ID: 1128249848

View in Genome Browser
Species Human (GRCh38)
Location 15:66156403-66156425
Sequence ACCAGCACCTGGTGGGTCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128249843_1128249848 -2 Left 1128249843 15:66156382-66156404 CCAAATTTCAAAATTCAAGCCAC 0: 1
1: 0
2: 0
3: 38
4: 287
Right 1128249848 15:66156403-66156425 ACCAGCACCTGGTGGGTCATCGG 0: 1
1: 0
2: 0
3: 11
4: 142
1128249842_1128249848 10 Left 1128249842 15:66156370-66156392 CCACAGAGAGGTCCAAATTTCAA 0: 1
1: 1
2: 4587
3: 20646
4: 17753
Right 1128249848 15:66156403-66156425 ACCAGCACCTGGTGGGTCATCGG 0: 1
1: 0
2: 0
3: 11
4: 142
1128249839_1128249848 22 Left 1128249839 15:66156358-66156380 CCAGCATGGCCTCCACAGAGAGG 0: 1
1: 0
2: 0
3: 27
4: 296
Right 1128249848 15:66156403-66156425 ACCAGCACCTGGTGGGTCATCGG 0: 1
1: 0
2: 0
3: 11
4: 142
1128249841_1128249848 13 Left 1128249841 15:66156367-66156389 CCTCCACAGAGAGGTCCAAATTT 0: 1
1: 0
2: 0
3: 18
4: 164
Right 1128249848 15:66156403-66156425 ACCAGCACCTGGTGGGTCATCGG 0: 1
1: 0
2: 0
3: 11
4: 142
1128249838_1128249848 30 Left 1128249838 15:66156350-66156372 CCTTCTCACCAGCATGGCCTCCA 0: 1
1: 0
2: 4
3: 31
4: 344
Right 1128249848 15:66156403-66156425 ACCAGCACCTGGTGGGTCATCGG 0: 1
1: 0
2: 0
3: 11
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128249848 Original CRISPR ACCAGCACCTGGTGGGTCAT CGG Intronic
900628858 1:3623342-3623364 ACCAGCACCTGTTGGATCCGCGG + Intergenic
900856465 1:5189179-5189201 ACCATGACCTTGTAGGTCATGGG - Intergenic
901604472 1:10448588-10448610 ACCACCCACTTGTGGGTCATAGG - Intronic
903288268 1:22290668-22290690 ACCAGCGCCAGGTGGGTCTAGGG - Intergenic
908977876 1:69920152-69920174 TCCAGGACCTGGTGGGACATGGG - Intronic
910820251 1:91338059-91338081 CCCAGCCCCTGGTGGCTCCTGGG + Intronic
913070342 1:115292920-115292942 ACCAGCGCCTGTGGGGTCACTGG + Intronic
916187098 1:162144218-162144240 ACCAGCCCTTGCTGGGGCATTGG + Intronic
916691618 1:167195390-167195412 ACTAGCCCCTGTTGGGTCACTGG + Intergenic
918718815 1:187826004-187826026 ACCAGCACCTGCTGTGGCATAGG + Intergenic
920081732 1:203379733-203379755 ATCACCACCTGGTTGTTCATTGG - Intergenic
920860015 1:209698355-209698377 ACTTGCCCCTGGTGGGACATAGG - Intronic
1063426436 10:5953565-5953587 AACAGCACTTGGTGAGTCTTTGG - Intronic
1064935107 10:20670790-20670812 CCCAGCTCCTGGTAGGTCCTTGG - Intergenic
1066075524 10:31871821-31871843 ACCAGCACATAGAGAGTCATGGG + Intronic
1070057851 10:72952806-72952828 AGCAGCAACTGGTGGGGGATGGG - Intronic
1070850921 10:79560912-79560934 GGCAGCACCTGGAAGGTCATGGG + Intergenic
1072364463 10:94695297-94695319 ACCAGGGCCTGTTGGGTGATTGG - Intronic
1074761596 10:116670568-116670590 GCCAGCACATGCTGGTTCATAGG - Intergenic
1076013370 10:127007903-127007925 ACCAGCATGTGGTGGGTGCTTGG + Intronic
1077508095 11:2941402-2941424 ACCTGCCCCTGCTGGGTCCTTGG - Intergenic
1079562033 11:21833680-21833702 ACCTCCAACTGGTGGGTGATAGG + Intergenic
1084219015 11:67666444-67666466 CCCAGCCCCTGGTTGGGCATGGG - Intronic
1084608878 11:70188087-70188109 ACCAGGGCCCGGTGGGTCCTGGG + Exonic
1085029309 11:73259977-73259999 ACCAGAACCTGGTGGGCATTGGG - Intergenic
1087730683 11:101775095-101775117 ACAAACACCAGGTGGGTCACAGG + Intronic
1093610250 12:21147437-21147459 ACCAGCACCTGTTGGGGGTTGGG - Intronic
1104839005 12:131811629-131811651 TCCAGAAGCTGGTGGGTCCTGGG - Intergenic
1105012567 12:132765589-132765611 TCCAGAACCTGGTGGGACCTGGG + Intergenic
1107332397 13:39315517-39315539 ACCAGCACCTAGCGGGGCAGGGG - Intergenic
1107675135 13:42788240-42788262 ACCACCAACTGGTGAATCATTGG - Intronic
1107720613 13:43244675-43244697 GCCAGCCCTTGGAGGGTCATAGG - Intronic
1108224471 13:48274170-48274192 CCCAGAACCTGGGGGGCCATTGG + Intergenic
1108704635 13:52974137-52974159 ACCAGCACCGTGTGGGGCACAGG - Intergenic
1118613960 14:67562629-67562651 GCCAGCCCCAGGTGGGCCATGGG + Exonic
1125753268 15:42045064-42045086 ACCTTCACCTGCTGGGTCACTGG - Intronic
1126466018 15:48962554-48962576 AGCAGGACCTGGTGGGACACAGG - Exonic
1127998772 15:64171749-64171771 GCCAGGGCCTAGTGGGTCATTGG - Exonic
1128249848 15:66156403-66156425 ACCAGCACCTGGTGGGTCATCGG + Intronic
1129515704 15:76155985-76156007 ACCAACATCTGGTGGGTTAGCGG - Intronic
1129781374 15:78274182-78274204 ACCAACACCTGCAGGGTCAGGGG - Exonic
1130959987 15:88652923-88652945 AGCAGCAGCTGGTGGCTGATGGG - Intronic
1132402813 15:101523796-101523818 ACCAGCAGCTGATGGGACAGAGG - Intronic
1132728646 16:1349877-1349899 GCCAGCACCCGGTAGGTCCTTGG - Exonic
1136444739 16:30309395-30309417 CCCAGCACATGGTGGATCGTTGG - Intergenic
1138271942 16:55701894-55701916 AGCACCACCTGGTGGCTCAGAGG + Exonic
1141252522 16:82371138-82371160 ACCAGCACCTGTTAGTTCCTGGG + Intergenic
1144556406 17:16286395-16286417 ACCAGCACCTGGTGACTGAACGG + Intronic
1147467958 17:40626422-40626444 CCCAGCACCTTTTGGGACATGGG + Exonic
1152330830 17:79671576-79671598 ACCAGGCCCTGCTGGGTCGTGGG + Intergenic
1152458661 17:80430104-80430126 CCCAGCACCAGGTGGGGCAGAGG + Intronic
1152729861 17:81964299-81964321 CCCAGCACCTGCTGGCCCATAGG - Intergenic
1160218810 18:76957416-76957438 ACCAGCCCCTGGAGGGACCTGGG - Intronic
1161534722 19:4811956-4811978 AGCAGGGCCTGGTGGGTCATGGG - Intergenic
1162067204 19:8133067-8133089 ACCAGCACCATGTGCGTCAACGG - Exonic
1162301992 19:9849518-9849540 TCCAGCACCTGGGGGGACACGGG - Exonic
1162386973 19:10365575-10365597 ACCAGCACCTCGTGGGTTGGGGG + Exonic
1163785125 19:19271020-19271042 ACCAGCATAGAGTGGGTCATAGG + Exonic
1168049284 19:53816668-53816690 ACCACCACCTGCGTGGTCATGGG - Intronic
925350507 2:3197953-3197975 TCCAGCACCAGCTCGGTCATTGG - Intronic
926109067 2:10170629-10170651 ATCAGCCCCAGCTGGGTCATGGG + Intronic
926387506 2:12351685-12351707 ACCAGCAGCTGATGGGACAATGG - Intergenic
926719558 2:15949620-15949642 TCCAGCACATGGAGGGCCATGGG - Intergenic
927027055 2:19079250-19079272 GCCAGCTCCTGGTGGGGCATTGG + Intergenic
927234475 2:20857884-20857906 CAAAGCACCTGGAGGGTCATTGG + Intergenic
929574645 2:43044040-43044062 CCCAGCACCTGGTGTGTGTTGGG + Intergenic
930433159 2:51306368-51306390 ACCATCACCTGATGAGCCATTGG + Intergenic
932472271 2:71967735-71967757 ACCAGCACCTGCTGGGTTTCTGG - Intergenic
932751766 2:74375813-74375835 ACCAGCTCCTGGTTGGTGATGGG - Intronic
933902366 2:86859224-86859246 CCCAGCAACTGATGGGTCACTGG + Intronic
934936079 2:98466389-98466411 ACCAGCACCTGTTGGCTCAAGGG + Intronic
935622393 2:105141561-105141583 ACCAGTACCAGGTGGGGCAATGG + Intergenic
935778179 2:106490044-106490066 CCCAGCAACTGATGGGTCACTGG - Intergenic
937205170 2:120231799-120231821 ACCAGCACAGGGTGGGGCGTGGG - Intergenic
938642314 2:133293820-133293842 AACAACTCCTGGTGGGTAATTGG + Intronic
938989165 2:136610349-136610371 ACCAGGACCTGTTGGGGGATGGG + Intergenic
940922929 2:159329892-159329914 AGTATCACCTGGTAGGTCATTGG - Intronic
942194515 2:173504300-173504322 ACAAGCACCTTTTGGCTCATGGG + Intergenic
946025423 2:216669142-216669164 CCTAGCACCTGGTGGCTTATTGG + Intergenic
948770398 2:240248725-240248747 CCCAGCACCTGGGGTGTCTTTGG - Intergenic
1169128024 20:3144875-3144897 ACAAGCACCTGTTGGGCCAATGG - Intronic
1169218023 20:3804554-3804576 AACGGCACCTGGGGCGTCATGGG - Exonic
1169544443 20:6636388-6636410 AGCACCACCTGGTGGAACATTGG - Intergenic
1170568711 20:17621079-17621101 ACCAGCACCAAGTGTGTCAATGG + Intronic
1172505796 20:35461494-35461516 CCCAGCTCCTGGTGGGTGAGGGG + Intronic
1174551688 20:51366944-51366966 TCCTGCACCTAGTGGGTCAAGGG - Intergenic
1180967042 22:19795797-19795819 AGCAGCAGCTGCTGGGCCATGGG - Intronic
1182144637 22:27989991-27990013 ACCAGCACCTGGTGGAGCTGAGG + Exonic
1184164477 22:42719782-42719804 CCGAGCACCTGGTGGGTCTCAGG - Intronic
953432531 3:42851621-42851643 TCCAGCACCTGGAGAGTGATGGG + Intronic
953545759 3:43862676-43862698 TGCAGCACCTGGTGGGTGCTGGG + Intergenic
957776158 3:84759284-84759306 AACAGCATCTGGTGGGTGAATGG + Intergenic
963158118 3:142121171-142121193 ACCAGCAACTGAGGGGTGATGGG + Intronic
963252421 3:143115545-143115567 ACCAGCACCTGGTACATTATAGG + Intergenic
968943687 4:3652562-3652584 GCGAGCAGCTGGTGGGTCAGAGG + Intergenic
973622854 4:52744667-52744689 ACCCCCACCTGGTGGCTCACAGG - Exonic
975587918 4:75969657-75969679 ACCAGCAGCTGCTGGGTCTGTGG - Intronic
976330505 4:83825839-83825861 ACCAGGACCTGTTGGGGGATGGG - Intergenic
976422504 4:84862482-84862504 ACCAGCACATAGTAGGTTATTGG - Intronic
977257291 4:94755326-94755348 ACCAGGACTTGGTTTGTCATAGG + Intergenic
981553188 4:145962566-145962588 ACCAGGACCTGTTGGGGCTTGGG - Intergenic
982011734 4:151112291-151112313 ACTTGCACCTGTTGGGTCAATGG + Intronic
983177345 4:164606097-164606119 ACCAGCACCATGTGTTTCATAGG - Intergenic
985062524 4:186093065-186093087 ACCAGCTCCTCATGGCTCATAGG - Intergenic
985489453 5:170926-170948 AACTGCACCTGGGGGGTCTTGGG + Intronic
985975801 5:3418304-3418326 TCCAGCTCCTGGTGGTTCCTTGG - Intergenic
986474193 5:8109163-8109185 ACCAAGACCTGGTGGGACAGAGG + Intergenic
990839668 5:60062901-60062923 ACCAGGGCCTGTTGGGTCATGGG + Intronic
990961118 5:61394476-61394498 ACCAGCACTGGGTGAGTCCTGGG + Intronic
992497812 5:77310364-77310386 ACCAGAACCTGCTGCGTCACTGG - Intronic
1000284100 5:159811660-159811682 ACCACCAACTGGTGGCTTATAGG - Intergenic
1001085679 5:168698702-168698724 GCCAGCACCTGGTGGGTGAAGGG - Intronic
1003533095 6:6954099-6954121 AGCAGCACCTGGTGGGGCCCAGG - Intergenic
1004287906 6:14339621-14339643 AGAAGCACCAGGTGGGTCAGGGG - Intergenic
1005589423 6:27309625-27309647 GCCAGCACCTGGTCAGGCATTGG - Exonic
1008866739 6:56221149-56221171 ACCAGCATCTGGTGGGTGGAAGG - Intronic
1015163159 6:130175275-130175297 CTCAGCACCTGGGAGGTCATGGG - Intronic
1015248542 6:131102843-131102865 ACCAGGAGCTGGTGGGTAATAGG - Intergenic
1015681048 6:135808764-135808786 AGCATGACCTGGTGGGTGATTGG + Intergenic
1019112334 6:169725517-169725539 ACCTGCACGTGGTGGGACAGAGG - Intronic
1019338417 7:495868-495890 ACCTGCACCAGGTGAGTCAATGG + Intergenic
1021386371 7:20035658-20035680 ACCTGCACTTGGTGGGTCACAGG + Intergenic
1026930658 7:74221445-74221467 TCCAGCCCCTGGTGGCTCAGGGG + Intronic
1028475912 7:91252897-91252919 ACCAGCGCCTGTTGGGGGATGGG - Intergenic
1029445934 7:100612814-100612836 ACCAGGAGCTGGTGGGTCCGGGG + Exonic
1032011061 7:128348319-128348341 CCCAGCACCTAGTACGTCATAGG + Intergenic
1032996422 7:137452140-137452162 ACCATCACCTGGTGGGGAGTTGG + Intronic
1034875503 7:154721330-154721352 CCCAGCAGCTGGTGGGTCAGGGG - Intronic
1035112045 7:156491316-156491338 ACCTGCACCTCGCAGGTCATGGG + Intergenic
1037880112 8:22569184-22569206 TCCAGCACCTGGTAGGTCGGGGG - Exonic
1039077805 8:33708306-33708328 AGCAGGAACTGGTGGGACATTGG + Intergenic
1042146008 8:65731031-65731053 ACCAGCACATGGTAGGTACTTGG - Intronic
1044147291 8:88732928-88732950 ACCAGTTCCTTGTGGGTAATGGG - Intergenic
1045962039 8:107979738-107979760 ACCAGCAGAAGGTGGTTCATTGG - Intronic
1047121835 8:121913411-121913433 ACCAGAAGCGGGTGGGTAATGGG - Intergenic
1048502933 8:134995085-134995107 ACCAGGGCCTGTTGGGGCATGGG - Intergenic
1049664411 8:143836670-143836692 ATCAGCACCAGGTGGGGGATGGG + Intronic
1057129017 9:92640426-92640448 CCCAGCAACTGGTGGGGCTTTGG + Intronic
1057317193 9:93977113-93977135 ACCTGCACCAGGTGAGTCAGGGG + Intergenic
1059739109 9:117132448-117132470 ACCAGATCCTGGTGGGGCCTAGG - Intronic
1060212398 9:121718518-121718540 ACCAGGGCCTGGTGGCTCAGGGG - Intronic
1062064222 9:134517690-134517712 ACCAGCAGCTGGTGAGACAAGGG - Intergenic
1062173165 9:135146547-135146569 TCCAGCTCCTGGTGGTTCCTTGG + Intergenic
1186792088 X:13009394-13009416 CCCAGCAGCTCTTGGGTCATAGG - Intergenic
1188343747 X:29038522-29038544 ATCAGAACATGATGGGTCATGGG - Intronic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1190988515 X:55522175-55522197 CCCAACACCTGGAGGGGCATGGG - Intergenic
1191013264 X:55783589-55783611 ACCAGTGCCTGATGTGTCATAGG - Intergenic
1197345355 X:125321896-125321918 ACCATCTCCTGGTGCATCATTGG - Intergenic
1199187053 X:144927497-144927519 ACCAGAACCTGTTGGGGGATGGG + Intergenic
1199617028 X:149664594-149664616 ACAAGAACCTGATGGGTCACTGG - Intergenic
1199625613 X:149738654-149738676 ACAAGAACCTGATGGGTCACTGG + Intergenic
1200971171 Y:9153963-9153985 ATCAGCTCCTGATAGGTCATGGG + Intergenic
1202139852 Y:21710334-21710356 ATCAGCTCCTGTTAGGTCATGGG - Intergenic