ID: 1128250895

View in Genome Browser
Species Human (GRCh38)
Location 15:66163707-66163729
Sequence CTGAGTTATGGGAAGGCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128250884_1128250895 1 Left 1128250884 15:66163683-66163705 CCCTGAGGATTTACAGCCTCCCT 0: 1
1: 0
2: 2
3: 16
4: 192
Right 1128250895 15:66163707-66163729 CTGAGTTATGGGAAGGCGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 163
1128250880_1128250895 25 Left 1128250880 15:66163659-66163681 CCTAATAGAGGATTGTTCTGCCA 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1128250895 15:66163707-66163729 CTGAGTTATGGGAAGGCGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 163
1128250882_1128250895 5 Left 1128250882 15:66163679-66163701 CCACCCCTGAGGATTTACAGCCT 0: 2
1: 0
2: 1
3: 18
4: 192
Right 1128250895 15:66163707-66163729 CTGAGTTATGGGAAGGCGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 163
1128250883_1128250895 2 Left 1128250883 15:66163682-66163704 CCCCTGAGGATTTACAGCCTCCC 0: 1
1: 0
2: 1
3: 16
4: 137
Right 1128250895 15:66163707-66163729 CTGAGTTATGGGAAGGCGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 163
1128250885_1128250895 0 Left 1128250885 15:66163684-66163706 CCTGAGGATTTACAGCCTCCCTC 0: 1
1: 0
2: 1
3: 16
4: 138
Right 1128250895 15:66163707-66163729 CTGAGTTATGGGAAGGCGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128250895 Original CRISPR CTGAGTTATGGGAAGGCGGG CGG Intronic
903849651 1:26298108-26298130 CTGAGTTGTGGGGGGGAGGGAGG + Intronic
904790397 1:33016026-33016048 CTGGGTTATGGGCAGGAGGGAGG + Intronic
905806701 1:40882423-40882445 CTGAGAGATGGGGAGGAGGGGGG + Intergenic
908328860 1:63050840-63050862 CTGAGTTCTGGGAATACAGGAGG - Intergenic
910462765 1:87466531-87466553 CAGAGTTATGGGCATGGGGGGGG + Intergenic
911057378 1:93720535-93720557 CTGTGGTCTGGGAAGGCGAGTGG - Intronic
912052632 1:105549187-105549209 GTGAGGTATGGGGAGGGGGGAGG - Intergenic
914412475 1:147444265-147444287 GTGAGGTAGGGGAAGGAGGGAGG + Intergenic
916323592 1:163533128-163533150 GTGACTTATGGGAAAGCCGGAGG + Intergenic
920045816 1:203131673-203131695 CTGAGTTAGGGAAAGGCTGCTGG + Intronic
920503018 1:206497363-206497385 CTGGTTTATGGGAAGGCTGGAGG - Intronic
921250616 1:213294271-213294293 CTGAGTTTTGCCAAGGAGGGTGG + Intergenic
921791401 1:219294696-219294718 CTGAGCTGTGGGAAGGCTTGAGG - Intergenic
922794635 1:228333967-228333989 CTGACTGATGGGCAGGCTGGAGG + Intronic
922980106 1:229818526-229818548 CTGACCTCTGGGAAGGCTGGTGG - Intergenic
923029220 1:230233978-230234000 ACAAGTTATGGGAAGGCGAGGGG + Intronic
1065177201 10:23089843-23089865 CACAGTTATGGGAAGGTGAGGGG + Intergenic
1068565361 10:58568757-58568779 CTGAGTTGAGGGAAGGCAAGGGG - Intronic
1070718963 10:78743360-78743382 CTGAATTACGGCAAGGCAGGAGG - Intergenic
1072403369 10:95127549-95127571 CACAGTTATGGGAAGATGGGAGG + Intergenic
1074328629 10:112479652-112479674 ATGAGTTACGGGAAGGTGGGGGG - Intronic
1075208375 10:120466876-120466898 CTCAGTTCTAGGAAGGAGGGAGG - Intronic
1081711696 11:45220757-45220779 CTTAGGTGTGGGAAGCCGGGTGG + Intronic
1082270022 11:50160290-50160312 CTGAGTGATGGGAAGGCATTGGG + Intergenic
1083655867 11:64229369-64229391 CTGGGTCTTGGGAAGGTGGGTGG + Intronic
1084546433 11:69817353-69817375 CTGCGCACTGGGAAGGCGGGAGG - Intronic
1084912618 11:72403301-72403323 CTGATTTAAGGGAAGGAGAGAGG - Intronic
1087267372 11:96075647-96075669 CTGAGCTAGGGGAAGTCGGGTGG + Intronic
1090245282 11:125211798-125211820 CTGAGCTTTGGGAATGGGGGAGG + Intronic
1091799182 12:3313947-3313969 CTGAGTAATGGGAAGGGTGGAGG - Intergenic
1098204977 12:68099153-68099175 CTGAGTTAAGGCAAGTTGGGAGG - Intergenic
1099782481 12:87215314-87215336 CTGAGTTAAGTGAGGGTGGGAGG - Intergenic
1100121621 12:91375267-91375289 CTGGGCAAAGGGAAGGCGGGTGG + Intergenic
1101303636 12:103505472-103505494 CTGAGTCATGGGAACGTGGTAGG + Intergenic
1102034164 12:109761474-109761496 CCGGGTTATGGGATGGCAGGGGG - Intronic
1102352474 12:112204290-112204312 CTGAGTTCTGGGAAGTGGGAAGG + Intronic
1102704694 12:114870828-114870850 CTGAGCAATGGGAAGACAGGAGG - Intergenic
1102820175 12:115901878-115901900 CTGAGTCCTGGGGAGTCGGGAGG + Intergenic
1104602977 12:130165478-130165500 CTGATTTGTGGAAAGGAGGGGGG + Exonic
1105332711 13:19432911-19432933 CTGAGTTAGAGGAAGGCTTGTGG + Intronic
1105878976 13:24586866-24586888 CTGAGTTAGAGGAAGGCTTGTGG - Intergenic
1105920861 13:24962184-24962206 CTGAGTTAGAGGAAGGCTTGTGG + Intergenic
1106020448 13:25909796-25909818 CTGAGTTGGGGGAGGGCGGCGGG - Intronic
1106046323 13:26145437-26145459 CTGAATCATGGGGAGGGGGGGGG + Intronic
1108589586 13:51901429-51901451 GTGAGGCATGGGAGGGCGGGTGG - Intergenic
1108626049 13:52229780-52229802 CTGAGTTAGAGGAAGGTGTGTGG + Intergenic
1108660014 13:52576699-52576721 CTGAGTTAGAGGAAGGTGTGTGG - Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1112649761 13:101382287-101382309 TTGTGTTATGGGGAGGGGGGCGG + Intronic
1115508881 14:34120343-34120365 CTGAGTTAGGGCAAGGGGGCTGG - Intronic
1115786935 14:36837105-36837127 CAGAGTGATGGGAAGGTGTGTGG + Intronic
1117516052 14:56502287-56502309 CTGAGTGATGGGAACCTGGGAGG - Intronic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1122931197 14:104933698-104933720 CTGAGTGAGGGAAGGGCGGGAGG + Exonic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931268 14:104933869-104933891 CTGAGTGAGGGGAGGGCGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1124231034 15:27946702-27946724 CTGAGAGATGGGCAGGCAGGAGG - Intronic
1124709336 15:31992653-31992675 CTCAGTTATGGGAACCCGTGTGG + Intergenic
1125033252 15:35093763-35093785 CTGAGTGGTGGGAGGGTGGGAGG + Intergenic
1127903450 15:63358560-63358582 ATGAGTGCTGGGAAGGCGGATGG - Intronic
1128146270 15:65334092-65334114 CTGAGTGATGGGGAGGGAGGGGG - Intronic
1128250895 15:66163707-66163729 CTGAGTTATGGGAAGGCGGGCGG + Intronic
1130888243 15:88111504-88111526 CTGGTTTGTGGGAAGGCAGGAGG + Intronic
1131422082 15:92315308-92315330 CTGAATTCTGGAAAGGCAGGAGG - Intergenic
1132744339 16:1430480-1430502 CTGAGCTCTGGGCAGGTGGGCGG + Intergenic
1133358293 16:5153295-5153317 CTGATTCATGGAAAGGCAGGAGG + Intergenic
1138028782 16:53542551-53542573 AGGTGTTGTGGGAAGGCGGGAGG + Intergenic
1138438650 16:57021050-57021072 CTGCGTCATGGGGAGCCGGGAGG + Intronic
1141225411 16:82110437-82110459 GTGAGTTCTGGGAAGGGGGGTGG - Intergenic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1142325029 16:89409227-89409249 CTGAGTCCTGTGGAGGCGGGTGG - Intronic
1143342386 17:6223084-6223106 CTGAGTTGGGGGGAGGGGGGAGG + Intergenic
1146300587 17:31686095-31686117 CTGAGTTATGGGTGGGGGTGAGG - Intergenic
1147309283 17:39584919-39584941 CTGAGGTATTGGAAGGCAGGTGG + Intergenic
1147519772 17:41159880-41159902 CTGAGTTATGGGAAGCTAGTTGG - Exonic
1151696862 17:75722274-75722296 CTGAGCCATGGGAAAGAGGGCGG - Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1157582550 18:48782039-48782061 CTGAGTGGTGGGCAGGAGGGTGG + Intronic
1159509313 18:69376066-69376088 CTCAGTTAAAGGAAGGAGGGTGG + Intergenic
1159559571 18:69979133-69979155 CTAAGTTATGGGAAGTAGGTAGG - Intergenic
1160523560 18:79522625-79522647 CTGAGGTGAGGGAAGGCTGGGGG - Intronic
1160534907 18:79586558-79586580 CTGGGTGGTGGGAAGGCGTGCGG + Intergenic
1161822048 19:6535578-6535600 CTGAGTTATGGTAATACGTGAGG + Exonic
1162562519 19:11425894-11425916 CTGAGTAAGGGGAAGGCTGGAGG + Intronic
1163342963 19:16721618-16721640 GTGAGTTGTGGGAAGGTGGCTGG + Intronic
1164857616 19:31537274-31537296 CTGGGTTATGGGAGGGTGAGAGG - Intergenic
1166357218 19:42234328-42234350 CAGAGTTATGGGAGGGTGGCGGG - Intronic
926874526 2:17460091-17460113 ATGAGTTGTGGGAAGTCGTGAGG + Intergenic
928915314 2:36464377-36464399 CTGGGAAATGGGAAGGCAGGAGG - Intronic
929364896 2:41142278-41142300 CTGAGTTATGAGAAAAGGGGAGG + Intergenic
929831700 2:45352113-45352135 ATGAGGCAAGGGAAGGCGGGAGG + Intergenic
931671217 2:64649820-64649842 CTGAGCTATGCGGAGGCGTGGGG - Intronic
933763574 2:85692412-85692434 CTGAGTTAGGGTAGGGCTGGGGG + Intronic
939394612 2:141612735-141612757 CTGAGTGATGCGAAGGCGAAAGG - Intronic
941412463 2:165176875-165176897 CAAAGTTATGAAAAGGCGGGGGG - Intronic
941673632 2:168321300-168321322 GCAAGTTATGGGAAGGTGGGGGG - Intergenic
1170725816 20:18925367-18925389 TTAAGGTATGGGAAAGCGGGAGG - Intergenic
1174661216 20:52214963-52214985 CTCAGCTATGGGGCGGCGGGGGG - Intergenic
1175191047 20:57212390-57212412 CTGAGCGCTGGGAAGCCGGGAGG + Intronic
1175830888 20:61965183-61965205 CTGAGGTCCGGGAAGGCGGGGGG + Intronic
1176079336 20:63264068-63264090 CTGATTTCTGGGAAGGGTGGGGG + Intronic
1176358345 21:5971597-5971619 ATGAGATATGGGGAGGGGGGGGG - Intergenic
1179099087 21:38340819-38340841 CTCAGTTAGGGAAAGGCTGGAGG - Intergenic
1179765173 21:43566953-43566975 ATGAGATATGGGGAGGGGGGGGG + Intronic
950156272 3:10723765-10723787 CTGAGTGTTGGGAAGGAGGGTGG + Intergenic
954265127 3:49465753-49465775 CTGGCTTCTGGGAAGGCTGGTGG + Intergenic
956379966 3:68654867-68654889 CTGAGTTTGGGGGGGGCGGGGGG + Intergenic
959189079 3:103086562-103086584 CTGAGGGATGGGAAGGTTGGAGG - Intergenic
962249601 3:133827756-133827778 CTCTGTGATGGGGAGGCGGGGGG - Exonic
963248287 3:143082907-143082929 CTGAGGTGGGGGAAGGGGGGTGG - Intergenic
965402090 3:168224163-168224185 CTGGGATATGGGCAGGCAGGCGG - Intergenic
965689846 3:171344003-171344025 TTGAGCAATGGGAAGGAGGGAGG - Intronic
973759476 4:54103203-54103225 CTAGGCTATGGGAAGGGGGGTGG - Intronic
983631561 4:169854444-169854466 CTCAGTAATGAGAAGGCGGCAGG + Intergenic
985990964 5:3560914-3560936 CTGGGATCTGGGAATGCGGGAGG - Intergenic
986730412 5:10631193-10631215 CTGAGACATGGGAGGGCAGGAGG + Intronic
988166445 5:27596166-27596188 CTGGGTTTTGGGGAGGGGGGTGG + Intergenic
990309495 5:54524388-54524410 CTGAGTTACTGGGAGGAGGGTGG - Intronic
990693886 5:58393361-58393383 CTGAGTTCTGAGAAGGGAGGAGG + Intergenic
994388678 5:99163531-99163553 CTCAGAAATGGGAAGGTGGGAGG + Intergenic
995242185 5:109898089-109898111 CTGAGAGATGGGAAAGAGGGAGG + Intergenic
996085977 5:119305788-119305810 CTGAGGTATGGGTAGGCCAGAGG + Intronic
996854181 5:127986603-127986625 CTGACTTAGGGGAAGGCTGATGG + Intergenic
997177610 5:131796328-131796350 CTGAGTTGAGAGAAGGCTGGAGG - Intronic
999288283 5:150407097-150407119 CTGAGTTGAGGGATGGTGGGAGG + Intronic
1003186863 6:3839742-3839764 CTGGGGTATGGGAGGGAGGGAGG - Intergenic
1004287332 6:14333813-14333835 ATGAGTTTTGGGAGGGAGGGTGG - Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006718609 6:36135911-36135933 CTGAGGTTTGGGGAGGCTGGAGG + Intronic
1007061262 6:38942753-38942775 CTGAGGTGTGGGAAGCCTGGAGG + Intronic
1008508455 6:52253904-52253926 CAGAGTTTTGGGATGGTGGGTGG + Intergenic
1010463284 6:76138041-76138063 GTGAGGTAGGGGAAGGGGGGAGG - Intergenic
1012831136 6:104204697-104204719 CTGACTTTTTGGAAGGAGGGAGG - Intergenic
1014249273 6:119099186-119099208 GTGAGGTATGGGAAGGGGTGTGG - Intronic
1014249361 6:119099787-119099809 GTGAGGTATGGGAAGGGGTGTGG - Intronic
1015579048 6:134703525-134703547 GTGAGTGGTGGGAAGGAGGGAGG + Intergenic
1015756236 6:136609502-136609524 CTGAGTTCTGGCTAGGCGTGGGG + Intronic
1017867453 6:158456149-158456171 GTAAGTTATGGGAAGGTGAGGGG + Intronic
1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG + Intergenic
1019870292 7:3754668-3754690 CTAAGTAAGGGGAAGGGGGGTGG + Intronic
1020073873 7:5244832-5244854 CTGAGTGATAGGAATGCAGGAGG + Intergenic
1020327214 7:6984162-6984184 CTGATTCATGGAAAGGCAGGAGG + Intergenic
1022109434 7:27219504-27219526 CTGAGTTGGGGGAAGGGGGGAGG + Intergenic
1023438173 7:40159709-40159731 CTGAGAGATAGGAAGGCAGGAGG + Intronic
1024903467 7:54349473-54349495 CTGAGTTGTGGGAAGACATGAGG + Intergenic
1026767704 7:73171045-73171067 CTGAGCTGTGGGGATGCGGGAGG + Intergenic
1027044170 7:74980753-74980775 CTGAGCTGTGGGGATGCGGGAGG + Intronic
1027079472 7:75221605-75221627 CTGAGCTGTGGGGATGCGGGAGG - Intergenic
1028999072 7:97134092-97134114 CTGAGCTTTGGAAAGGGGGGAGG - Intronic
1029388692 7:100260187-100260209 CTGAGCTGTGGGGATGCGGGAGG - Intronic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1034033812 7:147799043-147799065 ATGGGTTATGGGAAGGCCTGGGG - Intronic
1037223488 8:16554538-16554560 CTGAGGTCTGGGAAGGGGAGGGG + Intronic
1038136595 8:24792570-24792592 GAGAGTTCTGGGAAGGCTGGCGG - Intergenic
1045447583 8:102283325-102283347 CTTAGGAAGGGGAAGGCGGGGGG + Intronic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1050038933 9:1466816-1466838 CTGAGTTGGAGGAAGGAGGGAGG + Intergenic
1050407300 9:5323117-5323139 ATGAATTGTGGGAAGGCGAGAGG - Intergenic
1050414299 9:5399066-5399088 ATGAATTGTGGGAAGGCGAGAGG - Intronic
1057519705 9:95751534-95751556 CTGAGCTGTGGGAGGGAGGGAGG + Intergenic
1058902219 9:109451848-109451870 TAGTGTTATGGGAAGGCAGGAGG + Intronic
1059945123 9:119401826-119401848 CTCAGTCATGAGAAGGCAGGGGG - Intergenic
1060557493 9:124516174-124516196 CTGAGGAATGGGAAGGCAGCTGG + Intergenic
1060634409 9:125189153-125189175 CTGAGGAAGGGGAAGGCGGTGGG - Intronic
1060756189 9:126215638-126215660 GTGAGTGAGGGGAAGGCCGGTGG - Intergenic
1060995458 9:127873003-127873025 GTGAGTTGCGGGCAGGCGGGTGG - Intronic
1061219860 9:129244001-129244023 CTGTTTTATGGAAAGGCGGGTGG - Intergenic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1185505866 X:631919-631941 CTGAGCGCTGGGAAGGCGCGTGG - Intronic
1191154762 X:57261307-57261329 CTTTGTTAGGGCAAGGCGGGTGG + Intergenic
1195066026 X:101239167-101239189 ATGAGTTTGGGGAAGGCAGGAGG - Intronic
1197772495 X:130098108-130098130 CTGAGCCATGGGCAGGCAGGGGG + Intronic
1198060629 X:133042420-133042442 CTCAGCCAAGGGAAGGCGGGAGG - Intronic
1199719409 X:150531571-150531593 CTTAGTTCTGGGAAAGCGAGGGG + Intergenic
1200090912 X:153635538-153635560 CTGGGCTCTGGGGAGGCGGGTGG + Intergenic
1201317224 Y:12659539-12659561 AAGAGTTAACGGAAGGCGGGTGG + Intergenic