ID: 1128252080

View in Genome Browser
Species Human (GRCh38)
Location 15:66170810-66170832
Sequence TGCAGCCCCTGTCCAGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 1, 2: 3, 3: 29, 4: 314}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128252063_1128252080 21 Left 1128252063 15:66170766-66170788 CCCCATCCCCACCTCCCTCCCCA 0: 2
1: 5
2: 72
3: 482
4: 3779
Right 1128252080 15:66170810-66170832 TGCAGCCCCTGTCCAGGAGGTGG 0: 1
1: 1
2: 3
3: 29
4: 314
1128252067_1128252080 14 Left 1128252067 15:66170773-66170795 CCCACCTCCCTCCCCACAAGCAC 0: 1
1: 0
2: 6
3: 71
4: 809
Right 1128252080 15:66170810-66170832 TGCAGCCCCTGTCCAGGAGGTGG 0: 1
1: 1
2: 3
3: 29
4: 314
1128252073_1128252080 3 Left 1128252073 15:66170784-66170806 CCCCACAAGCACGGCCCTCAGCT 0: 1
1: 0
2: 2
3: 27
4: 211
Right 1128252080 15:66170810-66170832 TGCAGCCCCTGTCCAGGAGGTGG 0: 1
1: 1
2: 3
3: 29
4: 314
1128252070_1128252080 10 Left 1128252070 15:66170777-66170799 CCTCCCTCCCCACAAGCACGGCC 0: 1
1: 1
2: 3
3: 40
4: 409
Right 1128252080 15:66170810-66170832 TGCAGCCCCTGTCCAGGAGGTGG 0: 1
1: 1
2: 3
3: 29
4: 314
1128252071_1128252080 7 Left 1128252071 15:66170780-66170802 CCCTCCCCACAAGCACGGCCCTC 0: 1
1: 0
2: 2
3: 27
4: 265
Right 1128252080 15:66170810-66170832 TGCAGCCCCTGTCCAGGAGGTGG 0: 1
1: 1
2: 3
3: 29
4: 314
1128252059_1128252080 29 Left 1128252059 15:66170758-66170780 CCCCCACTCCCCATCCCCACCTC 0: 1
1: 2
2: 37
3: 436
4: 3286
Right 1128252080 15:66170810-66170832 TGCAGCCCCTGTCCAGGAGGTGG 0: 1
1: 1
2: 3
3: 29
4: 314
1128252060_1128252080 28 Left 1128252060 15:66170759-66170781 CCCCACTCCCCATCCCCACCTCC 0: 1
1: 4
2: 71
3: 440
4: 3034
Right 1128252080 15:66170810-66170832 TGCAGCCCCTGTCCAGGAGGTGG 0: 1
1: 1
2: 3
3: 29
4: 314
1128252075_1128252080 1 Left 1128252075 15:66170786-66170808 CCACAAGCACGGCCCTCAGCTGA 0: 1
1: 0
2: 0
3: 13
4: 132
Right 1128252080 15:66170810-66170832 TGCAGCCCCTGTCCAGGAGGTGG 0: 1
1: 1
2: 3
3: 29
4: 314
1128252064_1128252080 20 Left 1128252064 15:66170767-66170789 CCCATCCCCACCTCCCTCCCCAC 0: 1
1: 5
2: 85
3: 417
4: 3686
Right 1128252080 15:66170810-66170832 TGCAGCCCCTGTCCAGGAGGTGG 0: 1
1: 1
2: 3
3: 29
4: 314
1128252068_1128252080 13 Left 1128252068 15:66170774-66170796 CCACCTCCCTCCCCACAAGCACG 0: 1
1: 0
2: 3
3: 53
4: 549
Right 1128252080 15:66170810-66170832 TGCAGCCCCTGTCCAGGAGGTGG 0: 1
1: 1
2: 3
3: 29
4: 314
1128252061_1128252080 27 Left 1128252061 15:66170760-66170782 CCCACTCCCCATCCCCACCTCCC 0: 1
1: 5
2: 55
3: 548
4: 3571
Right 1128252080 15:66170810-66170832 TGCAGCCCCTGTCCAGGAGGTGG 0: 1
1: 1
2: 3
3: 29
4: 314
1128252065_1128252080 19 Left 1128252065 15:66170768-66170790 CCATCCCCACCTCCCTCCCCACA 0: 1
1: 11
2: 66
3: 742
4: 5064
Right 1128252080 15:66170810-66170832 TGCAGCCCCTGTCCAGGAGGTGG 0: 1
1: 1
2: 3
3: 29
4: 314
1128252062_1128252080 26 Left 1128252062 15:66170761-66170783 CCACTCCCCATCCCCACCTCCCT 0: 1
1: 1
2: 63
3: 855
4: 5579
Right 1128252080 15:66170810-66170832 TGCAGCCCCTGTCCAGGAGGTGG 0: 1
1: 1
2: 3
3: 29
4: 314
1128252066_1128252080 15 Left 1128252066 15:66170772-66170794 CCCCACCTCCCTCCCCACAAGCA 0: 1
1: 0
2: 7
3: 98
4: 1035
Right 1128252080 15:66170810-66170832 TGCAGCCCCTGTCCAGGAGGTGG 0: 1
1: 1
2: 3
3: 29
4: 314
1128252074_1128252080 2 Left 1128252074 15:66170785-66170807 CCCACAAGCACGGCCCTCAGCTG 0: 1
1: 0
2: 1
3: 23
4: 190
Right 1128252080 15:66170810-66170832 TGCAGCCCCTGTCCAGGAGGTGG 0: 1
1: 1
2: 3
3: 29
4: 314
1128252072_1128252080 6 Left 1128252072 15:66170781-66170803 CCTCCCCACAAGCACGGCCCTCA 0: 1
1: 0
2: 0
3: 11
4: 199
Right 1128252080 15:66170810-66170832 TGCAGCCCCTGTCCAGGAGGTGG 0: 1
1: 1
2: 3
3: 29
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128252080 Original CRISPR TGCAGCCCCTGTCCAGGAGG TGG Intronic
900243793 1:1628706-1628728 TGCAGCTGCTGTCCAGGGTGAGG + Exonic
900347083 1:2215078-2215100 GCCAGCCCCTGACAAGGAGGGGG + Intergenic
900521582 1:3107925-3107947 TGCAACCCCTGCCGGGGAGGGGG + Intronic
900575778 1:3381900-3381922 CACAGCCCCTGTACAGGTGGTGG - Intronic
900582454 1:3415769-3415791 TGCAGCCCGGAGCCAGGAGGTGG + Intronic
900981469 1:6048500-6048522 AGCTGCCCCTGTCCAGAAGCTGG + Intronic
901459550 1:9383362-9383384 TGCAGCCCCGAGCCTGGAGGTGG - Intergenic
901734770 1:11305664-11305686 GCCAGCCCCCGTCCGGGAGGTGG - Intergenic
902251569 1:15156946-15156968 TGCACCACCTGTCCAGGCTGGGG - Intronic
903859115 1:26354526-26354548 TGCTCCCCATGTCCAGGAGCAGG + Intergenic
904035727 1:27557450-27557472 AGCAGCAACTTTCCAGGAGGAGG - Intronic
905856920 1:41320425-41320447 AGCAGCCCCTGTGCAGGGGAGGG + Intergenic
906617532 1:47244089-47244111 TTCAGCCTCTGACCAGGAAGTGG + Intergenic
907370853 1:54002527-54002549 TGCAGCCCCTCCTCAGAAGGAGG + Intergenic
908114279 1:60925613-60925635 TGCTGCGCCTGGCCGGGAGGTGG + Intronic
912727000 1:112067545-112067567 TGCAGCCCCTTTCAAGGTGTAGG + Intergenic
914423151 1:147548506-147548528 TGCATACCCAGTCTAGGAGGTGG - Intronic
914680927 1:149937724-149937746 TGCAGCTCCTTTAAAGGAGGGGG + Intergenic
915586312 1:156845694-156845716 GGCAGAACCTGACCAGGAGGTGG + Exonic
917907813 1:179605462-179605484 ACCAGCACCTGTTCAGGAGGAGG + Intronic
919640328 1:200039642-200039664 TGCTGCCCGTGTCCAGGTGCTGG + Exonic
920416220 1:205800758-205800780 GGGAGCCCCTGCCCAGGAGCAGG + Intronic
920959859 1:210654749-210654771 TGCAGCCCCTAGGAAGGAGGTGG + Intronic
922422707 1:225470407-225470429 TGCAGCCCATTCCCAGGTGGGGG + Intergenic
922777043 1:228219619-228219641 GTCAGCACCTGTCCAGGCGGTGG + Intronic
924825325 1:247532289-247532311 TGAAGCTCATGTCCAGGAAGGGG + Exonic
1062780384 10:199549-199571 TGTAGTCCCAGTCAAGGAGGAGG - Intronic
1062993902 10:1847267-1847289 TGGAGGCGCTGTCCAGGTGGGGG + Intergenic
1064227934 10:13503960-13503982 TGCAGCTGCTGCCTAGGAGGAGG + Intronic
1065561603 10:26969520-26969542 TGGAGTCCCTGCCAAGGAGGTGG - Intergenic
1066063656 10:31746201-31746223 TGAAGCCCATGGCCAGGTGGCGG - Intergenic
1067510501 10:46891060-46891082 TTCAGACCCTATCCAGGAGCTGG - Intergenic
1067651752 10:48160802-48160824 TTCAGACCCTATCCAGGAGCTGG + Intronic
1072614457 10:97040136-97040158 CGAAGCCCCTGTCAGGGAGGTGG + Intronic
1072775636 10:98189889-98189911 TGAAGCGCCTGTGCAGGAGAAGG + Intronic
1073774521 10:106770960-106770982 TGCTGCCCCTTACCAGGAGCAGG - Intronic
1074564183 10:114562124-114562146 GCCAGCCCCTGACCTGGAGGAGG - Intronic
1075415270 10:122258152-122258174 TGCAGCCCCTGGGGAGGAGGAGG - Intergenic
1075644630 10:124089608-124089630 AGCATCCCCTGTTCAGGGGGTGG + Intronic
1076403266 10:130196896-130196918 GGCTGCCCCTCTCCAGGTGGAGG + Intergenic
1076858472 10:133128668-133128690 TGAAGACCATGTCCAGGAAGTGG - Exonic
1076889034 10:133275069-133275091 GGCAGCCCCAGTCGGGGAGGGGG + Intronic
1077014709 11:394418-394440 GGCAGCCCGCGTCCAGGAGCAGG + Exonic
1077058902 11:609179-609201 GGCTCCCCCTGTCCTGGAGGTGG + Exonic
1077187671 11:1242744-1242766 TGCAGTCCCTGGACTGGAGGAGG - Exonic
1077188631 11:1246515-1246537 TGCAGTCCCTGGACTGGAGGAGG - Exonic
1077189613 11:1250370-1250392 TGCAGTCCCTGGACTGGAGGAGG - Exonic
1077385448 11:2267515-2267537 TGCAGCCTCAGTCCAGGTGGGGG - Intergenic
1077541487 11:3148518-3148540 TCCAGCGGCTGTCCAGGTGGAGG + Intronic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1081318482 11:41660783-41660805 TGCAGCCCTTCTCCTGCAGGGGG - Intergenic
1081814438 11:45930626-45930648 TGCAGCGCCTGGACAGGAGCTGG + Intronic
1082989455 11:59194949-59194971 AGAAGCCCCTGTCCCTGAGGAGG - Intronic
1083671793 11:64304068-64304090 TGCAGCCCCTCTCCAGCTGAGGG + Intronic
1083747122 11:64742833-64742855 TGCAGCCCTTGTCCAGGTCCAGG + Exonic
1083747191 11:64743024-64743046 CTCCGCCCCTGTCCAGCAGGGGG - Intronic
1084505952 11:69568137-69568159 TGCAACCCCAGCCCTGGAGGTGG + Intergenic
1087630797 11:100648089-100648111 TGCAGCCCCTGTGGGGGATGGGG - Intergenic
1088010995 11:105001005-105001027 TGCAGCGCCTTCCCAGTAGGGGG - Intronic
1088230783 11:107671610-107671632 TGAGGCCCATGTCCAGGATGAGG - Intergenic
1088610839 11:111575061-111575083 GGCAGCCCCTGGCCAGAAGGAGG - Intergenic
1088712969 11:112524896-112524918 TGCAGCTCCTGTCCAGGGCTTGG - Intergenic
1089292790 11:117448422-117448444 TGCTGCCCCTGTCCTCGTGGGGG + Intronic
1089301555 11:117502016-117502038 TGCAGCATGTGTTCAGGAGGTGG + Intronic
1089397192 11:118144153-118144175 TGCCTCCCCTGTCCAGGACCAGG + Intronic
1089625524 11:119748558-119748580 AGCTGCCCCTGGCCAGGAAGTGG - Intergenic
1089646118 11:119880237-119880259 GGCAGGGCCTGTCCTGGAGGAGG + Intergenic
1089711308 11:120316887-120316909 TGCAGCCCCAGACCAAGAGGCGG - Intronic
1089930606 11:122307144-122307166 AGTGGCCTCTGTCCAGGAGGAGG - Intergenic
1090226653 11:125075908-125075930 TGGAGCCCCAGTCCAGGAGAAGG - Intronic
1092238896 12:6825769-6825791 TGCAGATTCTGTCCAGTAGGGGG - Intronic
1093795683 12:23307779-23307801 TGCAGTCCATCACCAGGAGGAGG - Intergenic
1093884776 12:24447132-24447154 AGCAGCCCCTGCTCAAGAGGAGG - Intergenic
1094000810 12:25692136-25692158 TGCAGCCCCTCTTGAGGAGCTGG + Intergenic
1094427445 12:30329797-30329819 TGCAGCCACTGTCCCAGATGTGG - Intergenic
1095345544 12:41144751-41144773 TGCAACCCATTCCCAGGAGGAGG - Intergenic
1096556063 12:52404655-52404677 TGCAGCCACTGACCAGAAGTAGG - Intronic
1096597988 12:52709337-52709359 TGCAGCCCCGGTCTAGGAATGGG + Intergenic
1098322318 12:69258652-69258674 GGCAGAACCTGACCAGGAGGTGG - Exonic
1099392393 12:82097608-82097630 TATGGCCCCTGGCCAGGAGGTGG + Intergenic
1100135126 12:91544842-91544864 TGCAGGCTCTGTCCAGGGGGTGG - Intergenic
1100190432 12:92185162-92185184 TGCAGCCTCTGGCCAACAGGTGG - Intergenic
1103008511 12:117439883-117439905 GGCAGCGTCTGCCCAGGAGGAGG + Intronic
1103993493 12:124814652-124814674 TCCAGCCCCAGTCCCAGAGGCGG + Intronic
1104799532 12:131544267-131544289 TGCAACCCCTGACCAGGAGTCGG + Intergenic
1104914325 12:132257006-132257028 TTCAGCAGCTGTCCAGGTGGTGG + Intronic
1104987457 12:132604859-132604881 TGCAGGCCCTGCCCAGGAACAGG - Intronic
1105804633 13:23945974-23945996 AGCAGCCCCTGCTCAGGAGCCGG - Intergenic
1106342387 13:28842915-28842937 GGCAGCACCTGTCCCAGAGGGGG - Intronic
1107830903 13:44373466-44373488 TCCAGCCCTCGTCCAGGGGGCGG + Intergenic
1108509044 13:51138111-51138133 GGCAGGCCCTGGCGAGGAGGAGG + Intergenic
1112434370 13:99381173-99381195 TGCAGGCCCTGCCCTGGAGAGGG - Intronic
1113797368 13:113066290-113066312 TGCTGGCCCTGGCCAGGAGTGGG - Intronic
1114358383 14:21941059-21941081 TTCAGCCCCTGTCCACCAGAGGG + Intergenic
1114372685 14:22107906-22107928 TGCAGCCACAGTACAGGAGCAGG - Intergenic
1117392006 14:55271498-55271520 TGCAGCCCCGGGCCAGGCCGCGG + Exonic
1117776574 14:59189568-59189590 TGAAGCCCTGGGCCAGGAGGTGG + Intronic
1118684049 14:68273229-68273251 GGCAGCTCCTGAGCAGGAGGAGG + Intronic
1119163351 14:72471538-72471560 TGCAGCCCGTGGCCTGGAGCCGG + Intronic
1119904162 14:78286370-78286392 TTCCCTCCCTGTCCAGGAGGGGG + Intronic
1122087613 14:99318403-99318425 GGCAGCCTCTGTCCAGGTGCGGG + Intergenic
1122402663 14:101476494-101476516 TGCATCGCCTGTCCTGGTGGGGG - Intergenic
1123932305 15:25177784-25177806 TGCAGCCCATGTCCCGCTGGGGG + Intergenic
1124827531 15:33113685-33113707 TGGGGCCCCTGTCTAGAAGGGGG - Intronic
1125706287 15:41739830-41739852 TGAAGCCCCTGTCAAGGGAGAGG + Intronic
1125841072 15:42801639-42801661 TGCTGTCCATGTCCAGGAAGCGG + Intronic
1126573237 15:50173014-50173036 GGCAGCCCCCATCCGGGAGGTGG + Intronic
1126954083 15:53913465-53913487 TGCTTTCCCTGTCCAGGGGGTGG - Intergenic
1127084007 15:55408098-55408120 AGCAGCCCCAGCCTAGGAGGCGG + Intronic
1127827779 15:62719917-62719939 GGCAGCCCCTGCCCAGAAGAGGG - Intronic
1128252080 15:66170810-66170832 TGCAGCCCCTGTCCAGGAGGTGG + Intronic
1129155627 15:73715628-73715650 TGCAGACCCTGGGCAGCAGGAGG + Intergenic
1129232705 15:74205674-74205696 TGCAGCCCCTGGGCAGATGGAGG - Intronic
1131024649 15:89129695-89129717 TGAAGCCACTGGCCAGCAGGGGG - Intronic
1132312034 15:100864232-100864254 TGCAGCCCCTTTCCTTGAAGTGG + Intergenic
1132722094 16:1321395-1321417 TGCATCTCCTGGTCAGGAGGGGG + Intronic
1134064915 16:11221923-11221945 GGCTGCCTCTGGCCAGGAGGTGG + Intergenic
1134265707 16:12690913-12690935 GGCAGCCCCTGTAGAGGAGCAGG + Intronic
1140037703 16:71383739-71383761 AGCTGCCCCTGTCCCTGAGGAGG + Intronic
1140388755 16:74566269-74566291 TACTTTCCCTGTCCAGGAGGTGG - Intronic
1142009289 16:87705746-87705768 TCCAGCCCTTGTCCAGAAGATGG - Intronic
1142256248 16:89015175-89015197 TGCATCCCCCCGCCAGGAGGTGG + Intergenic
1142264603 16:89057930-89057952 TCCTGCAGCTGTCCAGGAGGAGG - Intergenic
1142889251 17:2932353-2932375 TGCAGCCCCAGTGGAGGAGGAGG + Intronic
1142985382 17:3691930-3691952 TGTGGCCCCTGCCCAGGAGCTGG - Intronic
1143126131 17:4641831-4641853 TTCAGCCCCAGTCCAAAAGGCGG + Intronic
1143483653 17:7240828-7240850 TGCTGCCCCTGAGCTGGAGGGGG - Exonic
1144782597 17:17815457-17815479 TGCAGCCCCTGCCAAGGACAGGG + Intronic
1144829057 17:18121619-18121641 TGCACCTCCTGGCCAGGGGGAGG - Exonic
1144836179 17:18157864-18157886 TGCAGCCGCTGCACAGGAGGTGG + Exonic
1145815735 17:27793767-27793789 TGCAGCCCCCGCCCCGGGGGCGG + Intronic
1146280704 17:31542348-31542370 GGCAGCCCCTGACCAAAAGGTGG + Intergenic
1147914557 17:43878750-43878772 TGCTGCGCCTTCCCAGGAGGTGG - Intronic
1148197172 17:45722335-45722357 TGAGGCCACTGTCCAGCAGGGGG + Intergenic
1150137137 17:62702234-62702256 TGCAGTCCCAGTGGAGGAGGTGG + Intronic
1150636399 17:66916239-66916261 TGCATCTCCTCTCCCGGAGGTGG - Intergenic
1151458190 17:74239191-74239213 TGCTGCCCCTCTCCAGGTGCAGG + Intronic
1152347142 17:79760147-79760169 TGAAGGCCTTGTCCAGGAGCAGG + Intergenic
1152363382 17:79842467-79842489 ACCAGCCCCTGTCTGGGAGGGGG - Intergenic
1152584929 17:81184750-81184772 TCCAGGGCCTGTCCGGGAGGAGG + Intergenic
1152716880 17:81904508-81904530 TGTGGCCTCTGTCCAGGTGGTGG + Exonic
1155153715 18:23141598-23141620 TGTAGCCCCAGGCCAGGCGGGGG + Intronic
1155294679 18:24374307-24374329 TGCTGCCCTGGTACAGGAGGAGG + Intronic
1156357121 18:36351341-36351363 GGCAGCCTCTATCCTGGAGGGGG + Intronic
1157298873 18:46465434-46465456 AGCAGTCCCTGTCCAGCAGGGGG + Intergenic
1159559976 18:69983697-69983719 TGCATCCCCTGTCCTGGAGGAGG - Intergenic
1159560084 18:69984292-69984314 TGCATCACCTATCCTGGAGGAGG + Intergenic
1160294373 18:77623899-77623921 TGCAGCCCCTCTCGTGGAAGGGG - Intergenic
1160706499 19:532440-532462 TCCAGCCCCCGCCAAGGAGGAGG - Intronic
1160793496 19:933512-933534 TCCAGCCCCGGGCGAGGAGGTGG - Intronic
1160801927 19:974276-974298 CACACCCCCTTTCCAGGAGGGGG + Exonic
1161683684 19:5692947-5692969 TGGAGCCCCTGGCCAGGGGCTGG - Intronic
1162032800 19:7924762-7924784 TGCACCGCCTGTCCCGGAGACGG - Exonic
1162115514 19:8426916-8426938 TACCGCCCCTGTCCACCAGGTGG + Intronic
1164988884 19:32670275-32670297 TGAATCCTCTGTCCAGGAGTAGG + Intronic
1165046373 19:33108164-33108186 TGCAGCAACGGTCCAGGTGGAGG - Intronic
1166855874 19:45782419-45782441 GGCAGCCCCTGTCCAGGCCCTGG + Intronic
1167253454 19:48413976-48413998 TGAAGTACCTGCCCAGGAGGAGG - Exonic
1167373344 19:49097977-49097999 TGCAGTCTGTGTCCAGTAGGTGG + Intronic
1167645864 19:50704424-50704446 TGCAGCCCCAGACCTGGAAGGGG + Exonic
1167738900 19:51312237-51312259 TGCGGCTCCTGTTGAGGAGGGGG + Intronic
1167866986 19:52336654-52336676 CGCAGCCCCAGTCCCGGCGGGGG + Intronic
1168267990 19:55232604-55232626 TGAAGCCTCTGTCCAGAGGGTGG - Intronic
1168310826 19:55459737-55459759 TTCCTCCCCTGTGCAGGAGGCGG + Intronic
1168560675 19:57380199-57380221 TGCCGCCGCTGATCAGGAGGTGG + Intronic
925538192 2:4938502-4938524 TGCAGCCTCTGTACAGCAAGAGG - Intergenic
926086174 2:10021782-10021804 TGCACCATCTGTCCAGGAGCGGG + Intergenic
926646937 2:15300211-15300233 TGCAGCGCATATCCAGGAGGTGG + Intronic
932421128 2:71602071-71602093 TGAAGCCCCCGTCCAGGAAGAGG - Intronic
932739789 2:74282799-74282821 TGCAGACCCTGTCCAGGGTGTGG + Intronic
935185644 2:100730443-100730465 TCCAGCCCCTCTCCTGGAGGTGG + Intergenic
936081238 2:109434076-109434098 TGAAGCCCCTGGCCTGGAGTTGG + Intronic
945480402 2:210338311-210338333 TGAAGCCCCAGTACAGGAGAGGG - Intergenic
947201428 2:227617824-227617846 TGCAGCCCCTGCCCAGAGGCCGG - Intronic
947838065 2:233189383-233189405 TGCAGCCACAGTCCTGGAGGGGG + Intronic
1168978383 20:1985025-1985047 TGAAGCCCCTGGCCAGGGTGGGG - Intronic
1168992912 20:2109909-2109931 TACAGCCCCTGTCCGGCCGGTGG + Intronic
1169781533 20:9315588-9315610 GGCAGGCCCTATTCAGGAGGTGG + Intronic
1170501359 20:16977560-16977582 TGCAGCTACTGTCCAGGCTGAGG - Intergenic
1170573373 20:17645220-17645242 TGCTGCCCCTGTGCAGGAAGCGG - Intronic
1170914508 20:20609701-20609723 GGCAGCCCAGGTCCAGGACGGGG + Intronic
1171461356 20:25299815-25299837 GGCACACCCTGGCCAGGAGGGGG + Intronic
1172539236 20:35698531-35698553 TACAGCCGCTGCCCCGGAGGTGG - Exonic
1175956339 20:62611483-62611505 TGGAGCTCAAGTCCAGGAGGTGG + Intergenic
1176018687 20:62951969-62951991 TGCAGCCTTTCCCCAGGAGGCGG - Intergenic
1176179583 20:63743036-63743058 TTCAGCCCCGGGCCTGGAGGGGG - Exonic
1178404985 21:32316592-32316614 GGCAGGGCCTGTGCAGGAGGTGG - Exonic
1179408236 21:41142729-41142751 TCCAACTCCTGTTCAGGAGGAGG - Intergenic
1180082058 21:45491445-45491467 TGCAGCCCCCACCGAGGAGGTGG - Intronic
1180157948 21:45987074-45987096 TGAGGCCCCTGCCCAGGAGACGG + Intronic
1182070839 22:27462581-27462603 TGCAGCCCCTGCGCAGGAGGGGG + Intergenic
1182366219 22:29781176-29781198 TGCAGCCCCAGGGCAAGAGGTGG - Intergenic
1183095433 22:35549153-35549175 TCCTGCCCCTGCCCCGGAGGTGG + Intronic
1183199122 22:36373648-36373670 CCCAGGCCCTGTCCTGGAGGGGG - Intronic
1183269752 22:36853691-36853713 CGCTGCCCTTGGCCAGGAGGGGG - Intergenic
1183481838 22:38069442-38069464 TGCCTCCTTTGTCCAGGAGGTGG + Intronic
1183909551 22:41068177-41068199 GGCAGCACCTGTCCAGGACTTGG - Intergenic
1184682924 22:46081652-46081674 TGCCACCTCTGTCCAGGAGCTGG + Intronic
1184788905 22:46687268-46687290 TGCAGCCCCTGTCCAGGAGTGGG - Intronic
1184872787 22:47251608-47251630 CTGAGCCCCTGTCCTGGAGGTGG + Intergenic
1185056069 22:48578921-48578943 AGCAGCCGCTGTCCAGCAGGAGG + Intronic
1185117490 22:48945954-48945976 TGCTGCCCCAGTGCTGGAGGAGG + Intergenic
1185172515 22:49302080-49302102 GACAACCCCTGCCCAGGAGGTGG + Intergenic
1185338551 22:50281605-50281627 TGCAGCCCCCGCCCAAGCGGCGG - Exonic
1185418058 22:50720747-50720769 GGCAGCCCCGGTCCCGGCGGCGG + Intergenic
949783508 3:7715916-7715938 TGCAGCCTCTTTTTAGGAGGAGG - Intronic
950551368 3:13668216-13668238 TGCTGCCCATTTCCAGGTGGGGG + Intergenic
950741579 3:15056525-15056547 TGCAGCACCTGACCAGGCTGTGG + Intronic
956322803 3:68017260-68017282 TCAAGCACCTGTCCAGTAGGTGG - Intronic
960593003 3:119383132-119383154 TGCAGTCCGGGTCCAGCAGGTGG + Exonic
961062731 3:123845177-123845199 TGCAGCCCCTTTCCACAGGGAGG - Intronic
962207644 3:133448026-133448048 TGCAGCCACTCTCCTGGAGATGG + Intronic
962269301 3:133966478-133966500 TGCAGCCCCAGGCCAAGAAGAGG + Intronic
963233822 3:142936172-142936194 TGCATCCACTGGCAAGGAGGTGG + Intergenic
966912143 3:184565601-184565623 TGCTGCCCCTGTGAAGGAGGTGG - Intronic
967980783 3:195063977-195063999 TGCTGGGCGTGTCCAGGAGGTGG - Intergenic
967986093 3:195096260-195096282 TGCAGCCCATGCACAGCAGGAGG + Intronic
968550927 4:1223076-1223098 TGCTGGCCTTGTCCAGGGGGCGG - Intronic
969112532 4:4852703-4852725 TGCAGAGCATCTCCAGGAGGGGG - Intergenic
969184653 4:5466187-5466209 AGGAGCCCCTGGCCAGGAGCAGG + Intronic
970007294 4:11424098-11424120 TGCAGCCCCTGTGCTGGATCTGG + Intronic
971359497 4:25923678-25923700 TGCTGCCCCTGCCCAAAAGGAGG + Intronic
971405635 4:26319498-26319520 TGCAGCGCGTGCCCGGGAGGCGG - Intronic
972425660 4:38930108-38930130 TGCAGCCCCTGTGCTCCAGGTGG - Intronic
976043661 4:80918719-80918741 TGCTGCCCCTGTCCAGGCACAGG + Intronic
980847630 4:138343141-138343163 TGGAGCGCCTGTCCAAGAGCCGG + Intergenic
981702061 4:147617795-147617817 CACAGCGCCGGTCCAGGAGGCGG + Exonic
982212074 4:153045844-153045866 TGCAACCCATGTGCAGGAGTTGG - Intergenic
985472479 5:54323-54345 TGCAGACCCCACCCAGGAGGAGG + Intergenic
985711496 5:1432145-1432167 AGCAGACCCTGTGCAGAAGGTGG - Intronic
986719624 5:10551698-10551720 TGTAGCCCCTGTCCTGTAAGAGG - Intergenic
991935220 5:71794075-71794097 CGCTGCCCCTGTCTGGGAGGTGG - Intergenic
992749531 5:79849564-79849586 TGCAGCCCCTGGACAAGTGGCGG - Intergenic
994512498 5:100722811-100722833 TGCAGCCCCCTTCCAAGAGAAGG - Intergenic
997647229 5:135489493-135489515 TCCAGCCCCTGTCCGGCCGGAGG + Intergenic
998648395 5:144090160-144090182 TGCAGCCCCTTTCCTGGGGCTGG + Intergenic
999264063 5:150255177-150255199 TGCAGCCCCTGCACTGGAGGAGG - Intronic
1000157720 5:158568279-158568301 TGGAGCCCAGGTTCAGGAGGAGG - Intergenic
1001598074 5:172911043-172911065 TGGAACCCCAGTCCAGGAGAGGG - Intronic
1001934479 5:175694615-175694637 TGCAGCCCCTGTGGAGGAGAGGG + Intergenic
1002901042 6:1410015-1410037 TGCAGCCCCCGTCCATGCGGTGG + Intergenic
1003375423 6:5572431-5572453 TGCATCCCCAGTGCTGGAGGTGG - Intronic
1005135960 6:22570061-22570083 GGCAGCCCCCGACCAAGAGGAGG + Exonic
1005661397 6:28002501-28002523 TGCCGTCCCTGTCCAGGGTGGGG - Intergenic
1006442282 6:34060064-34060086 TGCTGGGCCTGTGCAGGAGGCGG + Intronic
1006578043 6:35060244-35060266 TGCAGCCACTTACCAGGAAGTGG - Exonic
1006735050 6:36267609-36267631 TGAAGCCCATGTACAGCAGGTGG + Intronic
1006946603 6:37788521-37788543 TCCAGCCCCTTTCTAGGAGCAGG - Intergenic
1007356115 6:41319016-41319038 AGCAGCCTCTGGCCAGCAGGGGG - Intergenic
1007414613 6:41684350-41684372 TTCAGCCCCTCTCCCGGAGATGG - Exonic
1007607796 6:43129101-43129123 TGGGGCCCCTGTCCAGGACACGG + Exonic
1008097596 6:47355311-47355333 TGGAGCCCCTGTTCTGGAGCAGG - Intergenic
1008290126 6:49705182-49705204 TGCAGCCACTGTGCAAGATGGGG + Intronic
1011640707 6:89413555-89413577 TGCAGACACTTTCCAGAAGGTGG + Intergenic
1013599486 6:111691159-111691181 AGCAGCCCATGTCAGGGAGGTGG - Intronic
1013797903 6:113906481-113906503 CCCAGCCCCTGTCTAGAAGGAGG + Intergenic
1015672388 6:135705161-135705183 TTCAGTGCCTGTTCAGGAGGTGG + Intergenic
1017725677 6:157274734-157274756 CGCAGCCCCGGTCCCGGACGGGG + Intergenic
1018151127 6:160940459-160940481 TGCTGCCCCTGTCCTGAATGTGG - Intergenic
1018317224 6:162569062-162569084 TGCTGTCCATGTCCAGGAAGTGG - Intronic
1019279835 7:193978-194000 GGCAGCCCCTCCCAAGGAGGAGG - Intronic
1019613122 7:1946931-1946953 TACAGCCCAAGTCCTGGAGGAGG + Intronic
1019747547 7:2709181-2709203 CCCAGCCCCTGTCCTGCAGGGGG - Exonic
1021787334 7:24164942-24164964 TGCATCCACTGTCCAGAAGTGGG - Intergenic
1022206187 7:28165906-28165928 TGCAGGCACTGTCTAGGAGCTGG - Intronic
1022470917 7:30681539-30681561 TGCTTCCCCTGCCCAGGAGGGGG - Intronic
1023609781 7:41961059-41961081 TGCAGCCCCTGGGCTTGAGGTGG + Exonic
1024576339 7:50767633-50767655 TGCGGCTCCTGGCCAGCAGGGGG + Intronic
1024917896 7:54524619-54524641 TACAGCTGCTGTCCAGGATGGGG + Intergenic
1026344918 7:69465590-69465612 TTCAGCCCCTCTCCTGGAGGTGG + Intergenic
1026394153 7:69934815-69934837 TGCAGCCACTCTGCAGGAGTTGG + Intronic
1026440635 7:70440632-70440654 TTCAGCCTGTGTCCAGGAGAAGG - Intronic
1029653343 7:101908723-101908745 TGGAGCCCCTGGCCTGGTGGGGG + Intronic
1033180093 7:139168370-139168392 TGCAGCCCTTGGCCAGGAAATGG + Exonic
1033495197 7:141887030-141887052 TGCAGCCTGTGAGCAGGAGGGGG + Intergenic
1034470278 7:151251188-151251210 TGAAGCCCCTGTGGAGGAGCTGG + Intronic
1035305808 7:157930612-157930634 TGCTGCCCCTGGCCCTGAGGTGG + Intronic
1036208237 8:6820834-6820856 TGCAGCTCCTGTCCAGGAAAGGG - Intronic
1036498520 8:9292795-9292817 TGCAACCCCTGTACATGAAGAGG + Intergenic
1037485568 8:19343629-19343651 TGCAGCCCCTGGGTAGGAGACGG - Intronic
1038424174 8:27453895-27453917 TGCACCCTATGTCCAGGTGGTGG + Intronic
1039053055 8:33512316-33512338 TGCAGCCCCCTCCAAGGAGGAGG - Exonic
1039837027 8:41264891-41264913 AGCAGCCACTGCACAGGAGGAGG - Exonic
1042143865 8:65707075-65707097 TGGAGCCCCAGTGCAGGGGGAGG - Exonic
1042222588 8:66487904-66487926 GACAGCTCCTGTCCAGGATGAGG - Intronic
1043381021 8:79702217-79702239 TACAGCCCCTGTGCAGGAGCAGG - Intergenic
1044539766 8:93395397-93395419 TGCTGCCCCTGTGCAGGATCAGG - Intergenic
1044920813 8:97167585-97167607 TTAAGCCCTTGTCCAGGAGAGGG - Intergenic
1045976112 8:108131946-108131968 AGCGGCCCCTGGCCATGAGGTGG - Intergenic
1046103905 8:109644691-109644713 CGCTGCCGCCGTCCAGGAGGAGG + Exonic
1046275696 8:111957152-111957174 TGCAGCCACTGTCCCAGATGTGG + Intergenic
1047307759 8:123666768-123666790 AACAGCCCCTTTCCAAGAGGGGG - Intergenic
1048205895 8:132414960-132414982 AGCAGCCCCTCTCCGGGAGGTGG - Intronic
1049019048 8:139941340-139941362 GGCAGCCCCTAGCCAGGAAGTGG + Intronic
1049053029 8:140214138-140214160 TGCAGCCCCAGTCCGTGATGTGG + Intronic
1049261050 8:141639396-141639418 TGCAGCTCTTGGGCAGGAGGAGG + Intergenic
1049417827 8:142503607-142503629 TGCTGCCCCTCCCCAGCAGGAGG - Intronic
1049432890 8:142573521-142573543 TGCAGCCCCAGGCCATGAGGAGG + Intergenic
1049534037 8:143169791-143169813 TGCAGCCCCTTTCCAGGGGACGG - Intergenic
1049573972 8:143382094-143382116 GGTGGCCCCTGCCCAGGAGGCGG - Intronic
1049630225 8:143650085-143650107 TGCAGCCCCTGTCCTGAGAGGGG - Exonic
1049664391 8:143836600-143836622 AGAGGCCCCTGGCCAGGAGGGGG + Intronic
1049678415 8:143903924-143903946 TGCAGCTGCTGACCCGGAGGAGG - Intergenic
1049762124 8:144336482-144336504 TGCCGCCCCTGGACAGGCGGGGG + Intergenic
1049792064 8:144476700-144476722 GGCAGCAAGTGTCCAGGAGGAGG + Intergenic
1051844668 9:21438151-21438173 TGCATCCCCAGGCCAGGGGGTGG - Intronic
1053168555 9:35861845-35861867 TGGAGCCCTTGTCCAGGAGGTGG - Intergenic
1053593265 9:39534161-39534183 CACACCCCCTTTCCAGGAGGGGG - Intergenic
1054573041 9:66831116-66831138 CACACCCCCTTTCCAGGAGGGGG + Intergenic
1056048802 9:82746555-82746577 TGCATCCCATGTACAGAAGGGGG - Intergenic
1056928591 9:90855434-90855456 TACAGCCCTCGTCCAGGAGCAGG - Intronic
1057220669 9:93256227-93256249 CCCTGCCCCTGCCCAGGAGGGGG + Intronic
1057298928 9:93865429-93865451 AGCTGCCACTGTCCAGGATGGGG - Intergenic
1057843290 9:98503148-98503170 GTCAGCCCCAGGCCAGGAGGTGG + Intronic
1058457255 9:105148939-105148961 TGCTGCCCATGTCCAGGGAGTGG - Intergenic
1058684417 9:107467721-107467743 AGAAGCCTCTGTCCAGGAAGGGG + Intergenic
1059251548 9:112891160-112891182 TCCAGCCCCTGCCCCGGTGGTGG - Intergenic
1060224438 9:121782626-121782648 CCCTGCCGCTGTCCAGGAGGCGG + Intronic
1060822943 9:126671917-126671939 GGAAGCCCCAGTCCAGGAGAAGG - Intronic
1061431363 9:130533372-130533394 TGCAGCACCTGTTCAGGGGCTGG - Intergenic
1062092942 9:134688100-134688122 GGAAGCCCCTGGCCAGCAGGAGG + Intronic
1062597710 9:137306550-137306572 TGCTGCCCCTGTCTGGGAGGAGG - Intergenic
1185447747 X:268334-268356 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185447764 X:268389-268411 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185447797 X:268499-268521 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185447813 X:268554-268576 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185447861 X:268719-268741 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185447956 X:269049-269071 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185447973 X:269104-269126 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185447989 X:269159-269181 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185448021 X:269269-269291 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185448037 X:269324-269346 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185448054 X:269379-269401 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185448104 X:269544-269566 TGCAGTCCCCGCCCAGGCGGAGG - Intergenic
1185448152 X:269709-269731 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185448219 X:269929-269951 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185448252 X:270039-270061 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185448300 X:270204-270226 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185448375 X:270479-270501 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1185448423 X:270644-270666 TGCAGGCCCCGCCCAGGCGGAGG - Intergenic
1186455175 X:9704988-9705010 TGCAGCCCCTGCCCTTGATGTGG + Exonic
1190026030 X:46923975-46923997 AGAAGCTCCAGTCCAGGAGGAGG - Intronic
1193049926 X:77089042-77089064 GGCTGCCCCCTTCCAGGAGGTGG + Intergenic
1198374579 X:136026164-136026186 TACAGCCCCTGTTCACGAAGAGG - Intronic
1199190339 X:144963103-144963125 TACAGCCACTGTACAGGAGCTGG - Intergenic
1199688914 X:150291257-150291279 GGATGCCCCTGGCCAGGAGGTGG + Intergenic
1200060704 X:153482513-153482535 GCCAGCCCCTGTCCTGGGGGTGG - Intronic
1200137153 X:153880700-153880722 TGCAGCCCAAGTCCCAGAGGTGG + Intronic