ID: 1128254039

View in Genome Browser
Species Human (GRCh38)
Location 15:66184368-66184390
Sequence CTGTGGAAGAGGGAGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1962
Summary {0: 1, 1: 2, 2: 7, 3: 207, 4: 1745}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128254039_1128254048 -3 Left 1128254039 15:66184368-66184390 CCATCCCCCTCCCTCTTCCACAG 0: 1
1: 2
2: 7
3: 207
4: 1745
Right 1128254048 15:66184388-66184410 CAGCTCCCACCATCTCACCTGGG 0: 1
1: 0
2: 3
3: 18
4: 259
1128254039_1128254047 -4 Left 1128254039 15:66184368-66184390 CCATCCCCCTCCCTCTTCCACAG 0: 1
1: 2
2: 7
3: 207
4: 1745
Right 1128254047 15:66184387-66184409 ACAGCTCCCACCATCTCACCTGG 0: 1
1: 0
2: 3
3: 36
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128254039 Original CRISPR CTGTGGAAGAGGGAGGGGGA TGG (reversed) Intronic
900140132 1:1136384-1136406 GTGTGGTCGAGGGAAGGGGAAGG + Intergenic
900145593 1:1157561-1157583 GTGTGGAGCAGGAAGGGGGAAGG + Intergenic
900217654 1:1490234-1490256 CTGTAGGACAGGGATGGGGAAGG - Intronic
900751514 1:4400844-4400866 CAGAGAAAGAGGGATGGGGAAGG - Intergenic
900772679 1:4558298-4558320 CTGTGGAAGATAGAGCTGGAAGG + Intergenic
900808990 1:4786941-4786963 TTGTGGAAGGGGCAGGGGTAGGG - Exonic
900931120 1:5738469-5738491 CTATGGAGAAGGGTGGGGGAGGG - Intergenic
900989002 1:6089335-6089357 CTGTGGCAGAGGCATGGGGCAGG - Intronic
901026517 1:6281287-6281309 CTGTGGAGAAGGGAGGGCGGGGG + Intronic
901053534 1:6437863-6437885 GTGTGTGAGAGGGAGGGAGAGGG + Intronic
901513731 1:9731391-9731413 CTGTGGGAGAATGAGGGGGCGGG + Intronic
901522803 1:9798142-9798164 GAGGGGAAGAGGGAGGGGGAGGG + Intronic
901522812 1:9798160-9798182 GAGGGGAAGAGGGAGGGGGAGGG + Intronic
901555437 1:10028363-10028385 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
901677509 1:10894861-10894883 CTTTGGAAGGCGGAGGGGGGAGG - Intergenic
901798347 1:11692937-11692959 CTGTGGAGGAAGGGAGGGGAGGG + Intronic
901857297 1:12052683-12052705 CTGTGGGAGAGGGAAGGGGCCGG - Intergenic
901918695 1:12520185-12520207 CTTTGGAAGATGGAGGCGGAAGG + Intergenic
902257048 1:15196426-15196448 ATGTGAAAGAGAGAGGGGGAGGG + Intronic
902480741 1:16710281-16710303 GTGTGTGAGAGGGAGGGAGAGGG - Intergenic
902694805 1:18133136-18133158 TAAAGGAAGAGGGAGGGGGAAGG + Intronic
902797134 1:18807224-18807246 CAGGGGAAGAGGCAGGGGGTAGG + Intergenic
902805752 1:18860379-18860401 GTGTCAAAGAGGGTGGGGGAAGG + Intronic
902872810 1:19324610-19324632 CTGTGGAAGAGGAAGAGGAAGGG - Intronic
903100178 1:21023254-21023276 GAGAGGGAGAGGGAGGGGGAGGG - Intronic
903163162 1:21503490-21503512 CCGTGGGGGGGGGAGGGGGAGGG + Intergenic
903290832 1:22313330-22313352 GTGTGGAGGAGGGAGGGTCATGG - Intergenic
903411541 1:23147528-23147550 CTTTGGAAGACTGAGGTGGAAGG + Intronic
903429303 1:23280340-23280362 GGGTGGAAGGGAGAGGGGGATGG + Intergenic
903482234 1:23662158-23662180 CTGTGGAGGATGGTGGGGGCAGG - Intergenic
903515621 1:23909008-23909030 CAGTGGAAGCAGGTGGGGGAGGG + Intronic
903516904 1:23917182-23917204 CTGTGGGAGACCGAGGAGGAAGG + Intergenic
903884486 1:26532864-26532886 CTGAGGAAGAGGGAGGAGTGTGG + Intronic
903937947 1:26909746-26909768 ATGTGCCAGAGGGATGGGGAGGG + Intronic
904012554 1:27398189-27398211 CAGGGGAAGAAGGATGGGGAGGG + Intergenic
904332259 1:29767715-29767737 CACTGGAAGAGGGAGGGAGGTGG - Intergenic
904379556 1:30101750-30101772 CTGTAGAAGAGGCTGGGGAAGGG - Intergenic
904389651 1:30173861-30173883 CTTTGGAAGGGGGTGGGGCAGGG - Intergenic
904390744 1:30184252-30184274 GTGGGAAAGAGGGAGGGGGAGGG - Intergenic
904408053 1:30306609-30306631 CAGTGGAAGGGAGAAGGGGAAGG - Intergenic
904408731 1:30312034-30312056 CTCTGGGAGAGGGAGGAGGAAGG + Intergenic
904543517 1:31250176-31250198 CTGTGGAGAAGGGAGGGAGCTGG - Intergenic
904698106 1:32341846-32341868 CAGGGGAAGGGGGAGGGGAAGGG - Intergenic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
905092022 1:35437324-35437346 CTGAGGAGGAAGGAGGGAGAAGG - Intronic
905228063 1:36492869-36492891 CTGTGGCAGGAGGATGGGGATGG + Intergenic
905344020 1:37299259-37299281 CTTGGGAAGAGGGAGGGAGGAGG + Intergenic
905362362 1:37429776-37429798 GAGAGAAAGAGGGAGGGGGAGGG - Intergenic
905370171 1:37478867-37478889 ATGTGGCAGAGGGACCGGGAAGG + Intronic
905371719 1:37486031-37486053 CTGTGAAAGGAGGAGAGGGAGGG + Intergenic
905672103 1:39798609-39798631 CTGTGGTAAAGGGTGGTGGATGG + Intergenic
905680692 1:39869087-39869109 CATGGGGAGAGGGAGGGGGAGGG - Intronic
905686805 1:39914039-39914061 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
905699154 1:39999064-39999086 CCGTGGAAAGGGGAGGGGGAGGG - Intergenic
905746386 1:40422137-40422159 CTGTGGAAAGGGGAGAGCGAGGG - Exonic
906052826 1:42888601-42888623 CTGTAGCAGAGGGAGAGGGGTGG - Intergenic
906060913 1:42948111-42948133 CGGTGGGATAGGGAGGGTGAGGG - Intronic
906253923 1:44332830-44332852 CTTTGGAAGGAGGAGGGGCAAGG + Intronic
906289270 1:44609547-44609569 CTGTGGAAGATGGCAGGGAAGGG + Intronic
906319669 1:44808294-44808316 CTGTGGAGGAGGGAAGGGTTAGG + Intergenic
906427021 1:45723972-45723994 GAGAGGGAGAGGGAGGGGGAGGG - Intronic
906662488 1:47592987-47593009 CTCTGGGAGAGAGAGGGGGAAGG + Intergenic
906904502 1:49875298-49875320 GTGTGGAGGGGGGAGGGGGGAGG - Intronic
907102493 1:51849571-51849593 CTTTGGAAGGTGGAGGTGGATGG + Intronic
907105396 1:51878337-51878359 CTGAGGAAGAGGGACGGAGGGGG - Exonic
907275257 1:53313429-53313451 CTGTGGAGGACGGTGGAGGAAGG - Intronic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
907456454 1:54579537-54579559 CTGGGGGAGAGGGAAGGGGCTGG + Intronic
907615503 1:55920719-55920741 CTGTGAAAGGGGGGGTGGGAAGG + Intergenic
907760475 1:57353746-57353768 GTGTGGAAGGGGGAGGAGCAGGG - Intronic
907791241 1:57666860-57666882 GAGAGGGAGAGGGAGGGGGAAGG + Intronic
907883859 1:58576043-58576065 GTGCGCAAAAGGGAGGGGGAAGG + Exonic
908091647 1:60692135-60692157 CAGAGGAAGAGGGAGAGAGATGG - Intergenic
908097871 1:60759281-60759303 CTGTGGTAGAGAGAGGAGAAAGG - Intergenic
908173137 1:61527679-61527701 CTGAGGAAGGGGGAAAGGGAAGG + Intergenic
908389928 1:63675240-63675262 GTGTGGGAGGGGGAGAGGGAAGG - Intergenic
908467676 1:64414227-64414249 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
908999758 1:70204716-70204738 GTGTGTAAGAGAGAGAGGGAGGG - Intronic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
909172517 1:72314809-72314831 CTGGGGAAGAGGTATGTGGATGG - Intergenic
909180710 1:72420335-72420357 CTGTGGTGGGGGGAGGGAGAGGG - Intergenic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
909933053 1:81520357-81520379 GTGTGGCAGAGGGGCGGGGATGG - Intronic
909954636 1:81763761-81763783 CTGTGGGAGACGGAGGCGGGCGG + Intronic
909964884 1:81896347-81896369 CTGTGAGGGTGGGAGGGGGACGG + Intronic
910561984 1:88600626-88600648 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
910686743 1:89925429-89925451 CCATGGACGGGGGAGGGGGATGG - Intronic
910777701 1:90892536-90892558 GAGGGGGAGAGGGAGGGGGAGGG + Intergenic
910897719 1:92085782-92085804 CTTTGGAAGGCTGAGGGGGATGG + Intronic
910934486 1:92476208-92476230 CTGTGGGGATGGGAGGGGGAGGG + Intronic
911064229 1:93773434-93773456 CTGTGCAGGTGGGAAGGGGAGGG + Intronic
911215393 1:95187688-95187710 GTATGGAAGGGGCAGGGGGAGGG - Intronic
911483952 1:98482358-98482380 ATGAGGAAGAGGGAGGGGAATGG - Intergenic
911813539 1:102313308-102313330 GTGGGGTAGGGGGAGGGGGAGGG + Intergenic
911848222 1:102781382-102781404 GTGGGGTAGGGGGAGGGGGAGGG + Intergenic
912212338 1:107569516-107569538 CTGGGGAAGAGGTATGTGGATGG + Intergenic
912490026 1:110057669-110057691 CTGTGGAGGAGGCTGGGGCAGGG + Intronic
912512846 1:110200233-110200255 CTGTGGAAGAGGGATGAGTAAGG - Exonic
912560997 1:110551484-110551506 ATGGGGAAGAGGGAGTGGGAGGG + Intergenic
912596407 1:110881255-110881277 CTGAGGATGAAGGTGGGGGAGGG - Intronic
912646883 1:111401588-111401610 CTGTGGAAGAGCCAAGGGCAGGG - Intergenic
912711991 1:111956655-111956677 CTGTGGAAGTGGGGGAGGGCTGG - Intronic
913022979 1:114805348-114805370 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
913069485 1:115286033-115286055 GTGTAGAAGGGGCAGGGGGAGGG + Exonic
913099709 1:115551855-115551877 CTGTGGAGCAGAGAGGGTGAAGG - Intergenic
913306394 1:117431185-117431207 CGTGGGGAGAGGGAGGGGGAGGG + Intronic
913522578 1:119659784-119659806 TTGTAGAAGAGAGAGGGGGAGGG - Intronic
913531778 1:119738761-119738783 CTCTGGCAGAGCGAGGGGGTGGG + Intronic
913578152 1:120197507-120197529 CTGTGGTGGAGGCAGGAGGAGGG + Intergenic
913997360 1:143662178-143662200 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
914196785 1:145451881-145451903 GGGAGGAGGAGGGAGGGGGAGGG + Intergenic
914221838 1:145688549-145688571 CTTGGGAATAGGGAGCGGGATGG + Intronic
914707072 1:150179156-150179178 CTGGGGCAGAGGCAGTGGGAAGG - Intergenic
914780409 1:150780866-150780888 CGTGGGGAGAGGGAGGGGGAGGG - Intergenic
914965417 1:152253248-152253270 CTGGGGAAGAGGTATGTGGATGG - Intergenic
914968827 1:152288218-152288240 GTGGGGTAGGGGGAGGGGGAGGG - Intergenic
915106271 1:153536737-153536759 ATGGTGAAGAGGGAGGGGGCTGG + Intergenic
915112621 1:153574472-153574494 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
915379987 1:155431651-155431673 CTGTGGGGGAGGGATGGGGGTGG + Intronic
915445926 1:155974979-155975001 CTTTGGGAGAGGGTGGGGGTGGG - Intronic
915513686 1:156400772-156400794 CTGTGGCAGCGGGTGGGGGCTGG + Intergenic
915555843 1:156660235-156660257 CTGAGGAGGCGGGAGGGGAAGGG + Intergenic
915988484 1:160490125-160490147 AAATGGAAGAGAGAGGGGGATGG - Intronic
916071272 1:161171502-161171524 CCATGGAAGAGGGAGGGGCTTGG + Exonic
916087664 1:161282404-161282426 GAGAGGGAGAGGGAGGGGGAGGG + Intronic
916508027 1:165445500-165445522 CTGTGAAAGGAGGAGGGGGTGGG + Intergenic
916670247 1:167011033-167011055 AAGTGAAAGAGGAAGGGGGAAGG - Intronic
916709304 1:167388875-167388897 TTTTGGAAGAGAGAGGGTGATGG - Intronic
916709479 1:167390831-167390853 TTTTGGAAGAGAGAGGGTGATGG + Intronic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
916863971 1:168836742-168836764 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
917315453 1:173720008-173720030 CTTTGGGAGATGGAGGAGGAAGG + Intronic
917359523 1:174160113-174160135 CGGAGGAAGAGGAAGGGCGAGGG - Intronic
917719979 1:177778085-177778107 CTGTGGAAGAGGAATGTGTATGG - Intergenic
917729284 1:177858164-177858186 CCGAGGAAGATGGAGGGTGAAGG + Intergenic
917764620 1:178202667-178202689 CTGGGGAAGAGGTATGTGGATGG + Intronic
917802074 1:178580563-178580585 CTGAGGAGGAGGGATGGGGAGGG - Intergenic
918123019 1:181556484-181556506 CTGTGGGAGGGGGAGGCAGAGGG + Intronic
918530679 1:185517675-185517697 GTGGGGTTGAGGGAGGGGGAAGG + Intergenic
918820157 1:189243441-189243463 CTGGGGTGGGGGGAGGGGGAGGG - Intergenic
919457952 1:197842214-197842236 ATGTGGAGGAGGGAAGAGGAAGG + Intergenic
919806504 1:201383830-201383852 CTGTGGGGGAGGGAAGGGGAGGG - Intronic
919847774 1:201652244-201652266 CTGAGGCGGAGGGAGGGGGTGGG + Intronic
919856974 1:201712674-201712696 CTTTGGGAAAGGGAGGAGGAAGG + Intronic
919897115 1:202015857-202015879 CTGTGGGAGAGGAGTGGGGAGGG - Exonic
919915383 1:202135674-202135696 CTGAGGGAGCGGGATGGGGAGGG - Intronic
920093180 1:203468720-203468742 CTGAGGAAGAGTCAGGTGGAGGG + Intergenic
920097623 1:203496848-203496870 CTGTGGAGGAGGAGGAGGGAAGG - Intronic
920202569 1:204268650-204268672 CTGTGGAAGAGAGAGGGAGTAGG - Intronic
920291830 1:204928975-204928997 CTGGGGAAGAGGGAAGGGCTGGG - Intronic
920567726 1:206988666-206988688 ATGTGGAAGAAGGAGGTAGAAGG + Intergenic
920642623 1:207768490-207768512 GTGTGGAAGAGGGGTGGGTAGGG - Intronic
921097016 1:211895452-211895474 AAGAGGAAGAGGGAAGGGGAGGG - Intergenic
921113982 1:212069276-212069298 ATTTGGAAGAGGGAGGGGAGAGG - Intronic
921191007 1:212708736-212708758 CTGTGGAAGTTGGATGGGGGCGG - Intergenic
921271666 1:213475606-213475628 CTGAGGGAGAGGCAGCGGGAGGG - Intergenic
922128691 1:222755384-222755406 AGGAGGAAGAGAGAGGGGGAAGG + Intergenic
922342078 1:224665771-224665793 CTGGGAAAAAGGGAGGGGGGAGG - Intronic
922471594 1:225880427-225880449 CTGAGGAGAAGGCAGGGGGAGGG + Intronic
922586257 1:226736914-226736936 CTGCGGAAGGGGCACGGGGAGGG + Exonic
922616656 1:226964881-226964903 CTCTGGAGGTGGGAGGGGGCGGG + Intronic
922722736 1:227906829-227906851 ATGAGGAAGAGGGAGGGAGGAGG - Intergenic
923082860 1:230675896-230675918 CTTTGGAAGGTTGAGGGGGAAGG - Intronic
923174720 1:231453558-231453580 AAGTGGGAGAGGGAGGGGGAGGG - Intergenic
923314058 1:232762298-232762320 CTGAGGAAGAGGAAGAAGGATGG - Intergenic
923482467 1:234397493-234397515 GGGGGGAAGGGGGAGGGGGAAGG + Intronic
923482613 1:234397801-234397823 CGGGGGAAGAGGGGGAGGGAGGG + Intronic
923900014 1:238315513-238315535 CTGTGGAAGACAGAATGGGAAGG + Intergenic
924275422 1:242381396-242381418 TTGGGGGTGAGGGAGGGGGAAGG + Intronic
924659430 1:246002856-246002878 CTTTGGGAGAGGGAGGTGGAAGG - Intronic
924661008 1:246016701-246016723 CTGTGGAAGAGGGGCCAGGAGGG + Intronic
924880506 1:248157026-248157048 ATGGGGTGGAGGGAGGGGGAAGG - Intergenic
1062822184 10:542621-542643 CTGTGGTATAGAGAGGGGCAGGG - Intronic
1063084844 10:2806981-2807003 TGGAGGGAGAGGGAGGGGGAGGG + Intergenic
1063374983 10:5548880-5548902 GTGTGGATAAGGGAGAGGGAGGG - Intergenic
1063393055 10:5662523-5662545 CTGTCGAGAAGGGGGGGGGAGGG + Intronic
1063480001 10:6367150-6367172 ACGTGGAAGAGAGAGGGGGAAGG + Intergenic
1063656346 10:7994023-7994045 CAGAGAAAGAGAGAGGGGGAGGG - Intronic
1063744392 10:8863663-8863685 GTGGGGTGGAGGGAGGGGGAGGG - Intergenic
1063744764 10:8868376-8868398 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
1063865983 10:10366162-10366184 CTGAGAAAGAGAGAGAGGGAGGG + Intergenic
1063900411 10:10726982-10727004 AGGAGGAAGAGAGAGGGGGATGG + Intergenic
1064007417 10:11709506-11709528 GTGGGGAAGAGAGAGGAGGATGG + Intergenic
1064019335 10:11796592-11796614 CTGGGGAAGAGGGAGGGGCTAGG + Intergenic
1064108838 10:12520934-12520956 GAGAGGGAGAGGGAGGGGGAGGG + Intronic
1064190127 10:13198593-13198615 CAGAGGAGGAGGGAGTGGGAGGG + Intronic
1064262718 10:13798939-13798961 CTGGGGAAGAAGGAAGGGAAAGG - Intronic
1064267342 10:13835833-13835855 TGGTGAAAGGGGGAGGGGGATGG - Intronic
1064624747 10:17251045-17251067 CTGGGGTAGAGGCAGGTGGATGG - Intergenic
1064741582 10:18440134-18440156 ATGTGGGAGAGGGAGTGGAAGGG + Intronic
1064777117 10:18791124-18791146 ATGTGGGAGAGGGAGGGACAAGG + Intergenic
1065021893 10:21508566-21508588 GTGTGTAAGAGGGAGAGAGAGGG + Intergenic
1065354644 10:24827962-24827984 CTTTGGGAGACGGAGGTGGATGG - Intergenic
1065540843 10:26765615-26765637 CTGAGGAAGAGGGGAAGGGAAGG + Intronic
1065650948 10:27890594-27890616 CTGTGGAGTAGGGAATGGGAGGG + Intronic
1065728755 10:28691665-28691687 GAGGGGAAGAGGGAGAGGGAGGG - Intergenic
1065781916 10:29176829-29176851 CTGTTGGCGAGGGAGGGGGTGGG + Intergenic
1066242375 10:33550839-33550861 CTTGGGAAGGAGGAGGGGGAAGG - Intergenic
1066440215 10:35431364-35431386 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1066517320 10:36177455-36177477 ATGAGGAGGAGGGAGGGTGAAGG - Intergenic
1067058412 10:43065381-43065403 GGGTGGAAGAGGGAGGGGATGGG + Intergenic
1067114244 10:43422637-43422659 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
1067258587 10:44666580-44666602 TGGTGGGAGAGGGAGAGGGAGGG + Intergenic
1067338731 10:45384112-45384134 CTGATGCAGGGGGAGGGGGAAGG + Intronic
1067364004 10:45608124-45608146 AGGGGGAAGGGGGAGGGGGAAGG + Intergenic
1067502739 10:46820511-46820533 CGGTGAAAGAGAGAGGGGAAGGG + Intergenic
1067591851 10:47519502-47519524 CGGTGAAAGAGAGAGGGGAAGGG - Intronic
1067638966 10:48027575-48027597 CGGTGAAAGAGAGAGGGGAAGGG - Intergenic
1067708247 10:48627121-48627143 CCAGGGAAGAGGGAGGGGCATGG - Intronic
1067803577 10:49377245-49377267 CTGGGGCAGAGGTAGGTGGAAGG + Intronic
1068194006 10:53692410-53692432 ATGGGGAAGAGTGAGGGGCATGG - Intergenic
1068268990 10:54695058-54695080 GTGGGGTAGGGGGAGGGGGAGGG + Intronic
1068438367 10:57019568-57019590 TTGTGGAAGGGGCAGTGGGAGGG - Intergenic
1068776695 10:60875043-60875065 CTGGGGAAGAGAGAGGGGGCAGG + Intronic
1069189839 10:65473306-65473328 CTCTGGATGAGGGAGAAGGAAGG - Intergenic
1069498528 10:68929188-68929210 CTGTGGGAGACGGAGGTGGGTGG - Intronic
1069658042 10:70104964-70104986 CTGTGGCAGGGGGTCGGGGAGGG + Intronic
1069712602 10:70499638-70499660 CAGTGGCAGAGGGAGGAGCAGGG - Intronic
1070439136 10:76425744-76425766 GTGGGGTGGAGGGAGGGGGAAGG - Intronic
1070536608 10:77383144-77383166 CTCTGAATGAGGGAGGGGGATGG - Intronic
1070649511 10:78224779-78224801 GTGAGGAAGAGGGGGTGGGATGG + Intergenic
1070683429 10:78465003-78465025 CTGCTGAAGAGGGAGAGGGCGGG + Intergenic
1070721834 10:78762342-78762364 TTGTGGAACATGGTGGGGGATGG - Intergenic
1070902931 10:80046718-80046740 ATGTAGAAGAAGGAAGGGGAAGG + Intergenic
1071255658 10:83869626-83869648 CTCTAGAGGATGGAGGGGGATGG - Intergenic
1071292991 10:84200893-84200915 CGTTGGAAGAGGGAGGGGACAGG - Intronic
1071299758 10:84247751-84247773 CTGTGGACTGGGGAGGGGGCTGG - Intronic
1071432062 10:85613877-85613899 CAGTGGAATAGGGTGGGAGAGGG - Intronic
1071546127 10:86531098-86531120 CTGGGGAAGGGGGTTGGGGAGGG + Intergenic
1071730559 10:88244265-88244287 CTGAGGAACAAGGAGGAGGAGGG - Intergenic
1071734066 10:88278688-88278710 TTTTGGAAGAGGTTGGGGGAAGG - Intronic
1071784292 10:88881051-88881073 GTGTGGAGGAGGGAGGGGCGAGG + Intronic
1071807683 10:89142542-89142564 GAGGGGAAGGGGGAGGGGGAGGG + Intergenic
1071971919 10:90916115-90916137 ATGGGGGACAGGGAGGGGGAGGG + Intronic
1072397370 10:95058785-95058807 GTGTGGTGGGGGGAGGGGGAAGG - Intronic
1072564976 10:96609939-96609961 CTGTGAGAGAGGCAGGTGGAGGG - Intronic
1072578351 10:96720137-96720159 CTGAAGAAGTGGGAGGGGGTCGG + Intronic
1072587076 10:96792172-96792194 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
1072612637 10:97028928-97028950 CCATGGAAGTGGGAGGGGTAAGG - Intronic
1072686445 10:97540046-97540068 CTGAGGAAGGGGGAGGGGCATGG + Intronic
1072908451 10:99477281-99477303 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
1073059543 10:100725074-100725096 GTGTGTATGGGGGAGGGGGAGGG - Intergenic
1073136694 10:101224365-101224387 CGGGGGAGGAGAGAGGGGGAAGG + Intergenic
1073265518 10:102226141-102226163 CTGGGGAAGTGGGCGGGCGATGG + Intergenic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073348510 10:102802089-102802111 AGGTGGAAGGAGGAGGGGGAAGG - Intronic
1073479922 10:103779937-103779959 CTGAAGAAGGGGGAAGGGGAAGG + Intronic
1073482588 10:103796114-103796136 CTTTGGAAGACCGAGGCGGAAGG + Intronic
1073502142 10:103949870-103949892 CAGTGGAAGGGGCAGGGGAAAGG + Intergenic
1073592131 10:104767630-104767652 GAGTGGAAGTGGGAGGGGAAGGG - Intronic
1073597693 10:104817343-104817365 GGGTGGAAGAGGGGGGAGGAGGG - Intronic
1073849919 10:107602930-107602952 AGGAGGGAGAGGGAGGGGGAGGG - Intergenic
1074120067 10:110487529-110487551 CTCTGGCAGAGGGAGGGGGAAGG - Intergenic
1074145935 10:110717344-110717366 CTGGAGAGGAGGGAGGAGGAGGG - Intronic
1074217704 10:111403844-111403866 CAGTGGGGGAGAGAGGGGGAAGG - Intergenic
1074270463 10:111948669-111948691 CTGAGGATGAGGGAAGGGGCAGG + Intergenic
1074391817 10:113064247-113064269 CTCTGGGAGAGGGAGGGGCCAGG + Intronic
1074472744 10:113742224-113742246 CCTTACAAGAGGGAGGGGGAAGG - Intergenic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074626074 10:115188035-115188057 CTGGGAGAGAGGGAGGGGGAGGG + Intronic
1074696287 10:116052541-116052563 GTGGGGTAGGGGGAGGGGGAGGG - Intergenic
1074852304 10:117448669-117448691 CTGTGGGAGGGGGACGGGGAGGG - Intergenic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075111834 10:119594088-119594110 CTATGGAAAAGGGTGGGAGAAGG + Intronic
1075181619 10:120216027-120216049 CCGTGGAAAGGGGAGGGGGAGGG + Intergenic
1075696183 10:124437266-124437288 CTGTGGAAGGCCGAGGGGGGTGG - Intergenic
1075855985 10:125630768-125630790 CAGTGGAAGTGGGAAGGGGAGGG - Intronic
1075923123 10:126229610-126229632 GAGGGGGAGAGGGAGGGGGAGGG - Intronic
1076029364 10:127144299-127144321 GTGTGGATGAGGCAGGGGGGAGG - Intronic
1076087705 10:127649794-127649816 TTGAGGAAGAGGAAGGGGAACGG - Intergenic
1076198467 10:128539176-128539198 TTGGGGTAGGGGGAGGGGGAAGG - Intergenic
1076426177 10:130369253-130369275 CTGGGGAAGAGGGAGCAGGAGGG + Intergenic
1076471009 10:130718230-130718252 CCGTGGTGGAGGGAGGGGAAGGG + Intergenic
1076548267 10:131260445-131260467 CTGCGGAAGAGGGATGCAGAGGG + Intronic
1076550980 10:131278039-131278061 CTGTGGGAGATGGAAGCGGAGGG + Intronic
1076602055 10:131663629-131663651 CTCTGGAAGTGGGAAGGGGTAGG - Intergenic
1077029210 11:456282-456304 CTTGGGAAGAGGGAGGGTGAGGG - Intronic
1077046990 11:551105-551127 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
1077130250 11:968452-968474 TTGTGGGACAGGGATGGGGACGG - Intronic
1077239496 11:1503127-1503149 CTGTGGAGAAGGGATGGGGAGGG + Intergenic
1077287285 11:1773157-1773179 GTGGGGGAGGGGGAGGGGGAGGG + Intergenic
1077303499 11:1857570-1857592 CTGGGGCGGCGGGAGGGGGATGG + Intronic
1077341664 11:2028953-2028975 GTGGGGAAGACGGAGGGGGCTGG + Intergenic
1077367206 11:2166059-2166081 CTGTGGAGCAGGGAGGATGAAGG + Intronic
1077392545 11:2306835-2306857 GGGAGGGAGAGGGAGGGGGAGGG + Intronic
1077534114 11:3111147-3111169 CTGTGGCAGGGGGTGGGGGTGGG - Intronic
1077839491 11:5960236-5960258 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
1077922556 11:6652591-6652613 CTGTGGAAGAGGAAGGGGATGGG + Intronic
1078127324 11:8580487-8580509 AGGGGGAAGGGGGAGGGGGATGG + Intronic
1078764072 11:14276614-14276636 AAGAGGAAGAGGGAGGGGAAGGG + Intergenic
1078984674 11:16581444-16581466 CTGTGGAGGGTGGAAGGGGAGGG + Intronic
1079116600 11:17644063-17644085 CTGGGGGCAAGGGAGGGGGAGGG + Intronic
1079241743 11:18726736-18726758 CTGTTGAAGTGGGAAGAGGAAGG - Intergenic
1079372185 11:19861030-19861052 CAGAGGGAGAGGGAGGGGGAGGG + Intronic
1079396166 11:20065706-20065728 CAGTGGCAGAGGCATGGGGAAGG + Intronic
1079431827 11:20397486-20397508 TTGAGGAAGAGGAAAGGGGAGGG - Intronic
1079445542 11:20553561-20553583 GGGAGGAAGAGGGAGGAGGAAGG - Intergenic
1079520167 11:21316843-21316865 CTGGGGAAGAGGCAGGGAAAGGG + Intronic
1080143527 11:28951792-28951814 GTGGGGTGGAGGGAGGGGGAGGG - Intergenic
1080329225 11:31115972-31115994 CTGTGGCAGTGGGGGGGGGGGGG + Intronic
1081106369 11:39075037-39075059 ATGTGAGAGAGAGAGGGGGAGGG - Intergenic
1081268956 11:41060981-41061003 GTGTGGAGGGGGGAGGGGAAGGG - Intronic
1081585736 11:44382429-44382451 CTGGGGAAAACGGAGGGGGCAGG + Intergenic
1081744577 11:45463958-45463980 CTGTGGCAGTGGGAGGGATATGG - Intergenic
1081751368 11:45513536-45513558 CTCTGGAGCAGGGAGGGGTAGGG + Intergenic
1081775962 11:45676103-45676125 CAGTGGAGGAGGGAGGGGGTAGG - Intergenic
1081814239 11:45929643-45929665 CTGGGGAAGGGGTAGGGGGGTGG + Intronic
1081907555 11:46679321-46679343 CTGGGGTGAAGGGAGGGGGAAGG - Intronic
1082024705 11:47563775-47563797 CTTTGGAAGGCCGAGGGGGACGG + Intronic
1082035132 11:47639593-47639615 CTTTGGGAGACCGAGGGGGATGG + Intronic
1082067341 11:47911404-47911426 CTGTGGCAGAGGGAGGGGAGAGG - Intergenic
1082262862 11:50090670-50090692 ATGTGGAAGAGGGAGGCAGAAGG + Intergenic
1082674154 11:56075112-56075134 CTGTGGCAGGAGGATGGGGAGGG - Intergenic
1082819843 11:57537500-57537522 GGGTGGAAGAGGGAGAGGAAGGG + Intergenic
1082915682 11:58433904-58433926 GTGGGGAGGGGGGAGGGGGAGGG + Intergenic
1083042101 11:59699031-59699053 CGTGGGGAGAGGGAGGGGGAGGG - Intergenic
1083120631 11:60509626-60509648 ATGAGGGAGGGGGAGGGGGAGGG - Intergenic
1083120635 11:60509632-60509654 CTGGGCATGAGGGAGGGGGAGGG - Intergenic
1083175430 11:60946880-60946902 CTCTGTAGGAGGGAGGGGTATGG - Intronic
1083186449 11:61020567-61020589 ATGAGGAAGAAAGAGGGGGAAGG + Intergenic
1083269183 11:61562718-61562740 GTATGGAAGAGGGAGGGCTAAGG + Intronic
1083287202 11:61667743-61667765 CTGGGTGAGAGGGATGGGGAGGG + Intergenic
1083326534 11:61875965-61875987 CTGGGGAAGAGGCTGGGGGTGGG + Exonic
1083399128 11:62411809-62411831 CTGGGGAAGCAGGAGTGGGAAGG - Intronic
1083618546 11:64037831-64037853 CTGAGGCACAGGGAGGTGGAGGG - Intronic
1083627224 11:64077970-64077992 CTGAGGAGGAGGCAGGGGAAAGG - Intronic
1083857738 11:65401394-65401416 AAGTGGGAGAGGGAGGGGCAGGG - Intronic
1083887277 11:65579055-65579077 CTGGGGGAGGGGGAAGGGGAGGG - Intronic
1084042353 11:66549486-66549508 CTTTGGGAGACGGAGGGGGGCGG + Intronic
1084091119 11:66879913-66879935 CTGTGAATGACGGAGGGTGAGGG + Intronic
1084149112 11:67279915-67279937 GTGTGGGAGAGGAAGGGGGAGGG + Intronic
1084161328 11:67352020-67352042 CTGTGGAAGATGGGGTGGGAGGG + Intronic
1084546972 11:69819435-69819457 CTGGGGGAGGGGGCGGGGGAGGG - Intergenic
1084569913 11:69953131-69953153 ATGGGGAAGGGGGAGAGGGACGG + Intergenic
1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG + Intronic
1084694839 11:70746947-70746969 CTGGGGTGGAGGGAGGGGGGTGG - Intronic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1084903999 11:72331991-72332013 ATGTGGGAGGTGGAGGGGGAAGG + Intronic
1084913461 11:72409732-72409754 CTTTGGAAGACGGAGGCGGGTGG + Intronic
1084935442 11:72584314-72584336 CTGGGGAAGGGAGAGGGGCAAGG + Intronic
1084958711 11:72704753-72704775 CTGGGCAAGAGGGATGGGGGTGG + Intronic
1084972509 11:72779657-72779679 CTGAGGAGCAGGGATGGGGAAGG - Intronic
1085014606 11:73165051-73165073 CTGTAGATAAGGGAGGTGGAGGG - Intergenic
1085112233 11:73898188-73898210 CGTGGGGAGAGGGAGGGGGAGGG + Intronic
1085167148 11:74413041-74413063 CTAGGCAAGAGGAAGGGGGAAGG + Intergenic
1085279614 11:75321279-75321301 CTGAGGAAGAGGTGGGGGGATGG - Intronic
1085443532 11:76583369-76583391 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
1085459739 11:76686395-76686417 AAGTGGAGCAGGGAGGGGGAAGG + Intergenic
1085502660 11:77037978-77038000 AGGGGGAAGAGGGAGGAGGAGGG + Intronic
1085759973 11:79233433-79233455 TTGTGGAAGAGGCAGGGGGACGG + Intronic
1086064451 11:82731903-82731925 CTGTGGCTGAGGGAGGAGGCCGG - Exonic
1086173764 11:83865541-83865563 CTGTAGAGAAGGGAGGGGAAAGG + Intronic
1086399809 11:86451279-86451301 CTGGGGAAAAGGTAGGTGGATGG + Intronic
1086446653 11:86878226-86878248 ATGAGGGAGAGGGAGGGGGAGGG - Intronic
1086557342 11:88126550-88126572 GTGGGGTGGAGGGAGGGGGAAGG + Intronic
1086767180 11:90710766-90710788 GGGTGGAAGTGGGAGGTGGAGGG - Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1086936427 11:92750320-92750342 CTATGGAAGAAGTCGGGGGATGG + Intronic
1087102603 11:94380121-94380143 GTTGGGAAGAGGGAGTGGGAGGG - Exonic
1087168699 11:95028642-95028664 AGGAGGAAGAGAGAGGGGGACGG - Intergenic
1087487166 11:98770773-98770795 ATGGGGAAGAGGGAGGGGAAGGG + Intergenic
1087487174 11:98770785-98770807 GAGGGGAAGGGGGAGGGGGAGGG + Intergenic
1087529041 11:99355558-99355580 CTGTGGATGATGGTGGTGGAGGG + Intronic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088166970 11:106950579-106950601 CTGGTGAAGAAGGTGGGGGAGGG + Intronic
1088222054 11:107579943-107579965 CTGTGGAAGGCTGAGGGGGGAGG - Intergenic
1088256938 11:107911783-107911805 GAGAGGGAGAGGGAGGGGGAGGG - Intronic
1088326758 11:108608843-108608865 CTGTGTGAGAGAGAGGGGGAGGG + Intergenic
1088505568 11:110523459-110523481 CTGTGGAAAGGGGTGGGTGATGG + Intergenic
1088801210 11:113308815-113308837 CTAAGGAAGAGGGAGGGAGAAGG - Intergenic
1089094394 11:115906654-115906676 CTGTGGAACAGGGATGAGAAGGG + Intergenic
1089159076 11:116424004-116424026 CTGAGGAACAGGTAGGGGAAAGG - Intergenic
1089165470 11:116472788-116472810 CAGGGGAGGAGGGAGGGAGAAGG - Intergenic
1089355101 11:117844431-117844453 CTGGGAGAGAGGCAGGGGGATGG - Intronic
1089375106 11:117988510-117988532 AAAGGGAAGAGGGAGGGGGAGGG + Intronic
1089514318 11:119022345-119022367 CTTTGGAAGACGGAGAGGGTAGG + Intronic
1089680587 11:120116917-120116939 CTGTGGGAGAGAAAAGGGGAGGG + Intronic
1089700618 11:120241794-120241816 CTGTGGAAGTGGGAGGGGGTGGG + Intronic
1089866178 11:121634173-121634195 CTGTGGAACTGGGTGGGGGAGGG + Intergenic
1090244602 11:125206966-125206988 CTGTGAGAGAGGGAGGGGCTGGG + Intronic
1090323602 11:125865758-125865780 GTGGGGTAGAGGGAGGGGGGAGG + Intergenic
1090333914 11:125950471-125950493 CTGTGGGAAGGGGAAGGGGAAGG + Intergenic
1090417854 11:126552965-126552987 CTGGGGAAGAGGATGTGGGAAGG - Intronic
1090419187 11:126562308-126562330 CTGAGTAAGAGGGAGGGGTAGGG + Intronic
1090658484 11:128863272-128863294 CTGGAGCAGAGGGAGGGGCAGGG + Intronic
1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG + Intronic
1091288099 11:134420111-134420133 CTGTGGAGGAAGGAGCTGGAGGG - Intergenic
1202824650 11_KI270721v1_random:84142-84164 GTGGGGAAGACGGAGGGGGCTGG + Intergenic
1091446472 12:546617-546639 GTGTGGAAGAGAGAAGAGGAGGG - Intronic
1091590542 12:1840433-1840455 ATGTGGAAGAGGGGGGTGGGTGG + Intronic
1091800909 12:3323982-3324004 CTGTAGAACAGGGAGGGATAAGG - Intergenic
1091833564 12:3568259-3568281 CTGAGGAGGAGGGAGAGGAAGGG + Intronic
1091908073 12:4205526-4205548 CTGTGGGAGAGGGTGGGTTATGG + Intergenic
1092016913 12:5167231-5167253 CTGTGGGCAAGGGTGGGGGATGG + Intergenic
1092045799 12:5431344-5431366 GTGTGGAAGGGAGAGGGAGATGG - Intergenic
1092046557 12:5435010-5435032 CTGGGGAGGAAGGAGGGGGGAGG - Intronic
1092051334 12:5472761-5472783 CTGTGGCAGAGGGACGTGGCAGG + Intronic
1092162798 12:6325173-6325195 CTTGGGGAGGGGGAGGGGGAGGG - Intronic
1092191832 12:6526868-6526890 CTGGAGGAGAGGGAGAGGGAAGG - Intronic
1092509938 12:9144212-9144234 GTGAGGATGAGGGAGGAGGAGGG + Intergenic
1092705141 12:11274777-11274799 GTGTGGTGGAGGGAGGGGGGAGG + Intergenic
1092710049 12:11326416-11326438 CTTTGGAAGAGTGAGGTGGGAGG - Intergenic
1092713806 12:11366910-11366932 CTTTGGAAGAGTGAGGTGGGAGG - Intronic
1092717518 12:11406087-11406109 CTTTGGAAGAGTGAGGTGGGAGG - Intronic
1092882734 12:12900568-12900590 GTGGGGAAGAGGGAGAGGGAAGG - Intronic
1093036431 12:14336312-14336334 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1093184271 12:16002126-16002148 GTGGGGAAGGGGGAGGGGGGAGG - Intronic
1093662230 12:21770517-21770539 CTGTGAAAGAAGCAGAGGGAAGG + Intronic
1093747687 12:22761806-22761828 CTTTGGAAGGGTGAGGCGGAGGG + Intergenic
1093757331 12:22867170-22867192 CTGTGGAAGAGGGATAGTTAAGG - Intergenic
1094015114 12:25854662-25854684 CTCTGGGACAGGGAGGTGGATGG - Intergenic
1094284946 12:28782488-28782510 CTGTGGAAGGGAGGGGGTGAGGG - Intergenic
1094365985 12:29681660-29681682 TTGTGGGGGTGGGAGGGGGAGGG - Intronic
1094670539 12:32564017-32564039 GAGAGGGAGAGGGAGGGGGAGGG + Intronic
1094729778 12:33161573-33161595 CTGTGGGAGAGGGAGCATGAGGG + Intergenic
1095042584 12:37459112-37459134 CTGTGGAATAGAGAGGTGGAAGG - Intergenic
1095102847 12:38201815-38201837 GTGTGGATGAGGGTGGGGGTGGG + Intergenic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095468512 12:42512560-42512582 ATGTGGAATAGGGAGAGGGCAGG - Intronic
1095844299 12:46729342-46729364 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1095947276 12:47760408-47760430 ATGGGGAAGAGTTAGGGGGATGG + Intronic
1096109657 12:49021263-49021285 CAGATCAAGAGGGAGGGGGATGG + Exonic
1096121046 12:49089742-49089764 GGGAGGGAGAGGGAGGGGGAGGG - Exonic
1096717236 12:53499073-53499095 CTCAGGAAGAGAGAGAGGGAAGG - Intronic
1096754749 12:53789847-53789869 CTCTGGAGAAGGAAGGGGGAGGG + Intergenic
1096789480 12:54035910-54035932 CTGGGGAAGAGGGAGCAGGGAGG + Intronic
1096846065 12:54407792-54407814 CTGGGGCCAAGGGAGGGGGATGG - Intronic
1096870352 12:54588692-54588714 CTGGGGGAGGGGGAGGGGGCCGG - Intergenic
1096884007 12:54698894-54698916 GTGGGGAAGGGGGAGGGGGAGGG - Intergenic
1096886151 12:54721328-54721350 GAGTGGCAGAAGGAGGGGGAGGG - Intergenic
1096996465 12:55841235-55841257 CTCTGAAGGAGGGAGAGGGATGG + Exonic
1097015864 12:55986896-55986918 CTGTAAAGGGGGGAGGGGGAAGG - Exonic
1097046854 12:56193380-56193402 GAGTGGAAGAGGAAGGGTGAAGG - Intergenic
1097131819 12:56816913-56816935 CTGAGGATGAGGGTGGGGGTGGG - Intergenic
1097140034 12:56893896-56893918 GTGGGGTAGGGGGAGGGGGAGGG + Intergenic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1097246868 12:57611756-57611778 CTGTGGGAGGGGGGGAGGGAGGG - Intronic
1097301496 12:58023722-58023744 CTGGGGTGGAGGGAGGGGGGAGG + Intergenic
1097626636 12:62010163-62010185 ATGGGGGAGAGGGAGGGGGAGGG - Intronic
1097710762 12:62914536-62914558 CTGTGGGAGAGGGAAGGTGATGG + Intronic
1097779378 12:63686124-63686146 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
1097821263 12:64131276-64131298 TTGTGGAAGAGGTATGTGGATGG - Intronic
1097903915 12:64900826-64900848 GTGTGGAAGAGGGCAGGGGCTGG + Intergenic
1098101214 12:67018883-67018905 GAGAGGAAGAGGGTGGGGGAAGG - Intergenic
1098130466 12:67344978-67345000 CTGTGGTGAGGGGAGGGGGAGGG - Intergenic
1098343619 12:69476739-69476761 CTGTGGGGGAGGGACGGGGGGGG + Intronic
1098412420 12:70201120-70201142 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
1098986073 12:77013728-77013750 CTGAGGAAGAGGAAGGAGAAGGG - Intergenic
1099025469 12:77459688-77459710 CTGTGGACGAGGCTGGGGGAGGG + Intergenic
1099119004 12:78664663-78664685 CTGTGTAAAAGGGATGGGGTAGG - Intergenic
1099735871 12:86565669-86565691 TTGGGGAAGAGGGATGTGGATGG + Intronic
1099978541 12:89571649-89571671 CTGACTCAGAGGGAGGGGGAGGG + Intergenic
1100145700 12:91674953-91674975 CTGTGGGAAGGGGAGTGGGAAGG - Intergenic
1100173234 12:92001141-92001163 CTTTGGAAGACCGAGGTGGAAGG + Intronic
1100581835 12:95946629-95946651 GAGAGGGAGAGGGAGGGGGAGGG - Intronic
1100606734 12:96158114-96158136 CGTGGGGAGAGGGAGGGGGAGGG - Intergenic
1100662695 12:96717320-96717342 CTGAGGATGAGGGAGGGCTAGGG - Intronic
1100823966 12:98457324-98457346 CTTTGGGAGAGTGAGGGGGGTGG + Intergenic
1101036320 12:100710678-100710700 CTGTTGGTGGGGGAGGGGGAGGG + Intergenic
1101086894 12:101245381-101245403 ATGAGGAAGAGGGAGGGGTAAGG - Intergenic
1101255578 12:102973722-102973744 AAGGGAAAGAGGGAGGGGGAAGG - Intergenic
1101503643 12:105327355-105327377 CTGTGGAGTAGAGATGGGGAGGG - Intronic
1101695648 12:107123342-107123364 CTGGGAAGGAGGGAGAGGGAAGG - Intergenic
1102072321 12:110031017-110031039 CTGGGGGAGAGGCGGGGGGATGG + Intronic
1102124189 12:110467231-110467253 CTTTGGGAGATGGAGGTGGACGG - Intronic
1102154645 12:110714975-110714997 GTGTGGCAGAGGGAGCGGGTGGG - Intergenic
1102167804 12:110820587-110820609 GAGAGGAGGAGGGAGGGGGAAGG - Intergenic
1102175199 12:110868749-110868771 GAGGGGAAGGGGGAGGGGGAGGG + Intronic
1102558044 12:113741884-113741906 CAGAGGAAGAGAGAGAGGGAGGG + Intergenic
1102678936 12:114677074-114677096 CTTTGAAAGGGGGTGGGGGAGGG + Intronic
1102759172 12:115370405-115370427 GTGTGGGAGAGAGAGAGGGAGGG + Intergenic
1103132858 12:118483764-118483786 ATGTTGTAGAGGGAGGGGAATGG + Intergenic
1103200839 12:119086645-119086667 ATGGGGAAGAGGGAGTGGGCTGG + Intronic
1103449873 12:121021057-121021079 CTCTGGAAGGGAGAGGGAGAAGG + Exonic
1103486751 12:121288320-121288342 GTGGGGAGGAGGGAGGGAGAGGG - Intronic
1103541964 12:121672486-121672508 CAGTGGAAGAGGGAGGAGCCGGG + Intronic
1103602216 12:122061573-122061595 CTGTGGTGGGGGGAGGGCGAGGG - Exonic
1103901638 12:124306523-124306545 CAGTGGAGGAGCGAGGGTGAGGG + Intronic
1103948935 12:124541283-124541305 ATGGGGGAGATGGAGGGGGATGG + Intronic
1104050002 12:125188548-125188570 CTGGGGGAGAGGGCGGGGGACGG - Intronic
1104476270 12:129073009-129073031 CTGTGGGTGGGGGAGGGAGAGGG - Exonic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1104713046 12:130998185-130998207 CGTGGGGAGAGGGAGGGGGAGGG + Intronic
1104717470 12:131025776-131025798 CTTTGGGAGACGGAGGTGGATGG - Intronic
1104790756 12:131480691-131480713 CTGTGGTGGAGGGTGGGGGCAGG - Intergenic
1104874512 12:132024683-132024705 CTGTCGAGGAAGGTGGGGGAAGG - Intronic
1104874521 12:132024721-132024743 CTGTCGAGGAAGGTGGGGGAAGG - Intronic
1104960511 12:132486532-132486554 CTGGGGAAGAGGGTGGGGAGGGG + Intergenic
1105356663 13:19665115-19665137 CTCTGGAAGTGGGTTGGGGAGGG + Intronic
1105367514 13:19778385-19778407 GAGAGGGAGAGGGAGGGGGAGGG - Intronic
1105498627 13:20952431-20952453 GTGTGGGAGAGGGCAGGGGATGG + Intergenic
1105666853 13:22569160-22569182 CTTTGGAAGGTGGAGGCGGACGG - Intergenic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1105943151 13:25169472-25169494 CTCTGGAGCAGGGCGGGGGACGG + Exonic
1106006439 13:25774403-25774425 CTGTTGGGGAGGCAGGGGGAGGG + Intronic
1106117478 13:26829903-26829925 ATGTGGAATTGGGTGGGGGATGG + Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106767866 13:32933372-32933394 CTGAGGAAGAGGTGTGGGGAAGG + Intergenic
1107755293 13:43615020-43615042 CTGTGGAATTTGGTGGGGGATGG + Intronic
1107809464 13:44186422-44186444 TGGTGGAAGAGGGAAGGGGTGGG - Intergenic
1107855107 13:44607404-44607426 AAGTGGAAAAGGGATGGGGATGG - Intergenic
1107863705 13:44683428-44683450 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
1107863719 13:44683462-44683484 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
1107937961 13:45361156-45361178 CTTTGGGAGGTGGAGGGGGAAGG - Intergenic
1108377930 13:49830466-49830488 CTGTGGGAGAGAGGGAGGGAAGG - Intergenic
1108557386 13:51607926-51607948 CTTTGTAAGAGGGAGGCAGAAGG + Intronic
1108602568 13:52007441-52007463 CTGTGGCAGAGGGAAGGAGTGGG - Intronic
1109358001 13:61257438-61257460 CTGTGTATGTGGGAGGGGGGTGG - Intergenic
1109509704 13:63353848-63353870 GTGGGGTAGAGGGAGGGGGGAGG - Intergenic
1110249424 13:73364957-73364979 TTATGGTTGAGGGAGGGGGAGGG + Intergenic
1110277323 13:73654716-73654738 CTCTAGAACAGGGAGGAGGAGGG - Intergenic
1110678773 13:78283322-78283344 TTGTGGAGGGGGGAGGGGGGAGG - Intergenic
1110682961 13:78337722-78337744 ATGGGGGAGGGGGAGGGGGAAGG + Intergenic
1110775721 13:79406030-79406052 CTGGGGAAGAGGGAAGGGGGAGG - Exonic
1110924799 13:81137991-81138013 CAGAGGAAGTGGGAGGGGGAAGG - Intergenic
1111131620 13:83984138-83984160 CTTTGGAAGATGGAGGCGGGCGG - Intergenic
1111399970 13:87721391-87721413 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1112724505 13:102286978-102287000 ATGGGGGAGGGGGAGGGGGAGGG + Intronic
1112749535 13:102567954-102567976 CTGTGGAAGAAGCTGGGAGAGGG - Intergenic
1112802860 13:103131894-103131916 GTGAGGGAGAGGGAGGGTGATGG - Intergenic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1113328944 13:109310880-109310902 GCGGGGGAGAGGGAGGGGGAGGG - Intergenic
1113430664 13:110247831-110247853 GTGTGGCAGAGAGAGAGGGAGGG + Intronic
1113485276 13:110648499-110648521 TTTGGGAAGATGGAGGGGGACGG - Intronic
1113554145 13:111217791-111217813 GTGTGGAAGAGGGAGGCTGGTGG + Exonic
1113745085 13:112738716-112738738 CTGGGGGAGGAGGAGGGGGACGG - Intronic
1113796573 13:113061832-113061854 GGGAGGAGGAGGGAGGGGGAGGG - Intronic
1114357547 14:21928243-21928265 CTGTTGGGGAGGGAGGCGGAGGG + Intergenic
1114407632 14:22471630-22471652 ATGTGGAAGAGGGATGTTGAGGG + Intergenic
1114586935 14:23824216-23824238 CAGTGTAAGAGGAAGTGGGAGGG - Intergenic
1114618283 14:24080052-24080074 GTGTGGGAGAGGGAGAGAGAGGG - Intergenic
1114952910 14:27779426-27779448 GTGGGGAGGGGGGAGGGGGAGGG + Intergenic
1115094540 14:29618971-29618993 ATGAGGAGGAGGAAGGGGGAGGG + Intronic
1115157053 14:30352955-30352977 GTGGGGTAGGGGGAGGGGGAGGG + Intergenic
1115160042 14:30383673-30383695 ATGTGAATGAGGGTGGGGGATGG - Intergenic
1115196234 14:30803011-30803033 CTATGGAAGAGGAAGGTGGGAGG - Intergenic
1115426868 14:33270477-33270499 GTGTGTAAGAGAGAGGGAGAAGG + Intronic
1115474149 14:33798315-33798337 CTCTGGAAGAGGGCTGGGGATGG - Intronic
1116062530 14:39941937-39941959 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1116095879 14:40366818-40366840 CTGTCGAAGAGACAGTGGGAAGG - Intergenic
1116281174 14:42910189-42910211 ATGGGGTAGGGGGAGGGGGAGGG - Intergenic
1117218632 14:53578703-53578725 ATGTGGCAGGGGGATGGGGAAGG + Intergenic
1117253114 14:53954548-53954570 CGGAGGAAGGGGGTGGGGGAAGG - Intronic
1117308224 14:54496971-54496993 CTTTGGAAGGCCGAGGGGGACGG - Intergenic
1117667851 14:58076094-58076116 GAGGGGAAGGGGGAGGGGGAAGG + Intronic
1117698833 14:58393776-58393798 CTGTGGTAAATGGAGAGGGATGG - Intergenic
1118181045 14:63493500-63493522 GTGTGGTGGGGGGAGGGGGAGGG + Intronic
1118705689 14:68478205-68478227 CTGTGTCAGAGGGAGGTCGATGG + Intronic
1118820509 14:69342410-69342432 GTGAGGAAGAGGGAAGGTGAGGG + Intronic
1118913270 14:70079686-70079708 CTGAGGAAAATGAAGGGGGAGGG - Intronic
1119319992 14:73724925-73724947 CAGAGGAAGATGCAGGGGGAGGG - Intronic
1119610725 14:76059634-76059656 CAGTGAGAGAGGGAGTGGGATGG - Intronic
1119696102 14:76714537-76714559 TTGAGGAAGACGGAGGGAGAAGG - Intergenic
1119714015 14:76845367-76845389 AAGGGGAAGAGGGAGGGGGAGGG + Intronic
1119732029 14:76957123-76957145 CTGGGGCTGAGGGAGGGGGGTGG - Intergenic
1119862830 14:77948878-77948900 TAGGGGAAGGGGGAGGGGGAAGG - Intergenic
1119932008 14:78556901-78556923 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1119991616 14:79204331-79204353 TGTTGGAAGAGGGAGGGTGAGGG - Intronic
1120170711 14:81245241-81245263 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
1120498327 14:85262952-85262974 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1120631991 14:86902818-86902840 CAGTAGAAGCGGGAGGGGGAGGG + Intergenic
1120726181 14:87944075-87944097 GTGGGGACGAGGGATGGGGAAGG - Intronic
1120825265 14:88949094-88949116 CTTTGGAAGGCCGAGGGGGATGG + Intergenic
1120949323 14:90026601-90026623 GTGGGGCAGGGGGAGGGGGAGGG - Intronic
1121081936 14:91115312-91115334 CTGAGGAAGCAGGAAGGGGAAGG + Intronic
1121153666 14:91663064-91663086 AGGTGGAGGAGGGAGGAGGAAGG - Intronic
1121512587 14:94523313-94523335 CTGAGGGAGAGGGAGGGGTTAGG - Intergenic
1121678044 14:95770415-95770437 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
1121710825 14:96038353-96038375 CTGTGGCACAGGGAGATGGAGGG - Intergenic
1121798383 14:96754120-96754142 GTGTGGAAGGGGGAGAGGGAAGG + Intergenic
1121842702 14:97147711-97147733 AAGTGGAAGTGGGAGGCGGAAGG - Intergenic
1121845371 14:97167953-97167975 TGGGGGGAGAGGGAGGGGGAGGG + Intergenic
1122058837 14:99123282-99123304 CAGGGGAAGAGGGAAGGGGAAGG - Intergenic
1122564928 14:102646844-102646866 CAGTGGGAGAGGGAGGGAGAAGG + Intronic
1122778784 14:104134936-104134958 CTGTGGGGGAGGGAGGAGGGTGG + Intergenic
1122806579 14:104262994-104263016 CCAGGGCAGAGGGAGGGGGAAGG - Intergenic
1122817372 14:104320325-104320347 TTGTGGGGGAGCGAGGGGGAGGG - Intergenic
1122881769 14:104693487-104693509 CAGTTGAGGAGGGAGGGAGAGGG + Intronic
1202941115 14_KI270725v1_random:146846-146868 CTGTGGAATAGAGAGGTGGAAGG - Intergenic
1123499752 15:20868921-20868943 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123593225 15:21879884-21879906 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123937925 15:25202966-25202988 GTGGGGAAGAGGGTGGGGGTGGG - Intergenic
1124136788 15:27042406-27042428 GTGTGGAAGAGGGATGGAGGAGG - Intronic
1124204305 15:27704045-27704067 GTGCGGAACAAGGAGGGGGAGGG + Intergenic
1124223303 15:27868553-27868575 CGGGGGTGGAGGGAGGGGGATGG + Intronic
1124239754 15:28019640-28019662 CTGTGGAGGAGGCTGGGTGAAGG - Intronic
1124382442 15:29177872-29177894 TAGTGGAAGAGGGTGGGCGAGGG + Intronic
1124706662 15:31972203-31972225 CTGTGGCAGACGGAGGAGGCTGG + Intergenic
1124957740 15:34370796-34370818 AGGAAGAAGAGGGAGGGGGAAGG - Intergenic
1125376508 15:39035987-39036009 GGGTGGAAGGGGGAGGGGGGAGG - Intergenic
1125597440 15:40895886-40895908 CTGTGGAAGAGACAGGTGAAGGG - Intronic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1125798226 15:42420252-42420274 CTGGGCAAGATGGAGTGGGATGG - Intronic
1125973347 15:43930062-43930084 CTGAGGCAGAGGGAGGGTGTGGG + Intronic
1126285996 15:47011289-47011311 TTGGGGAAGAGGGTGGGAGAAGG + Intergenic
1126292348 15:47096295-47096317 CTGTGGAATAGAAAGGTGGAAGG + Intergenic
1126596720 15:50390712-50390734 CTGAGGAAGTGAGAGTGGGAAGG + Intergenic
1126785777 15:52176952-52176974 CTGAGGAAGAGTGAGGAGGCAGG - Intronic
1127271971 15:57409622-57409644 GTGTGAAAGGGGGAGGGAGAAGG + Intronic
1127298067 15:57627369-57627391 GAGAGGGAGAGGGAGGGGGAGGG + Intronic
1127373580 15:58362297-58362319 CTGTGGAAGATGGAGCAGCAAGG - Intronic
1127387067 15:58475253-58475275 GTGTGGAAGATGGAGGGGAGAGG - Intronic
1127584080 15:60365856-60365878 TGGAGGGAGAGGGAGGGGGAGGG - Intronic
1127725505 15:61745388-61745410 CTGTGGACGGGGCAAGGGGATGG - Intergenic
1127856174 15:62955473-62955495 CTGAGGAGGAGGAAGGGGGATGG + Intergenic
1127915037 15:63448412-63448434 TGGGGGAAGAGGGCGGGGGAAGG - Intergenic
1128005574 15:64237123-64237145 GTGAGGGAGTGGGAGGGGGAAGG + Intronic
1128111887 15:65081708-65081730 CTATGGAAGAGGGAAGAGAAAGG - Intergenic
1128220312 15:65964227-65964249 CTTTGGAAGTGGGGGGTGGAGGG + Intronic
1128247880 15:66145206-66145228 CATTAGAAGAGGGAGAGGGAGGG - Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128346336 15:66854744-66854766 CTGGGGAAGGGGGAGGGGCCAGG + Intergenic
1128355752 15:66925293-66925315 CTGAGGAAGAGAGAGAAGGAAGG - Intergenic
1128393986 15:67204831-67204853 CTGTGAAAGTGGGATGGGCAGGG - Intronic
1128559641 15:68656146-68656168 CGGTGCGAGGGGGAGGGGGAGGG - Intronic
1128582899 15:68821125-68821147 CTGTGGCTGAGTGAGGGGGGTGG + Intronic
1128705119 15:69832593-69832615 AAGTGGAAGAGGAAGGGGAAAGG + Intergenic
1128961096 15:72005622-72005644 CAGAGGAAGAGGCAGGGGAAGGG - Intronic
1129044877 15:72725761-72725783 AAGGGGAAGAGGAAGGGGGAAGG - Intronic
1129054332 15:72808092-72808114 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
1129069352 15:72937920-72937942 CTGTGGAAGAGGAAGGATGCTGG + Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129247224 15:74286894-74286916 GAGGGGAAGAGGGAGGGGGAAGG - Intronic
1129295028 15:74595558-74595580 CAGAGGAAGAGCGAAGGGGAGGG - Intronic
1129615730 15:77097718-77097740 CTGCAGGAGAGGGAAGGGGAAGG + Intergenic
1129674141 15:77623229-77623251 CCAAGGAAGAGGCAGGGGGAGGG + Intronic
1129897150 15:79117004-79117026 CTGCTGAAGAGGCAGGTGGAAGG + Intergenic
1129903708 15:79171502-79171524 CTCTGGAACAGGGATGGGGGTGG - Intergenic
1130095306 15:80851153-80851175 ATGTGGGAGGGGGAGGGGCAGGG + Intronic
1130118320 15:81024735-81024757 CTGTGGTGGAGGCAGGGGGAAGG + Intronic
1130344634 15:83031627-83031649 GTGGGGCAGCGGGAGGGGGAAGG + Intronic
1130510652 15:84586471-84586493 GTGAGGAAGAGTAAGGGGGAGGG - Intergenic
1130637797 15:85641727-85641749 CTTTGGAAGGATGAGGGGGATGG - Intronic
1130669572 15:85899621-85899643 TGGTGGGAGAGGGAGGGGAAAGG + Intergenic
1130710740 15:86278624-86278646 CTGGGGGAAAGGGAAGGGGAAGG - Intronic
1130839303 15:87682744-87682766 CTGTGGCAGAGGGAGGAATAAGG - Intergenic
1131044051 15:89297762-89297784 CGTGGGGAGAGGGAGGGGGAGGG + Intronic
1131091032 15:89625183-89625205 CTGTGGGAGAGGCGGGGGCAGGG - Exonic
1131115295 15:89791694-89791716 CTTTGGAAGACTGAGGTGGATGG - Intronic
1131119632 15:89814452-89814474 CTGGGGAGGACGGACGGGGAGGG - Intronic
1131468151 15:92672424-92672446 AGGTGGAAGTGGGAGCGGGAGGG - Intronic
1131499909 15:92952321-92952343 CTGGGGAGGAGGGAGGGGGATGG + Intronic
1131641573 15:94299029-94299051 AAGGGGAAGGGGGAGGGGGAGGG - Intronic
1131708197 15:95021443-95021465 GTGTGTAGGAGGGAGGGGGAAGG - Intergenic
1131736616 15:95339398-95339420 ATGGAAAAGAGGGAGGGGGAAGG + Intergenic
1131848885 15:96516827-96516849 TTGGGGTGGAGGGAGGGGGAAGG - Intergenic
1132148295 15:99441593-99441615 CTGGGGCAGAGGGTGGGGAACGG + Intergenic
1132277295 15:100579024-100579046 GTGGGGTAGGGGGAGGGGGAAGG + Intronic
1132368787 15:101278109-101278131 TGGTGGAAGAGGGTGCGGGACGG - Intergenic
1202965344 15_KI270727v1_random:169808-169830 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1132664685 16:1076092-1076114 GGGAGGGAGAGGGAGGGGGAGGG - Intergenic
1132868177 16:2104056-2104078 TGGTGGAGGGGGGAGGGGGAAGG + Intronic
1132891239 16:2205794-2205816 CTGCGGAGGTGGGGGGGGGACGG + Intronic
1132897215 16:2234790-2234812 CGGTGGAGGTGGGAGGGGGAGGG + Intronic
1133275996 16:4638823-4638845 CCGAGGAAGGGGGAGTGGGAAGG - Intronic
1133365217 16:5203737-5203759 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
1133508054 16:6431380-6431402 CCCTGGAAGAGGGAGGGAAAAGG + Intronic
1133520260 16:6549463-6549485 GTGGGGAGGAGGGAGGAGGAGGG + Intronic
1133558113 16:6924829-6924851 GTGGGGTAGGGGGAGGGGGAGGG - Intronic
1133786970 16:8981474-8981496 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
1133842767 16:9425051-9425073 AGGGGGGAGAGGGAGGGGGAAGG + Intergenic
1133908117 16:10039764-10039786 GGGAGGGAGAGGGAGGGGGAGGG + Intronic
1134053821 16:11156690-11156712 CAGTGGAAGAGGGCAGGGGCTGG + Intronic
1134449400 16:14354225-14354247 AGGAGGAAGGGGGAGGGGGAAGG + Intergenic
1134479279 16:14603533-14603555 TGGTGGAGGAGGAAGGGGGAAGG - Intronic
1134549300 16:15131868-15131890 TGGTGGAGGGGGGAGGGGGAAGG + Intronic
1134690963 16:16190876-16190898 CTGGAGAAGAGGGAGGGGAGGGG + Intronic
1134692108 16:16197738-16197760 CTGGGGCAGAGGGAGAGGGGAGG + Intronic
1134777423 16:16865227-16865249 ATGTGGAAGGGGGAGTGAGAAGG + Intergenic
1135163700 16:20120166-20120188 AGGTGGAGGAGGGAGGGAGAGGG - Intergenic
1135221805 16:20620869-20620891 CAGTTGAGGAGGGAGGGGGAGGG + Intronic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135694728 16:24575839-24575861 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
1135992917 16:27228643-27228665 GGGTGGAAGAGGGTGGGGGCTGG - Intronic
1136165003 16:28447957-28447979 GAGAGGAAGGGGGAGGGGGAGGG - Intergenic
1136197960 16:28667017-28667039 AAGTGGGAGAGGAAGGGGGAGGG + Intergenic
1136197964 16:28667023-28667045 GAGAGGAAGGGGGAGGGGGAGGG + Intergenic
1136214309 16:28781200-28781222 GAGAGGAAGGGGGAGGGGGAGGG + Intergenic
1136259027 16:29061039-29061061 AAGTGGGAGAGGAAGGGGGAGGG + Intergenic
1136259031 16:29061045-29061067 GAGAGGAAGGGGGAGGGGGAGGG + Intergenic
1136411610 16:30080966-30080988 ATGCGGAAGAGGGAGCGGCAGGG + Intronic
1136539882 16:30923461-30923483 TGGTGGAGGAAGGAGGGGGAAGG + Intronic
1136751371 16:32638322-32638344 CTGTGGAAGGGGTGGGGGCAGGG + Intergenic
1137270424 16:46899425-46899447 CTGGGGCAGAGGGCTGGGGAGGG + Intronic
1137374801 16:47943354-47943376 CTGAGGAAGATGGAGCGGAAGGG - Intergenic
1137518951 16:49175244-49175266 TAGTAGAAGAGGGAGAGGGAGGG - Intergenic
1137537950 16:49341824-49341846 CTCTGGCAGAGGGAGTGGCAGGG + Intergenic
1137557002 16:49477146-49477168 GAGCGGAAGGGGGAGGGGGAGGG + Intergenic
1137626904 16:49914816-49914838 CTGCAGAAGAGGTGGGGGGAGGG + Intergenic
1138202543 16:55100921-55100943 CTGTGGAAGGAAGAGAGGGAGGG + Intergenic
1138271151 16:55696736-55696758 CTGTGGAAGGCTGAGGTGGAAGG + Intronic
1138619283 16:58198287-58198309 CTGTGGCGGCGGGAGGGCGAGGG - Intergenic
1138964873 16:62072091-62072113 CAGTGGAAGAAGCTGGGGGAAGG - Intergenic
1139043653 16:63030733-63030755 CTGATGCAGAGGGATGGGGATGG + Intergenic
1139359209 16:66387120-66387142 CTGGGGATGAGGGAGGGAGGAGG - Intronic
1139616694 16:68099679-68099701 TTGGGGAAGAGGGAGGGAAAAGG - Intronic
1139652485 16:68369447-68369469 CTGGGGTAGGGGGCGGGGGAGGG + Intronic
1139759318 16:69171670-69171692 CTGTGGGAGAGGGGAGAGGAGGG + Intronic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139877501 16:70157880-70157902 CTTTAGAATAGGGAGGGGAAGGG + Exonic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1140110341 16:71998692-71998714 CTTTGGAAGGTGGAGGTGGATGG - Intronic
1140134661 16:72195315-72195337 CTGTGAAAAGGAGAGGGGGAAGG - Intergenic
1140219548 16:73033636-73033658 CTGTGAAAGTGTGAGGTGGAAGG - Intronic
1140262196 16:73390159-73390181 CTGAGGAACAGGTAGAGGGACGG - Intergenic
1140279763 16:73543827-73543849 CTGGAGAAGGGGGTGGGGGAGGG + Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140382775 16:74505474-74505496 CTTTGGAAGACCGAGGGGGGTGG + Intronic
1140509052 16:75494456-75494478 CTGTGAAAAAGGGAGGAGAAAGG + Intronic
1141163987 16:81648037-81648059 CGGTGGAAGCAGCAGGGGGAGGG - Intronic
1141172583 16:81700688-81700710 CTGGGGAAGAGGCAGCGGGAAGG + Intronic
1141376849 16:83539176-83539198 CTGTGGGCAAGGGTGGGGGATGG + Intronic
1141456134 16:84144042-84144064 GAGAGGGAGAGGGAGGGGGAGGG - Intronic
1141588159 16:85048971-85048993 GTGTGTGAGAGGGAGAGGGAGGG + Intronic
1141610261 16:85177164-85177186 CCCTGGAAGCAGGAGGGGGAAGG + Intronic
1141625358 16:85258634-85258656 CTGTGGGAGGAGGAGGGAGAGGG + Intergenic
1141766668 16:86063697-86063719 GGGAGGAAGAGGGAGGGAGAGGG + Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1141927496 16:87178972-87178994 GGGAGGAAGAGGGAGAGGGACGG - Intronic
1141997000 16:87641976-87641998 CTGTGGAGGAGGGGTGGGGCTGG + Intronic
1142000338 16:87660680-87660702 CTGTGGAAGAGGCAGCTGGTGGG - Intronic
1142011613 16:87718313-87718335 GGGAGGGAGAGGGAGGGGGAGGG - Intronic
1142011630 16:87718346-87718368 TGGAGGGAGAGGGAGGGGGAGGG - Intronic
1142128477 16:88421596-88421618 CTGGGGCAGAGGAAAGGGGATGG + Intergenic
1142259322 16:89035231-89035253 ATGAAGAGGAGGGAGGGGGAGGG - Intergenic
1142284366 16:89165719-89165741 GGGTGGAAGAGGGAGCAGGAAGG - Intergenic
1142284865 16:89167593-89167615 CAGTGGAGGCGGGTGGGGGAAGG - Intergenic
1142307056 16:89291586-89291608 GTTTGGAGGAGGGACGGGGAAGG - Intronic
1142334041 16:89475333-89475355 CTGGTGATGAGGGAGGGGAATGG - Intronic
1142411135 16:89917848-89917870 GGGTGGAAGCGGGAGGGGGATGG - Intronic
1203053505 16_KI270728v1_random:897577-897599 CTGTGGAAGGGGTGGGGGCAGGG + Intergenic
1142603568 17:1069729-1069751 CAGTGGCACAGGGCGGGGGAGGG - Intronic
1142767671 17:2074841-2074863 CTGATGGAGAGGGAGGGGCAGGG + Intronic
1142808591 17:2384853-2384875 CTGGGGGACAGGGACGGGGAGGG + Exonic
1142816224 17:2428010-2428032 AAGTGGAAGAGGGAAGGAGAGGG + Intronic
1142825150 17:2506252-2506274 GAGAGGGAGAGGGAGGGGGAGGG - Intronic
1143250119 17:5517352-5517374 CTGTGTATGTGGGAGGGGGGGGG - Intronic
1143309518 17:5977011-5977033 TTGTGGGAGAGGGTGAGGGAGGG + Intronic
1143473428 17:7190370-7190392 GTGTGGGAGAGGATGGGGGAGGG + Exonic
1143532075 17:7511343-7511365 GTGTGGGAGTGGGAGGAGGAAGG - Intronic
1143583866 17:7841888-7841910 CTGGGGGAGGGGGAGGCGGAGGG - Intronic
1143594770 17:7907584-7907606 CTGTGGCTGTGGGAGGGGGTAGG - Exonic
1143887538 17:10076204-10076226 AAGTGGGAGGGGGAGGGGGAGGG + Intronic
1143968003 17:10770671-10770693 GTGAGGAAGATGGATGGGGAGGG + Intergenic
1143994808 17:10997229-10997251 CTGGGGCAGAGGGCTGGGGAAGG - Intergenic
1144334341 17:14255524-14255546 TTGTAGGAGAGGGAGGAGGAGGG - Intergenic
1144576277 17:16431864-16431886 GTGGGGAAGGGGGAGGGGGCCGG - Intronic
1144671939 17:17137895-17137917 CTCTGGAAGAGACAGTGGGAGGG - Exonic
1144675331 17:17158211-17158233 GTGGGGGAGGGGGAGGGGGACGG - Intronic
1144866205 17:18337560-18337582 CGTGGGGAGAGGGAGGGGGAGGG - Intronic
1144955763 17:19018108-19018130 CTGAGGGAGAGGGTGGAGGAAGG - Intronic
1145855851 17:28156564-28156586 TTGTGGGAGGGGGAGGGGGATGG + Intronic
1146049044 17:29533827-29533849 CGTGGGGAGAGGGAGGGGGAGGG + Intronic
1146095982 17:29930409-29930431 CTGTGGAGTGGGGTGGGGGAAGG + Intronic
1146444682 17:32923809-32923831 TGGAGGGAGAGGGAGGGGGAGGG + Intergenic
1146910668 17:36646485-36646507 CTGGGGAAGAGGGTGGAAGAGGG + Intergenic
1147145601 17:38482698-38482720 CTGTGGAAGAGGGGCTGAGATGG + Intronic
1147167571 17:38601591-38601613 CTGTGGTGTGGGGAGGGGGATGG + Intronic
1147168471 17:38605339-38605361 GTGTGGAAGGGGGAGGGGTGAGG - Intronic
1147228073 17:38996374-38996396 CTCAGCAAGAGGGAGTGGGAAGG - Intergenic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147334646 17:39719934-39719956 CAGTGGAAGAGTGGGTGGGAAGG - Intronic
1147340628 17:39751460-39751482 CTGGGGGAGAGGGTGGGGGCTGG + Intergenic
1147364491 17:39951394-39951416 ATGTGGAATAGGGATTGGGAGGG - Intergenic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1147390321 17:40105257-40105279 GTGTGGTGGGGGGAGGGGGATGG + Intergenic
1147608467 17:41787106-41787128 CTGTTGGACAGGTAGGGGGAAGG - Intergenic
1147654099 17:42078723-42078745 CTGGGGCAGAGGCAGGGGCATGG + Intergenic
1147754677 17:42760824-42760846 GTGGAGAAGAGGGAGGGGGCTGG - Intronic
1147911455 17:43858516-43858538 CTGCTGAAGAGGGAGGGGACAGG + Intronic
1147992490 17:44343687-44343709 CTGAGGATGAGGCAGGGGCAGGG - Intergenic
1148269765 17:46253755-46253777 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
1148455849 17:47811027-47811049 CTGAGGAAGAGCGAGTGAGAAGG - Intronic
1148468822 17:47880886-47880908 TTGTGGCAGAGGCTGGGGGAGGG - Intergenic
1148484015 17:47978928-47978950 CTCTGGAAGATGCAGGGGGGAGG + Intronic
1148790618 17:50170617-50170639 CTGTGGAAAAGTGAAGGAGAGGG - Intronic
1148838268 17:50478107-50478129 GTGTGTAGGAGAGAGGGGGAAGG - Intergenic
1148846388 17:50532513-50532535 CTGTTGAAGAGGCAGGGGAAGGG + Intergenic
1148864062 17:50619471-50619493 GTGGGGAAGAGGGAAGGCGAAGG - Intronic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1148965020 17:51427859-51427881 CAGTGGGAGAGGGAGTGAGAGGG + Intergenic
1149061084 17:52422555-52422577 GTGGGGTAGGGGGAGGGGGAAGG + Intergenic
1149242415 17:54665485-54665507 AGGTTGAAGAGAGAGGGGGAAGG + Intergenic
1149315138 17:55431869-55431891 CAGGGGGAGGGGGAGGGGGAGGG + Intergenic
1149445356 17:56708921-56708943 CTGATAAAGAGGGAGGTGGAAGG + Intergenic
1149461356 17:56832687-56832709 GTGTTTAAGAGGGAGGAGGAGGG - Intronic
1149632841 17:58141783-58141805 GAGAGGAAGAGGGAGGGGGAGGG - Intergenic
1150041214 17:61863402-61863424 CCCAGGAAGAGGGAGGAGGAAGG - Exonic
1150129964 17:62663765-62663787 CAGTGCAAGGGGCAGGGGGAAGG + Intronic
1150312654 17:64141578-64141600 CTTTGGAAGGCAGAGGGGGAAGG + Intergenic
1150312986 17:64144871-64144893 CTCTGGGAGACGGAGGCGGATGG - Intergenic
1150483604 17:65529231-65529253 CTGTTGCAGAGGGAGAGGCAGGG - Exonic
1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG + Intergenic
1150824206 17:68460285-68460307 ATGGGGAAGGGGGAGGGGCAGGG + Intergenic
1150889018 17:69123012-69123034 CTGGGGTAGGGGGAGGGGGGAGG + Intronic
1151305660 17:73261356-73261378 CTGTAGAGAAGGAAGGGGGAGGG + Intronic
1151325880 17:73379550-73379572 CTGTGGGGGAGAGTGGGGGAGGG + Intronic
1151326830 17:73384917-73384939 ACGTGGCAGAGGGAGGGGGCAGG - Intronic
1151459500 17:74246096-74246118 CCCTGGAAGAAGGAAGGGGAAGG + Intronic
1151572687 17:74935198-74935220 CAGAGGCAGAGGGAGGGGAAGGG + Intergenic
1151629767 17:75302475-75302497 CTATGGAAGAAGAGGGGGGAAGG + Intergenic
1151654624 17:75490168-75490190 CTGGGGAGGAGGGAAGGGAAGGG - Intronic
1151770729 17:76158920-76158942 CTGTGGCAGAGTAAAGGGGAGGG - Intronic
1151852195 17:76697656-76697678 AGGTGGAGGCGGGAGGGGGAAGG + Intronic
1151859055 17:76745689-76745711 CAGGAGAAGAGGGAGGGAGATGG - Intronic
1151919173 17:77140959-77140981 CCGGGGAGGCGGGAGGGGGAAGG - Intronic
1151955514 17:77378268-77378290 CTTTGGAGGAGTGAGGGGTATGG + Intronic
1152120037 17:78412938-78412960 CTGGGGAAGAGGGGGTGGGAGGG + Intronic
1152257989 17:79251491-79251513 CTGGAGACAAGGGAGGGGGAAGG - Intronic
1152341018 17:79724920-79724942 CTTTGGAAGACGGAGGAGGGTGG + Intergenic
1152354330 17:79799334-79799356 CTGTGGAAGTGGGAGGGAGGGGG + Intronic
1152377963 17:79928394-79928416 ATGGGGAAGTGGGAGTGGGAGGG + Intergenic
1152562718 17:81086635-81086657 CTGTGGACGAGGGGGGCCGAGGG - Intronic
1152609217 17:81307443-81307465 AAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1152618429 17:81348559-81348581 CTGGGACAGTGGGAGGGGGATGG + Intergenic
1152650805 17:81491774-81491796 GGGTGAGAGAGGGAGGGGGAGGG - Intergenic
1152681451 17:81670456-81670478 GAGTGGAGGCGGGAGGGGGAGGG + Intronic
1152688902 17:81708526-81708548 CTGGGGGAGCGGGAGGGGCAGGG + Intergenic
1152757125 17:82091712-82091734 CAGTGGTAGAGGGAGTGGGGCGG - Intronic
1153342286 18:3987941-3987963 CTATGGACCAGGGCGGGGGATGG + Intronic
1153460044 18:5323049-5323071 GTGTGGAACAGGGAGGGAGGAGG + Intergenic
1153518600 18:5930010-5930032 CTGGGGAGGAGGGAGTGGCAGGG + Intergenic
1153544383 18:6191185-6191207 CTGGGGCAGAGGGAGGTGGCTGG + Intronic
1153767292 18:8386376-8386398 CTGAGGCAGAGAGAGAGGGAGGG + Intronic
1153852122 18:9104702-9104724 GGGTGGAAGGGGGAGGGAGAAGG - Intronic
1154016908 18:10626986-10627008 CTGTGGTGGAGGGAAGGTGAGGG - Intergenic
1154188599 18:12208658-12208680 CTGTGGTGGAGGGAAGGTGAGGG + Intergenic
1154290122 18:13099166-13099188 CATGGGGAGAGGGAGGGGGAGGG + Intronic
1154341514 18:13506361-13506383 CTGGGGTGGGGGGAGGGGGAGGG - Intronic
1154418682 18:14203450-14203472 GTGGGGTGGAGGGAGGGGGAAGG - Intergenic
1155332077 18:24728638-24728660 CTGTGATAGAGGCTGGGGGAAGG - Intergenic
1155492255 18:26410671-26410693 CTGGGGAGGTGGTAGGGGGAGGG + Intergenic
1155829244 18:30492227-30492249 GTGGGGAAGAGGGAGGGAGAGGG + Intergenic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1156111418 18:33731843-33731865 GTGAGGAGGAGGAAGGGGGAAGG - Intronic
1156292405 18:35759456-35759478 CTGGGGAGGGGGGAGGGGGGAGG + Intergenic
1156462102 18:37326828-37326850 AAGTGGCAGAGGGATGGGGAGGG - Intronic
1156501462 18:37562178-37562200 CTGTGGAGGAGGGAGTGGGTGGG - Intronic
1156541317 18:37913738-37913760 CTGTGGCTGAAGGAGGTGGATGG - Intergenic
1156932923 18:42666396-42666418 GTGGGGTAGGGGGAGGGGGAGGG + Intergenic
1157035112 18:43962258-43962280 ATGTGGAAGAGGAAAGGGAAGGG - Intergenic
1157214690 18:45773157-45773179 GAGGGGGAGAGGGAGGGGGAGGG - Intergenic
1157244968 18:46045510-46045532 GTGGGGTAGGGGGAGGGGGAAGG + Intronic
1157257695 18:46153248-46153270 CTGAGGAAGGGGCTGGGGGAGGG + Intergenic
1157554746 18:48606197-48606219 CTGAGGAAGGGGGAAAGGGACGG - Intronic
1157630282 18:49088410-49088432 GTGGGGTAGGGGGAGGGGGAAGG + Intronic
1157686893 18:49650143-49650165 TAGGGGAAGAGGGAAGGGGAAGG + Intergenic
1158157042 18:54437637-54437659 CTGTGGAAGAGAGAGGTAAAAGG + Intergenic
1158346363 18:56520681-56520703 CTGAGGGAGAGGGATGTGGAAGG + Intergenic
1158962777 18:62600506-62600528 CTGAGGCAGAGGTAGGGGGAGGG + Intergenic
1159014484 18:63090050-63090072 GAGAGGGAGAGGGAGGGGGAAGG - Intergenic
1159202591 18:65206629-65206651 CAGTGGAAGGGTGAGGAGGACGG - Intergenic
1159876032 18:73812397-73812419 CTATGGAAAAGAGAGGGGGAGGG + Intergenic
1159907378 18:74107772-74107794 CTCTGGAAAAGGGAGGGGAAAGG + Intronic
1159918271 18:74204718-74204740 GGGTGGGAGAAGGAGGGGGATGG + Intergenic
1159918282 18:74204745-74204767 GGGTGGGAGAAGGAGGGGGATGG + Intergenic
1159918293 18:74204772-74204794 GGGTGGGAGAAGGAGGGGGATGG + Intergenic
1159918312 18:74204826-74204848 GTGTGGGAGAAGGAGGGGGATGG + Intergenic
1159918321 18:74204853-74204875 GTGTGGGAGAAGGAGGGGGATGG + Intergenic
1160129592 18:76212928-76212950 CAGAGGAAGAGAGAGGGAGAGGG - Intergenic
1160228580 18:77029428-77029450 GAGAGGGAGAGGGAGGGGGAGGG + Intronic
1160237675 18:77098955-77098977 GAGGAGAAGAGGGAGGGGGAAGG - Intronic
1160394018 18:78559015-78559037 CTGGGGAGGAGGGGGTGGGAGGG - Intergenic
1160592968 18:79954150-79954172 CTTTGTAAGAGGGAGGCAGAAGG + Intergenic
1160659503 19:291532-291554 GAGGGGAGGAGGGAGGGGGAGGG + Intergenic
1160848988 19:1180670-1180692 CTGGGGAAGTGGGTGGAGGAAGG - Intronic
1160927785 19:1555468-1555490 GGGTGGGAGAGGGACGGGGAGGG - Exonic
1161012694 19:1968080-1968102 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161012730 19:1968188-1968210 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161012789 19:1968358-1968380 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161266681 19:3367480-3367502 CTACGGGAGGGGGAGGGGGAGGG - Intronic
1161270516 19:3387074-3387096 CTGGGATAGAGGGAGAGGGAGGG + Intronic
1161300919 19:3542945-3542967 CTGGAGAAGAGGGAGGGGAGAGG - Intronic
1161389258 19:4012726-4012748 ATGAGGAGGAGGGAGGGGGCAGG + Intronic
1161448262 19:4329811-4329833 CTGGGGGTGGGGGAGGGGGAGGG - Intronic
1161488056 19:4546366-4546388 CTGCGGGAGAGGGAGGTGGGTGG - Intronic
1161589576 19:5123283-5123305 CTGTGGAAGCGGGAAGGTCACGG + Intronic
1161650006 19:5478476-5478498 CTGTGGAAGAGGGAGGCCGCTGG + Intergenic
1161684807 19:5697490-5697512 CTGAGGCAGAGGGAGGAGGGGGG + Intronic
1161716726 19:5880512-5880534 GTGGGGAAGGGGCAGGGGGAGGG - Intronic
1161787026 19:6333120-6333142 CTGTGGTAGGGGGAGGCAGAGGG - Intronic
1161957982 19:7506802-7506824 CTGGGGAAGAGGGAGGAGGTGGG - Intronic
1162069446 19:8144973-8144995 CTGTGGAGGAGAGAGGGTGATGG + Intronic
1162088344 19:8261907-8261929 CTGGGGAACAGAGAGAGGGATGG - Intronic
1162158533 19:8696032-8696054 CTGTGGAGGAGGGAGTTGGGAGG + Intergenic
1162237375 19:9319803-9319825 GTGTGGTGGGGGGAGGGGGAGGG + Intergenic
1162254941 19:9482647-9482669 CGTGGGGAGAGGGAGGGGGAGGG - Intronic
1162302630 19:9852625-9852647 CTTTGGGAGACTGAGGGGGAAGG - Intergenic
1162385121 19:10356519-10356541 CTGGGGAAGTGGGACGGGGCTGG - Intronic
1162604648 19:11697335-11697357 CTGTGGAAGGCTGAGGGGGGAGG - Intergenic
1162799106 19:13101274-13101296 ATGGGAAGGAGGGAGGGGGAGGG + Intronic
1162849630 19:13420896-13420918 CTGTAGAAGATGGTGGGGGATGG - Intronic
1162932969 19:13966380-13966402 CTGTGGGAGGGAGAGGGGGGAGG - Intronic
1162934755 19:13976392-13976414 CTGTGGAGATGGGAGAGGGAAGG + Intronic
1162948514 19:14057497-14057519 CCGCGGAGGAGGGAGGGGAAAGG - Intronic
1162958734 19:14113950-14113972 CTGGGGAAGAGAGAGGGGATCGG - Intronic
1163137647 19:15324202-15324224 CTGGGGAGGGGGGAAGGGGAAGG + Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163198887 19:15747821-15747843 CGGTGGGGGAGGGAGGGAGAGGG + Intergenic
1163511738 19:17739538-17739560 CAGTGGAAGAGGGGTGGGGGTGG + Intergenic
1163518976 19:17780795-17780817 CTGAGGAAGCAGGAGAGGGAGGG + Intronic
1163745342 19:19043395-19043417 CTGGGGCAGAGGCAGGGGGCTGG + Intronic
1163779630 19:19239632-19239654 GAGTGGAAGGAGGAGGGGGAGGG - Intronic
1164262351 19:23579122-23579144 TTTTGGCAGTGGGAGGGGGATGG + Intronic
1164289687 19:23856128-23856150 CTGAGGAAGAGGTAGAGAGAGGG + Intergenic
1164348623 19:27302252-27302274 CTGGGGTGGAGGGAGGGGGGAGG - Intergenic
1164378610 19:27711737-27711759 CTGTGGGAGAGGAAGGCTGAGGG + Intergenic
1164405240 19:27938369-27938391 TTCTGGGAGAGGCAGGGGGATGG + Intergenic
1164466822 19:28494145-28494167 CTGGGGTAGAGGGAGGGTGGTGG + Intergenic
1164568983 19:29355148-29355170 CTGTAGGAGAGAGAGGGGGTGGG - Intergenic
1164607297 19:29609370-29609392 CTGTGGGAGAGCAATGGGGATGG - Intronic
1164741053 19:30575885-30575907 ATGTAGAAGAGGGGGAGGGACGG + Intronic
1164790572 19:30974242-30974264 GTGTGTAAGATGGAGGTGGAGGG - Intergenic
1164933655 19:32194880-32194902 CTATGGAAGATGGAAGGGGAGGG - Intergenic
1165059706 19:33199126-33199148 ATGGGGAAGAGGGAGGGGTTCGG - Intronic
1165257728 19:34589732-34589754 GTGTGGATGATGGAGGAGGAGGG + Intergenic
1165394684 19:35557898-35557920 CTGTGGACGAGGGAACGGGGCGG + Intronic
1165433037 19:35783124-35783146 CTGAGGAGGAGAGAGGAGGAGGG + Intronic
1165462691 19:35953354-35953376 CTGGGGAAGAGGGATGGCGTGGG - Intergenic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1165922014 19:39305226-39305248 CGGAGCAGGAGGGAGGGGGATGG - Intergenic
1165941456 19:39416659-39416681 CGGGGGTAGAGGGAGGGTGACGG - Intronic
1166259492 19:41627631-41627653 CTGTGGTGGAGGGAGGTGGGTGG + Intronic
1166375635 19:42325573-42325595 CTGTGGGAGGGCGAGGGGGCGGG - Intergenic
1166407104 19:42529049-42529071 CTGTGATAGAGGGAGGTGGGTGG + Intronic
1166499929 19:43332843-43332865 CTGTGGTGGAGGGAGGTGGGTGG + Intergenic
1166893806 19:46010557-46010579 CTGTGGGAGAGGGAGGCAGGAGG + Intronic
1167146103 19:47681375-47681397 CTGTGGCAGCTGGGGGGGGAAGG + Intronic
1167173151 19:47847153-47847175 CTTTGGAAGACTGAGGTGGAAGG + Intergenic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167583116 19:50358074-50358096 TTGAGGAAGAGGGAGGCGAAGGG - Intronic
1167649679 19:50722495-50722517 CTCAGGAGGAAGGAGGGGGAGGG + Intergenic
1167663075 19:50807836-50807858 CTGGGGTAGAGGGATAGGGAAGG - Intergenic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167739013 19:51312673-51312695 CAGTGGAAGAGCGATGGGCATGG + Intronic
1167924332 19:52810891-52810913 GAGAGGGAGAGGGAGGGGGAGGG - Intronic
1167937206 19:52918968-52918990 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
1167947201 19:52997699-52997721 CTGGGGTAGGGGGAGGGCGAGGG - Intergenic
1167971239 19:53188588-53188610 GAGAGGGAGAGGGAGGGGGAGGG + Intronic
1168072002 19:53958581-53958603 CTGGGGACGCGGGAGGGGGCGGG + Intergenic
1168123332 19:54267360-54267382 GAGTGGGGGAGGGAGGGGGAGGG + Intronic
1168343965 19:55641483-55641505 GTGTGTAACAGGGAGAGGGATGG + Intronic
1168411272 19:56141617-56141639 CTGAGGGAGAGGACGGGGGAGGG + Intronic
1168468810 19:56624897-56624919 CTCTGGATGGGAGAGGGGGATGG - Exonic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
1168588803 19:57615727-57615749 ATAAGGAAGAGGGAAGGGGAAGG + Intronic
1168627942 19:57933850-57933872 CTGTGTTTGAGGGAGGAGGAAGG - Exonic
1202714778 1_KI270714v1_random:36186-36208 GTGTGTGAGAGGGAGGGAGAGGG - Intergenic
925041964 2:739513-739535 CTGTGCAGGAGGCAGGGGAATGG + Intergenic
925166673 2:1719870-1719892 GTGTGAAAGAGAGAGAGGGAGGG + Intronic
925292395 2:2756398-2756420 CTGTGGTTGAGGGACAGGGAAGG - Intergenic
925372931 2:3360909-3360931 ATGGGGAAAGGGGAGGGGGAAGG + Intronic
925377539 2:3398961-3398983 CAGGGGAGGTGGGAGGGGGAGGG - Intronic
925414678 2:3661094-3661116 CTAATGAACAGGGAGGGGGACGG - Intronic
925459853 2:4051540-4051562 CTTTGGAAGGTGGAGGTGGAAGG + Intergenic
925476435 2:4221916-4221938 CTGGAGAAGAGAGATGGGGAAGG + Intergenic
925712891 2:6758669-6758691 ATGTGGAAGAGGGAGGCAGAGGG + Intergenic
925774319 2:7319190-7319212 CTGAGGGAGAGGGAGGTAGAAGG - Intergenic
925911009 2:8573649-8573671 CTGTGCAAGGTGGTGGGGGAAGG + Intergenic
925991751 2:9260080-9260102 CTATGGAGGTGGGAGGGGAAAGG + Intronic
926130059 2:10297376-10297398 CTGGGGAACAGGGCGGGGTATGG - Intergenic
926266823 2:11330828-11330850 GGGAGGAAGAGGGAGGAGGAGGG + Intronic
926266832 2:11330850-11330872 GGGAGGAAGAGGGAGGAGGAGGG + Intronic
926429102 2:12767703-12767725 CTGAGGAAGATGGAGGTGGTAGG - Intergenic
926589058 2:14720265-14720287 GTGTGAGAGAGGGAGAGGGAGGG - Intergenic
926687496 2:15709417-15709439 CTCTGCATGAGGGAGGGGGTAGG + Intronic
926731381 2:16038286-16038308 CAGGGGAGGAGGGAGGGAGATGG + Intergenic
927064858 2:19461067-19461089 CAGTTGCAGGGGGAGGGGGATGG - Intergenic
927159354 2:20242911-20242933 CTGTAGAAGAGGGTGGGTAATGG + Intergenic
927159846 2:20246673-20246695 CAGTGGAAGAGGGTGCAGGAAGG + Intergenic
927391461 2:22600133-22600155 CTGTGGAACTAGGAGGTGGAGGG + Intergenic
927732922 2:25491184-25491206 GGGAGGAAGAGGCAGGGGGAGGG + Intronic
927959625 2:27233021-27233043 ATCTGCAAGAGGGAGGGGAAGGG - Exonic
927973762 2:27322607-27322629 CATTGGAAGTGGGAAGGGGAAGG - Intronic
928005627 2:27558907-27558929 GAGAGGGAGAGGGAGGGGGAGGG + Intronic
928082999 2:28326604-28326626 CAGTCTGAGAGGGAGGGGGATGG + Intronic
928180488 2:29065157-29065179 TTGTGGGAGAGGGCTGGGGAGGG - Intronic
928363571 2:30684947-30684969 CTGGGGAGTGGGGAGGGGGAAGG + Intergenic
929066276 2:37978318-37978340 AGGGGGGAGAGGGAGGGGGAGGG + Intronic
929073465 2:38057785-38057807 AGAAGGAAGAGGGAGGGGGAAGG - Intronic
929252962 2:39779365-39779387 GAGGGGGAGAGGGAGGGGGAAGG + Intergenic
929356003 2:41025392-41025414 ATGTGCAAGAGGGAGAGGAAGGG + Intergenic
929469996 2:42182300-42182322 CAGTGGAGGGGGGAGGGGGGAGG - Intronic
929739336 2:44587438-44587460 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
929818741 2:45257082-45257104 CTGTGGAAGCGGGAGGAACATGG + Intergenic
929899269 2:45987169-45987191 CCCTGGAAGAAGGAGGGGCAGGG + Intronic
929906105 2:46048110-46048132 CTATGGAAGGGGCAGGGGGTGGG - Intronic
929990421 2:46781690-46781712 CTGTGGAGGATGGATGGGGCAGG - Intergenic
930049843 2:47206480-47206502 CTGGGCAAGAGGGAGGTGGGTGG + Intergenic
930158297 2:48127643-48127665 ATGTGAAGGAGGGAGAGGGAGGG + Intergenic
930320480 2:49848408-49848430 CTGTTGGAGGGGTAGGGGGAGGG - Intergenic
930374751 2:50551094-50551116 AGGAGGAGGAGGGAGGGGGAGGG + Intronic
930969616 2:57378979-57379001 CTTTGGAAGAAAGAGGCGGAAGG + Intergenic
930999040 2:57759388-57759410 GTGAAGTAGAGGGAGGGGGAGGG + Intergenic
931604919 2:64042477-64042499 GAGAGGGAGAGGGAGGGGGAAGG + Intergenic
931634506 2:64329391-64329413 TTGGGGAAGAGGGAGAGGTAGGG + Intergenic
931975351 2:67638002-67638024 GAGTAGAAGAGGGAGGGAGAAGG + Intergenic
932179182 2:69630352-69630374 GGGAGGGAGAGGGAGGGGGAGGG + Intronic
932494114 2:72138163-72138185 CTGGGCAAGAGGCAGGGGCATGG - Intronic
932498168 2:72157873-72157895 GTGAGGGAGAGGGAGGAGGATGG + Intergenic
932902491 2:75715468-75715490 CTGAGGTGGAGGGTGGGGGATGG + Intergenic
932909618 2:75792010-75792032 CTGTGGAAGAAGGAGGACTATGG + Intergenic
932973134 2:76570186-76570208 GTGAGGAAGAGGGACAGGGAAGG + Intergenic
933345290 2:81077377-81077399 CACTGAAAGAGGGAGGCGGATGG - Intergenic
933365713 2:81351137-81351159 GTGGGGAAGGGGGAGGGGGGAGG - Intergenic
933529614 2:83490082-83490104 CTGGGGTTGGGGGAGGGGGAGGG + Intergenic
933894125 2:86795008-86795030 GTCTGGGAGTGGGAGGGGGAAGG - Intronic
934574480 2:95391518-95391540 CAGTAGAAGAGGGAGGAGGCTGG - Intergenic
934731614 2:96662054-96662076 GTGTGGAAGAAGAAGGGGCATGG + Intergenic
934748273 2:96774148-96774170 CTGTGGGAGGGGGCAGGGGAAGG + Intronic
934860365 2:97759486-97759508 GTGTGGATGAGGGAGGAAGAGGG + Intronic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935138316 2:100327795-100327817 CTGTTGAAAAGGGCAGGGGAAGG - Intergenic
935206851 2:100903732-100903754 CTGTGGGAGTGGGAGGCTGAAGG - Intronic
935220072 2:101004597-101004619 CAGTGGAGGAGGGAGGGGTGAGG + Intronic
935386897 2:102509306-102509328 GTGTGGAAGAGGGAGGCAGAAGG - Intronic
935564219 2:104589620-104589642 CTGGGGAAGAGGTATGTGGATGG - Intergenic
936154585 2:110039831-110039853 CTGGGGATGGGGCAGGGGGAGGG + Intergenic
936190098 2:110331583-110331605 CTGGGGATGGGGCAGGGGGAGGG - Intergenic
936243885 2:110809934-110809956 CTGTGGAAGAGCTTGGGTGAAGG - Intronic
936451068 2:112634478-112634500 CTGGGGCAGTGGGAGGGGTAGGG + Intergenic
936538579 2:113331792-113331814 CTGTGAAAGACGGAAGGGGTGGG - Intergenic
936644727 2:114355892-114355914 GTGGGGTAGGGGGAGGGGGAAGG - Intergenic
936848813 2:116871758-116871780 GTGGGGTGGAGGGAGGGGGAAGG - Intergenic
936922195 2:117700215-117700237 ATGTGGAAGAAGGAGGTAGAAGG + Intergenic
936927475 2:117751971-117751993 GTGGGGAGGGGGGAGGGGGAAGG + Intergenic
936996568 2:118420789-118420811 CTGTGGAAGAGGGAAGAGCATGG + Intergenic
937151431 2:119689050-119689072 CTGTGGAGGAGTGGGGAGGATGG - Intergenic
937542407 2:122974219-122974241 TTGTGGGAGGGGGAGGGGGAAGG - Intergenic
937572267 2:123379056-123379078 TTGGGGTAGGGGGAGGGGGAGGG - Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937911192 2:127076370-127076392 TTGGGGGAGGGGGAGGGGGAGGG - Intronic
938074893 2:128326535-128326557 CTGCAGAAGAGGGAGGTGGCAGG + Intergenic
938240910 2:129741733-129741755 CTGGGGAACAGGCAGGAGGAAGG - Intergenic
938675038 2:133624125-133624147 TTGGGGAAAAGGGTGGGGGATGG + Intergenic
938949548 2:136244107-136244129 CTGAGGAAGAGAGAGGCGGCTGG + Intergenic
939397913 2:141655100-141655122 CTGGGGAGGAGGAAGAGGGACGG + Intronic
939931538 2:148240266-148240288 GTGAGGCAGGGGGAGGGGGAAGG + Intronic
940450968 2:153836649-153836671 GTGGGGAGGGGGGAGGGGGAGGG - Intergenic
940460577 2:153958808-153958830 CTGTGGAAGAGAGAAAGGAAAGG + Intronic
940472005 2:154112496-154112518 TTGGGGAAGAGGGATGTGGATGG - Intronic
940909739 2:159200095-159200117 CTGTTTAAAAGGGAAGGGGAAGG - Intronic
940931073 2:159432203-159432225 CTGTGGAATGAGGAGAGGGAAGG + Intronic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
941003232 2:160222524-160222546 ATGTGGGTGAGGAAGGGGGATGG - Intronic
941038211 2:160590557-160590579 AGGGGGAAGAGGAAGGGGGAGGG - Intergenic
941146634 2:161854990-161855012 ATGTGGAAGATGGAGGAGAAAGG + Exonic
941399941 2:165018368-165018390 GTGTGGTAGAGAGAGGGAGAGGG + Intergenic
941707385 2:168674335-168674357 CTGTGGAAGAGGAAAAGGGATGG - Intronic
941751686 2:169141307-169141329 CAGAGGAAGAGGGATGAGGATGG - Intronic
941814992 2:169787353-169787375 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
941963744 2:171280074-171280096 CTGTACAAGACGAAGGGGGAGGG + Intergenic
942655179 2:178207726-178207748 CTGGGGAGGAGGGTGGGAGATGG + Intronic
942710287 2:178827497-178827519 CAGGGGTCGAGGGAGGGGGAAGG - Intronic
942799626 2:179861020-179861042 CTGCGGAGGAGGGCGGGGGCCGG + Intronic
943100153 2:183478497-183478519 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
943757201 2:191569151-191569173 CTGTGGGAGGGGGAGAGGGGAGG + Intergenic
944033115 2:195261459-195261481 GTGGGGTGGAGGGAGGGGGAAGG + Intergenic
944077631 2:195749831-195749853 GTGGGGAAGGGGGAGGGGGGAGG + Intronic
944207841 2:197175561-197175583 CTTTGGGGGAGGGAGGGAGAAGG - Intronic
944348922 2:198703816-198703838 TTGTGGAGGAGTGAGAGGGAAGG + Intergenic
944412364 2:199457462-199457484 CTGGGGAAGAGGGAAGGGGAAGG - Exonic
944537483 2:200725458-200725480 CTGTCAAAGGGTGAGGGGGAGGG - Intergenic
944570677 2:201041945-201041967 CCGTGCAAAGGGGAGGGGGAGGG - Intronic
944604749 2:201342554-201342576 CAGTGGAAGAGGGGTGGGAAGGG - Intronic
944636090 2:201677452-201677474 CTGTGAAAGAGTGAGGAGGAAGG - Intronic
944735367 2:202558073-202558095 CTGTGGAAGACTGAGGTGGGTGG + Intronic
945011483 2:205468631-205468653 CTGAGGAAGAGGTAGGGGAATGG + Intronic
945090540 2:206172584-206172606 CTGTGGAAAGGAGAGGGAGAGGG + Intergenic
945198206 2:207257013-207257035 CTGTGCATGTGGCAGGGGGAAGG + Intergenic
945232766 2:207609787-207609809 GAGAGGGAGAGGGAGGGGGAGGG - Exonic
945530636 2:210950114-210950136 CAGAGGGAGAGGGAGGGGGAGGG - Intergenic
945908894 2:215624028-215624050 GAGAGGACGAGGGAGGGGGAAGG + Intergenic
945942479 2:215963214-215963236 CTGTGGAAGGCCGAGGCGGATGG + Intronic
946017697 2:216617312-216617334 CTGTGGATGAGAGGGGGTGATGG + Intergenic
946406756 2:219496023-219496045 CTGAGTCAGAGGGAGGCGGATGG + Intronic
947103256 2:226644149-226644171 CTGTGGGAGAGAAAGGGAGAGGG - Intergenic
947313296 2:228827636-228827658 GACTGGAAGAGGGAGAGGGAAGG + Intergenic
947313830 2:228833000-228833022 GTGGGGTAGAGGGAGGGGGGAGG + Intergenic
947859559 2:233348972-233348994 CTGTGGCAGAGGACAGGGGAAGG - Intergenic
948091951 2:235302225-235302247 AGGAGGAAGAGGGAGGAGGAGGG - Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948205559 2:236161112-236161134 CTGGGGCAGAGGGAGGGTGGGGG - Intergenic
948428301 2:237902262-237902284 AGGTGGAAGAGGGAGGGGTAAGG + Intronic
948558548 2:238835218-238835240 AGGAGGAGGAGGGAGGGGGAGGG - Intergenic
948575790 2:238948692-238948714 GAGTGGAGGAGGGAGTGGGATGG - Intergenic
948706312 2:239795602-239795624 TAGGGGAAGAGGGATGGGGAGGG - Intronic
948790175 2:240372772-240372794 CTGTGGTGGGGGGAGGGGCATGG + Intergenic
948793013 2:240388860-240388882 TTGGGCAGGAGGGAGGGGGACGG + Intergenic
948872838 2:240812247-240812269 CTGTGGAAGGGGGCTGGGGGTGG + Intronic
948944226 2:241211307-241211329 CGATGGGAGAGGAAGGGGGAGGG - Intronic
948982280 2:241500529-241500551 CTGTGGGAGTGGGCGGGGGCAGG - Intronic
949004603 2:241637896-241637918 CGGTGGGAGCGGGAGGGGGACGG + Intronic
1168751059 20:281733-281755 CTTTGGAAGAGCAAGGTGGAAGG + Intronic
1169029894 20:2398826-2398848 ATGTGGTAGAGGGAGGTGGTGGG - Intronic
1169178616 20:3542542-3542564 AGGTGGAAGGGGGAAGGGGAAGG - Intronic
1169224197 20:3846358-3846380 CTGTGGGAGTGGGAGCGGGCGGG - Intergenic
1169286940 20:4316862-4316884 GTGTGAAAGAGGGAGGGGAAAGG + Intergenic
1169383086 20:5125988-5126010 CTTTGGAAGGCGGAGGCGGACGG + Intronic
1169449704 20:5701336-5701358 CGGAGGGAGAGGGAGGGGGAGGG - Intergenic
1170131271 20:13022759-13022781 TTGTGGCAGAGGGGAGGGGAGGG - Intronic
1170160459 20:13304861-13304883 GTGGGGAAGAGAGATGGGGAAGG - Intergenic
1170161116 20:13312468-13312490 CTGTGCATGAGGGAGAGGAAGGG - Intergenic
1170243095 20:14191979-14192001 GTGGGGGAGGGGGAGGGGGAGGG + Intronic
1170407101 20:16049940-16049962 CTGTGGAGGAGGGTGGGGGTGGG + Exonic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171399071 20:24860005-24860027 GTGAGGAAGAGGAACGGGGATGG - Intergenic
1171456850 20:25277022-25277044 CTGGGGAGGAGTGAGGGGGATGG + Intronic
1171480436 20:25451707-25451729 CTGGGGTAGGGGGAGGGGGGAGG - Intronic
1171537015 20:25902186-25902208 CTGTGGAATAGAGAGGTGGAAGG - Intergenic
1171804093 20:29658968-29658990 CTGTGGAATAGAGAGGTGGAAGG + Intergenic
1171839960 20:30197452-30197474 CTGTGGGATAGAGAGGTGGAAGG - Intergenic
1171848660 20:30292669-30292691 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
1171848670 20:30292687-30292709 GAGGGGGAGAGGGAGGGGGAGGG + Intergenic
1172037492 20:32019978-32020000 GAGGGGAAGACGGAGGGGGAAGG - Intronic
1172038675 20:32028698-32028720 CTGTGCAAAAGGGAGGGGAAAGG + Intronic
1172058873 20:32175346-32175368 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
1172152200 20:32798384-32798406 CTGTGGAAGTGGTAAGGGGGTGG + Intronic
1172428071 20:34869539-34869561 CTGGGCAAGAGGGAGGAGGCAGG + Intronic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172839830 20:37896062-37896084 CAGAGGAAGAGGGTGGGAGAGGG - Intergenic
1172879131 20:38187034-38187056 GGGTGGAGGAGGGAGGGGGGAGG + Intergenic
1172883573 20:38217093-38217115 CTGTGCAAGTGGGTGGGGGGGGG + Intronic
1172896344 20:38302931-38302953 CTGCTGCAGAGGGAGGGGCAGGG + Intronic
1172994315 20:39058811-39058833 TGGTGGAAAAGGGAGGGAGAGGG - Intergenic
1173185053 20:40834204-40834226 TTGAGTAAGAGGGAGGTGGACGG + Intergenic
1173249500 20:41357204-41357226 CTGTGGGAAGGGGAGGGAGAGGG + Intronic
1173543304 20:43871289-43871311 GTGAGGTAGAGGTAGGGGGAAGG - Intergenic
1173731676 20:45333245-45333267 CTGTGAAAGAGCCAGGGGGTGGG - Intronic
1173758742 20:45541230-45541252 CTGTTGAGGGGGCAGGGGGAGGG + Exonic
1173821659 20:46023519-46023541 CTGTGGAGGAGGGCTAGGGAAGG - Intronic
1173841404 20:46159545-46159567 CTGGGGCACAGGGAGGGGAAGGG + Intergenic
1173868632 20:46328603-46328625 CTGTGGAAGGAGGAGAGGAATGG - Intergenic
1174407288 20:50310564-50310586 GTGAGGAAGAGGGAAGGGGTGGG + Intergenic
1175421174 20:58834669-58834691 CTGTGGCAGAGGGAGAGAGAGGG + Intergenic
1175608208 20:60328687-60328709 CTGTGAATTAGGGAGGTGGAGGG - Intergenic
1175684631 20:61019199-61019221 TTATGGAAGAGGGAGGGAGATGG + Intergenic
1175735633 20:61385201-61385223 CTCTGGAAGTGGCAGGAGGAGGG + Intronic
1175755724 20:61528453-61528475 GAGGGGGAGAGGGAGGGGGAGGG + Intronic
1175799966 20:61796058-61796080 CTGGGCTTGAGGGAGGGGGAGGG - Intronic
1175823544 20:61924532-61924554 CTGTGGGCGAGGGAGGGTGCTGG + Intronic
1175828464 20:61949805-61949827 CTGTGGTACTGGGTGGGGGAAGG + Intergenic
1175950432 20:62580691-62580713 CTGTGGAGCAGGGAGGTGGGAGG + Intergenic
1175974297 20:62702625-62702647 ATGTGGAAGAGAGAGGCAGAAGG - Intergenic
1175992196 20:62795219-62795241 CCGGGGACGGGGGAGGGGGAGGG - Intergenic
1176038854 20:63053718-63053740 CTGTGGAAGATGAAGAGGGCAGG - Intergenic
1176090554 20:63316530-63316552 CTGGGGAAGATGGTGGGGGAAGG - Intronic
1176582046 21:8540096-8540118 CTGTGGAATAGAGAGGTGGAAGG + Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1176987108 21:15449983-15450005 CTGTTGAGGAGGGATGGGGGAGG - Intergenic
1177143420 21:17381904-17381926 GTGGGGAGGGGGGAGGGGGAGGG + Intergenic
1177207380 21:18025793-18025815 CCGTGGAAGATGAAGGGAGAAGG - Intronic
1177904737 21:26961848-26961870 GTTTGGAAGAGGGAGAGGGATGG - Intronic
1178007610 21:28240649-28240671 CTGTGGAGGAGGGAGGAGGCAGG - Intergenic
1178322278 21:31614736-31614758 CAGGGGAATAGGGAGGGGAAGGG + Intergenic
1178533345 21:33393055-33393077 CCGTGGAGGAGGGGTGGGGATGG + Intergenic
1178974714 21:37210890-37210912 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
1179415062 21:41191908-41191930 TTGGGGAAGAGGGATGTGGATGG - Intronic
1179422172 21:41245381-41245403 ATGTGGCAGAGGGAGGAGAATGG - Intronic
1179508793 21:41858748-41858770 CTGGGGAAGAGGGGGGTTGATGG + Intronic
1179598281 21:42458176-42458198 ATGTGGAAGAGGGACTGGAAGGG - Intergenic
1179628376 21:42661382-42661404 CTGGGGGAGGGGGATGGGGAGGG - Intronic
1180202854 21:46236895-46236917 CTGAGGAAGATAGAGGGGAAGGG + Exonic
1180264883 22:10517144-10517166 CTGTGGAATAGAGAGGTGGAAGG + Intergenic
1180413272 22:12636385-12636407 AGGAGGAAGAGAGAGGGGGAAGG + Intergenic
1180594622 22:16965115-16965137 CGGTGGAGGAGTGAGTGGGATGG - Intronic
1180626792 22:17199114-17199136 CTGGTGGAGGGGGAGGGGGAGGG - Intronic
1180844425 22:18973485-18973507 CTTGGGCAGAGGGAGGCGGAGGG - Intergenic
1180964162 22:19777202-19777224 GTGGGGTAGGGGGAGGGGGAGGG - Intronic
1181055005 22:20256697-20256719 CAGTGGAGGAGTGAGCGGGACGG - Intronic
1181149437 22:20872641-20872663 CTTTGGAAGGCGGAGGCGGATGG - Intronic
1181431230 22:22882966-22882988 GAGAGGGAGAGGGAGGGGGAGGG - Intronic
1181585929 22:23853804-23853826 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
1181934169 22:26427814-26427836 TTCTGGAAGAGGGAGGAGGTGGG + Intergenic
1181934176 22:26427837-26427859 TTCTGGAAGAGGGAGGAGGTGGG + Intergenic
1181934251 22:26428113-26428135 TTCTGGAAGAGGGAGGAGGTGGG + Intergenic
1181934258 22:26428136-26428158 CTCTGGAAGAGGGAGGAGGTGGG + Intergenic
1181934265 22:26428159-26428181 TTCTGGAAGAGGGAGGAGGTGGG + Intergenic
1181977236 22:26738540-26738562 AGGAGGAGGAGGGAGGGGGAGGG - Intergenic
1182048956 22:27298777-27298799 GAGGGGAAGAGGGAGGGGGCAGG + Intergenic
1182191336 22:28463761-28463783 GTGGGGTAGGGGGAGGGGGAGGG + Intronic
1182399644 22:30066041-30066063 GAGGGGGAGAGGGAGGGGGAGGG - Intergenic
1182520843 22:30883778-30883800 CGGTGGCGGAGGCAGGGGGACGG - Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182886395 22:33777636-33777658 GAGGGGAAGGGGGAGGGGGAGGG + Intronic
1182970557 22:34570872-34570894 CTGTGGTTGTGGGAGGGGGCTGG - Intergenic
1183403968 22:37620852-37620874 CCGTGGAGGAGGAAGGGGAAAGG - Exonic
1183463597 22:37967958-37967980 CTGGGGAACAGGGAGATGGAGGG - Exonic
1183469500 22:37998029-37998051 TTGGGGAAGAGGCAGGGAGAGGG + Intronic
1183595037 22:38806309-38806331 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183649832 22:39147528-39147550 CTGAGAAAGAGGGTGGGGGGTGG - Intronic
1183829453 22:40410024-40410046 CTCAGGAAGAGGGAAGGGGATGG + Exonic
1183924646 22:41197326-41197348 CTGTGGAGGAGGGAGGCGCTGGG - Intergenic
1184059799 22:42074698-42074720 CTGGGGCACAGGGAGGGGGTGGG - Intronic
1184100156 22:42337844-42337866 CTGTGGAAGAGGGTGGCCGGTGG + Intronic
1184186131 22:42866535-42866557 CTGTGAAAAGGGGTGGGGGAAGG + Intronic
1184851734 22:47124981-47125003 CTGTAAAGGAGGGAGGGGCAGGG + Intronic
1184858478 22:47160071-47160093 AGGTGGAGGAGGGTGGGGGAAGG + Intronic
1184972274 22:48033209-48033231 CTTTGGAAGGGTGAGGTGGATGG - Intergenic
1184995007 22:48199184-48199206 CTAGGGAAGAGAGTGGGGGAGGG + Intergenic
1184995032 22:48199239-48199261 CTGGGGAAGGGGGTGGGGGAAGG + Intergenic
1185169490 22:49284406-49284428 AAGTGGAAGAGGGAGGCAGAAGG + Intergenic
1185296992 22:50059200-50059222 CCGGGGAAGAGGGAGGGAGCTGG - Intergenic
1185313534 22:50169613-50169635 CTGTGGAACAGGGGACGGGATGG + Intergenic
949127955 3:469118-469140 GTGTGAAAGAGGGAGAGAGATGG - Intergenic
949296710 3:2533275-2533297 GTGGGGTGGAGGGAGGGGGAGGG - Intronic
949435276 3:4022640-4022662 GGGAGGAAGAGAGAGGGGGAGGG + Intronic
949638992 3:6014145-6014167 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
949741603 3:7240694-7240716 ATGTGGAAGAGGGGGAGGGAAGG - Intronic
949903737 3:8840943-8840965 CTGTGGAACAGGGCAGGAGAAGG + Intronic
949965130 3:9349247-9349269 ATGTGCAGGAGGGAGGGGCAGGG - Intronic
950080528 3:10218952-10218974 CTTTGGGAGAGCGAGGTGGACGG + Intronic
950099193 3:10346720-10346742 CAGTGGAAAAGGGTGGGTGAAGG + Intronic
950466408 3:13157776-13157798 CTGTGGCAGAGGGAGAAGAAAGG + Intergenic
950485901 3:13273876-13273898 ATGGGGCAGAGTGAGGGGGAGGG - Intergenic
950553714 3:13682691-13682713 CTGGGGCAGACGGAGGGGGCTGG - Intergenic
950699317 3:14729237-14729259 CTGTGGTAGAGGATGAGGGAAGG + Intronic
950799141 3:15535216-15535238 CTGGGGAAGAGAGGGGAGGAGGG + Intergenic
951217821 3:20040840-20040862 AGGTGGAAGCGGGAGGGGGAGGG - Intronic
951408079 3:22326062-22326084 AAGTGGAAGAGAGAGGGGAAAGG - Intronic
951797156 3:26552181-26552203 GAGTAGAAGAGGGAGGGGTATGG + Intergenic
952455343 3:33467035-33467057 GTGTGGGAGGGGGAGGGGGCTGG + Intergenic
952484465 3:33796366-33796388 CCATGGAAGAGGGTGGGGGATGG - Intergenic
952513467 3:34079853-34079875 GTGGGGTAGAGGGAGGGGGAAGG - Intergenic
952603226 3:35109772-35109794 GTGGGGAAGAGGAGGGGGGAGGG + Intergenic
953005644 3:38976748-38976770 GTGTGGGAGAGAGAGGGGAAGGG - Intergenic
953041119 3:39255733-39255755 CTGTGGTAGAGGGAGCAGTAGGG + Intergenic
953219262 3:40954010-40954032 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
953693105 3:45136378-45136400 CTAAGGAAGAAGGAGGAGGATGG + Intronic
953837865 3:46362711-46362733 CTGTGGAGGATGGAGCAGGAGGG - Intergenic
953908590 3:46881221-46881243 CTGAGGCAGAGGGAGGGGCTGGG - Intronic
953966357 3:47309976-47309998 CGTGGGGAGAGGGAGGGGGAGGG + Intronic
953975652 3:47380338-47380360 GTGGGGAAGTGGGTGGGGGAAGG - Intergenic
954412463 3:50376798-50376820 CTGTGGAAGGGGGAGAGGTGTGG - Intronic
954491652 3:50912671-50912693 CTTTGGAAAAGGGAGGGAAAAGG - Intronic
954511395 3:51129034-51129056 CTGGGGAAGAGGTATGTGGATGG - Intronic
954529677 3:51308145-51308167 CTGTGGAGGTGGGAGGGGAAGGG + Intronic
954761228 3:52875857-52875879 TTCTGGATGAGGGAGGGGGCCGG - Intronic
955307546 3:57849130-57849152 CTTTGGAAGGCCGAGGGGGATGG - Intronic
955360286 3:58268337-58268359 ACGTAGAAGAGGGAGTGGGAAGG - Intronic
955838131 3:63080403-63080425 CTGTGCAAGAGGTAGCGTGAAGG + Intergenic
955904339 3:63790859-63790881 CTGTGGAAGAGGGATTGAGATGG + Intergenic
956032155 3:65050266-65050288 CATTGTAAGAGGGAGGGAGAGGG - Intergenic
956825929 3:72996933-72996955 GTGTGTGCGAGGGAGGGGGAGGG + Exonic
956836115 3:73097325-73097347 CTGTGCAGTAGGGAAGGGGAAGG + Intergenic
956849697 3:73217711-73217733 AGGGGGAAGAGGGAAGGGGAGGG - Intergenic
957107255 3:75906695-75906717 CGCTGGAGGAGGGAGGCGGAAGG + Exonic
957544960 3:81625087-81625109 ATGAGGGAGGGGGAGGGGGAGGG + Intronic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
958020753 3:87992335-87992357 CTGAGCAAAAGGGAGGGGGAAGG + Exonic
958111286 3:89149625-89149647 GTGGGGAGGGGGGAGGGGGAGGG - Intronic
958431170 3:94043551-94043573 GAGGGGAAGAGGGAGGGGGGAGG - Intronic
958504257 3:94954035-94954057 GTGAGAGAGAGGGAGGGGGAAGG + Intergenic
958730655 3:97957112-97957134 CTGTGGTTGAGGGATGGGCATGG - Intronic
958795374 3:98701516-98701538 GTGTGGAAAAGGGAGGAAGAAGG + Intergenic
958893884 3:99809045-99809067 CTGAGGAAGAGGCATGTGGAGGG - Intergenic
959017036 3:101146472-101146494 GTGGGGTTGAGGGAGGGGGAGGG + Intergenic
959551845 3:107668975-107668997 CTCTGAATGTGGGAGGGGGATGG - Intronic
959817502 3:110692009-110692031 CTGTGGGAGAGTCAGGTGGAAGG + Intergenic
960195277 3:114759298-114759320 CAGTGGAAAGGGGATGGGGAGGG + Intronic
960238412 3:115312446-115312468 GTGGGGTGGAGGGAGGGGGAGGG - Intergenic
960270932 3:115673782-115673804 CAGTGGAGGAGGGAGAAGGATGG + Intronic
960344728 3:116518633-116518655 GAGAGGGAGAGGGAGGGGGAGGG - Intronic
960344732 3:116518639-116518661 CAGAGGGAGAGGGAGAGGGAGGG - Intronic
960488873 3:118285316-118285338 CGGAGGAAGAGAGAGAGGGAAGG + Intergenic
960659840 3:120045480-120045502 ATAAGGAAGAGGGAAGGGGAAGG - Intronic
960670665 3:120152786-120152808 CTTCGGAAGAGAGAGGCGGACGG - Intergenic
960697896 3:120413793-120413815 GAGAGGGAGAGGGAGGGGGAGGG - Intronic
960868968 3:122230526-122230548 CTGTTGCAGGGGGTGGGGGATGG - Intronic
960893394 3:122475922-122475944 CTGAGGAGGAGGGAAGAGGAAGG + Intronic
961168722 3:124780778-124780800 GAGGGGAAGAGGGAGGAGGAGGG - Intronic
961195941 3:125001559-125001581 GTGTTGATGTGGGAGGGGGAGGG - Intronic
961481507 3:127183734-127183756 GAGGGGGAGAGGGAGGGGGAGGG - Intergenic
961492475 3:127265147-127265169 CAGTGGCAGAGGGAGCGGCAGGG + Intergenic
961697375 3:128714832-128714854 CCATGGCAGAGGGAGTGGGAGGG - Intergenic
961763543 3:129189874-129189896 CTTTGGAAGGTGGAGGAGGATGG - Intergenic
961772908 3:129263287-129263309 TATTGGATGAGGGAGGGGGAAGG + Intronic
961779281 3:129312217-129312239 CTGGGAAAAAGGGAGGGGAAGGG + Intergenic
961780363 3:129317131-129317153 CTGTGCACGGGAGAGGGGGAGGG - Intergenic
962345937 3:134619088-134619110 CTGTGGAAGAGGGAGAGGGATGG + Intronic
962403163 3:135078634-135078656 CTGTGAAAGAGAGAGGAAGAGGG + Intronic
963005648 3:140724185-140724207 CTGTGGGAGAGGGAAGGGCCTGG - Intergenic
963051270 3:141146087-141146109 CTCTGGAAGAGGGTGGGGGCAGG - Intronic
963194156 3:142507708-142507730 ATGTGGAATAGGGTGGGAGATGG - Intronic
963430634 3:145197375-145197397 CTTGGGAAGAGGGGAGGGGAGGG + Intergenic
963560087 3:146854123-146854145 GTTTGGAAGATGGAGGAGGAGGG + Intergenic
963599470 3:147365182-147365204 CAGTAAAAGAGGGTGGGGGAAGG + Intergenic
963606331 3:147414041-147414063 CGGGGGGAGGGGGAGGGGGAGGG + Exonic
963614330 3:147516581-147516603 CTTTGGAAGGCGGAGGCGGACGG - Intergenic
963748754 3:149152473-149152495 CAGTGGAGGTAGGAGGGGGAAGG + Intronic
963938866 3:151081433-151081455 AAGTGGGAGGGGGAGGGGGAAGG - Intergenic
963938869 3:151081439-151081461 CAGGGGAAGTGGGAGGGGGAGGG - Intergenic
964113669 3:153113017-153113039 CTTTGGGAGAGGGAGGCGGGTGG + Intergenic
964405409 3:156343460-156343482 CTGAGGTCGAGGGAGAGGGAGGG + Intronic
964592856 3:158385004-158385026 TTGTGGAAGAAGGAAGGAGAAGG + Intronic
964601896 3:158511248-158511270 GTGGGGTAGGGGGAGGGGGAAGG - Intronic
964881499 3:161428356-161428378 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
964907395 3:161734419-161734441 CTGGAGAAGAGTGAGAGGGAAGG - Intergenic
965219193 3:165904367-165904389 CTGTGAAAGATACAGGGGGAGGG - Intergenic
965242312 3:166217669-166217691 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
965298463 3:166978275-166978297 GTGTGGTGGAGGGAGGGGGGAGG + Intergenic
965418809 3:168430715-168430737 CTGTGGAATATGGAGAGGGAGGG + Intergenic
965568998 3:170152427-170152449 CTTTGGAAGGCCGAGGGGGAGGG - Intronic
966185220 3:177221062-177221084 GTCTAGAAGAGGAAGGGGGAAGG - Intergenic
966886493 3:184380280-184380302 CTGGGGAGGAGGGAGGGAGGAGG - Exonic
966901862 3:184492479-184492501 GTGAGGAAGGGGGAGGGTGAAGG + Intronic
966924439 3:184635236-184635258 GTCGGGAAGAGGGAGGAGGAGGG + Intronic
966979066 3:185113767-185113789 ATGTGGAACAGGGAAGGGGGAGG + Intronic
967282255 3:187833792-187833814 CTCTGGTTGAGGGAGGGGCAAGG + Intergenic
967431082 3:189385967-189385989 GTGGGGTAGGGGGAGGGGGAAGG - Intergenic
967578682 3:191125777-191125799 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
967709497 3:192688353-192688375 CTGTGGCAGAGGTTGGGGGGTGG - Intronic
967977484 3:195043698-195043720 GGGGGGAAGAGGGATGGGGATGG - Intergenic
968339312 3:197941467-197941489 GAGGGGAAGGGGGAGGGGGAAGG - Intronic
968520424 4:1032516-1032538 TGGTGGGAGAGCGAGGGGGAGGG + Intergenic
968543135 4:1178400-1178422 CTGAAGATGAGGGAGGGGGAGGG - Intronic
968913889 4:3488839-3488861 CTGTGGATGTGGAAGGGGCAGGG + Intronic
968985374 4:3871862-3871884 CGGTGGAGGGGTGAGGGGGAGGG + Intergenic
969065298 4:4474638-4474660 ATGTGGAAGTGGGAGGCAGAAGG + Intronic
969121328 4:4913498-4913520 CTGGGGAAGGGGGAGGGAAAGGG + Intergenic
969148092 4:5141811-5141833 CTGAGGAAGGTGGAGGGGGTGGG - Intronic
969334372 4:6498954-6498976 CAGAGGGAGAGGGAGAGGGACGG - Intronic
969397691 4:6933303-6933325 CTCTAGAAAAGGGAAGGGGAAGG - Intronic
969482996 4:7456765-7456787 CTGTGGCAGGGGTAGGGGGGTGG + Intronic
969503634 4:7570371-7570393 CTCTGGCAGCGGGAGTGGGAGGG - Intronic
969665970 4:8557855-8557877 CCGTGGCAGAGGGAGCGGCAGGG - Intergenic
969821459 4:9723890-9723912 CTGGGGAAGAGGGGGTGGGGAGG - Intergenic
969853099 4:9977545-9977567 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
970007031 4:11421345-11421367 CTGGGTAGGAAGGAGGGGGAGGG - Intronic
970346987 4:15161930-15161952 GTGTGGCAGGGGGTGGGGGAAGG + Intergenic
970409059 4:15790171-15790193 GAGAGGGAGAGGGAGGGGGAGGG - Intronic
970420052 4:15897665-15897687 CTGAGGCAGGGGGAGGGTGATGG - Intergenic
970791477 4:19862944-19862966 CTGGGGCAGGGGGAGGGGGGAGG - Intergenic
970895417 4:21097706-21097728 CTGGGGGAGAGGGAGAGAGATGG - Intronic
970919793 4:21380429-21380451 ATGAGGGAGAGGGAGGGAGAGGG + Intronic
971035968 4:22693138-22693160 CTGAGGAAGATGGTGGGGTAAGG + Intergenic
971058231 4:22937484-22937506 ATTTGGAAGAGAGAGGGGGATGG + Intergenic
971383440 4:26120996-26121018 AAGAGGAAGAGGGAGAGGGAGGG + Intergenic
971571085 4:28211660-28211682 CTGTGTTAGATGGTGGGGGAGGG - Intergenic
971661698 4:29426112-29426134 GAGAGGAAGAGGGAGGAGGAAGG - Intergenic
972110830 4:35557209-35557231 CTGTGGAAGTGGAAGTGGTATGG - Intergenic
972238942 4:37167831-37167853 CTGTTGGAGGGGCAGGGGGATGG + Intergenic
972270884 4:37509973-37509995 CCGTGGGAGAGGGAGAGGGAGGG + Intronic
972270888 4:37509979-37510001 GAGAGGGAGAGGGAGGGGGAGGG + Intronic
972572955 4:40327302-40327324 CTGTGGGAGAGGTTGGGGGCTGG + Intergenic
972653969 4:41048645-41048667 GGGAGGGAGAGGGAGGGGGAGGG - Intronic
972654375 4:41050691-41050713 ATAAGGAAGAGGGAGGGAGAAGG + Intronic
972804054 4:42509362-42509384 CTGTTGAGGAAGAAGGGGGATGG + Intronic
973105008 4:46324711-46324733 TTGATGGAGAGGGAGGGGGAGGG - Intronic
973278860 4:48338765-48338787 GTGTGGTAGAGTGATGGGGAAGG + Intergenic
973752168 4:54032273-54032295 TAGAGGGAGAGGGAGGGGGAGGG - Intronic
974245161 4:59304840-59304862 GTGGGGTAGGGGGAGGGGGAAGG + Intergenic
974483513 4:62476116-62476138 CTATAGCAGTGGGAGGGGGAAGG - Intergenic
974597688 4:64036622-64036644 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
974974231 4:68870217-68870239 GTGGGGTAGGGGGAGGGGGAAGG - Intergenic
975141314 4:70921505-70921527 CTCAGGAAAAGGGAAGGGGAGGG - Intronic
975369439 4:73567977-73567999 CTGTGGAAAGGGGAGGGAGGAGG - Intergenic
975804026 4:78093969-78093991 TGGTGGAAGTGGGAAGGGGAGGG - Intronic
975848198 4:78547323-78547345 CGTGGGGAGAGGGAGGGGGAGGG - Intergenic
976119704 4:81766336-81766358 CTGATGAGGAGGGAGGGAGATGG - Intronic
976388388 4:84484540-84484562 CTGGGGGAGGGGGTGGGGGAAGG - Intergenic
976401832 4:84615578-84615600 CTGTGGCAGGGGGAGGGGGTGGG - Intronic
977032271 4:91900177-91900199 TGGGGGAAGAGGGAGGGGAAGGG + Intergenic
977200785 4:94112910-94112932 ATGGAAAAGAGGGAGGGGGAGGG + Intergenic
977270271 4:94909644-94909666 ATCAGGAAGAGGGAGGAGGAGGG - Intronic
977809754 4:101346183-101346205 CAGGGGGAGGGGGAGGGGGAGGG + Intronic
978744927 4:112182118-112182140 ATGGGGAAGAGGGAGAGGGAGGG + Intronic
978807694 4:112817998-112818020 GTGTGGAAGAGGCTGGCGGATGG + Intergenic
979328500 4:119404570-119404592 CTGGGGCAGAGGCAGGGGCAAGG - Intergenic
979496146 4:121385193-121385215 CTGTGGACCAGGGAGAGGCAGGG - Intergenic
979619847 4:122786692-122786714 ATGTGGACGAGGGAGGGAAAGGG - Intergenic
979851096 4:125572218-125572240 ATGGGGTAGAGGGAGGGGGGAGG + Intergenic
979948255 4:126860995-126861017 CTGTGGTGGGGGGAGGGGGGAGG - Intergenic
979990338 4:127367634-127367656 CTGGGGAGGAGGGAGTGGGGAGG - Intergenic
980651873 4:135727192-135727214 CTGTGGTAGAGGCATGGAGATGG - Intergenic
981295430 4:143125856-143125878 CTCTGGAAGGTGGAGGAGGAAGG - Intergenic
981367978 4:143925481-143925503 ATGTGGAAGAGGGAGGCCAAAGG - Intergenic
981377775 4:144035760-144035782 ATGTGGAAGAGGGAGGCCAAAGG - Intergenic
981438126 4:144750128-144750150 TTGGGGAAGGGAGAGGGGGAAGG + Intergenic
981546489 4:145899300-145899322 AGGTGGGGGAGGGAGGGGGAGGG + Intronic
981994664 4:150963174-150963196 CCGTGCAAAGGGGAGGGGGAGGG - Intronic
982134401 4:152259497-152259519 CTGTGGCAGGGGGAGGGGCATGG - Intergenic
982210461 4:153030673-153030695 TTATGGAAGCGGGAGGGAGAGGG + Intergenic
982297874 4:153848546-153848568 CAGTGGAAGAAGGAGCTGGAGGG - Intergenic
982877931 4:160671289-160671311 GGGAGGGAGAGGGAGGGGGAGGG - Intergenic
983617665 4:169725697-169725719 CTGAGGATGAGGGTGGGGGTTGG + Intergenic
983828211 4:172291722-172291744 CTGGGGCAGGGGGAGGGGGGTGG - Intronic
983906207 4:173184620-173184642 GAGAGGGAGAGGGAGGGGGAGGG + Intronic
984199344 4:176697984-176698006 GTGGGGTGGAGGGAGGGGGAGGG + Intronic
984551750 4:181169028-181169050 CTGGGGTAGAAGGAGGGTGAAGG - Intergenic
984888490 4:184472666-184472688 AGGTTGAAGAGGGAGGGGGCGGG + Intronic
985382722 4:189412559-189412581 CTGTGGCAGAAGGAAGGGAAAGG - Intergenic
985855240 5:2419214-2419236 CTGGGGAAAGGGGAGGGAGAAGG + Intergenic
985855537 5:2421721-2421743 CTGTGGAAGAGGGAGTGGTGGGG - Intergenic
986255108 5:6095880-6095902 GTGGGGAGGAGGGAGTGGGATGG + Intergenic
986646081 5:9917312-9917334 CTCTGGAAGAGGGGTGGGGCGGG - Intergenic
986678254 5:10208648-10208670 CTGAAGAAGAGGAAGAGGGAGGG - Intergenic
986791612 5:11166592-11166614 TGGTGGGAGTGGGAGGGGGAGGG + Intronic
986879094 5:12147853-12147875 TGGAGGAGGAGGGAGGGGGAGGG - Intergenic
987153264 5:15062295-15062317 CTGGGGAAGAGGTATGTGGATGG + Intergenic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
987245886 5:16048123-16048145 CCCTGGAAGAGGGTGAGGGAGGG - Intergenic
987255329 5:16144524-16144546 CTGATGAAGAGGGAGGGTGATGG - Intronic
987332550 5:16869919-16869941 AAGGGGAAGGGGGAGGGGGAGGG + Intronic
987623809 5:20371170-20371192 AAGTGGTATAGGGAGGGGGAGGG + Intronic
987698867 5:21368369-21368391 GTGGGGTAGAGGGAGGGGGGAGG + Intergenic
987910167 5:24132486-24132508 AGGTGGGAGAGGGATGGGGAGGG + Intronic
988608779 5:32705546-32705568 AGGAGGAAGAGGGATGGGGAGGG + Intronic
988735980 5:34021758-34021780 CTGTGGCAGGGTGAGGGGAAAGG + Intronic
988999258 5:36744152-36744174 TTGTGGGAGAGGGAGATGGAAGG - Intergenic
989188917 5:38650619-38650641 TTGGGGGAGGGGGAGGGGGAGGG + Intergenic
990090227 5:52036178-52036200 GTGGGGTGGAGGGAGGGGGAGGG + Intronic
990362192 5:55031705-55031727 CTGAGGAGGAGGGAGGGGCATGG + Intronic
990461791 5:56037556-56037578 CTGAGGATGAGGTTGGGGGAGGG + Intergenic
990501263 5:56398649-56398671 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990582085 5:57174533-57174555 GTGTGCAAGAGGCCGGGGGAAGG - Intronic
990589644 5:57249751-57249773 GAGGGGAAGGGGGAGGGGGAAGG - Intronic
991244488 5:64495475-64495497 CTGTGGAAGACGGGGGGATAGGG - Intergenic
991375274 5:65958656-65958678 GTGAGGGAGGGGGAGGGGGAGGG + Intronic
991605444 5:68396148-68396170 ATGAGGAAGGGGGAGGGGAAAGG + Intergenic
991658418 5:68926421-68926443 CAGAGGAAAAGGGAAGGGGAAGG + Intergenic
991960058 5:72035354-72035376 CTTTGAAAGAAGGAGGAGGAGGG - Intergenic
992556345 5:77907105-77907127 CTGTGGAAGTGGGATGGCAAAGG + Intergenic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993473600 5:88336202-88336224 CTTTGGAAGAATGAGGTGGAAGG - Intergenic
993663042 5:90662753-90662775 GTGTGGTGGGGGGAGGGGGAAGG - Intronic
994157280 5:96518265-96518287 CTGTAGAGGAGGAAGAGGGAAGG - Intergenic
994531435 5:100977764-100977786 GTGGGGGAGGGGGAGGGGGAAGG - Intergenic
995109627 5:108414475-108414497 AAGGGGAAAAGGGAGGGGGATGG - Intergenic
995193117 5:109340660-109340682 CGTGGGGAGAGGGAGGGGGAGGG - Intronic
995507989 5:112880350-112880372 GTGTGTAAGATGGAGGGGAAAGG + Intronic
995890196 5:116942476-116942498 CTGTGGGTGATGGATGGGGATGG + Intergenic
995912536 5:117204626-117204648 CTGGCGAAGGGGGAGGGGGGGGG + Intergenic
996392117 5:122973161-122973183 CTGGGGAAGAGGTATGTGGATGG - Intronic
996674590 5:126159239-126159261 AGGAGGAAGAGAGAGGGGGATGG + Intergenic
996723056 5:126648485-126648507 CTGAGAAACAGGTAGGGGGAAGG + Intergenic
996769130 5:127067138-127067160 CTGGTGAAGATGGAGTGGGAAGG + Intronic
997342459 5:133155448-133155470 AAGTGGAAGAGGGAGGCAGAGGG + Intergenic
997381211 5:133439837-133439859 GTGGGGAAGAGGGTGGGGGTGGG - Intronic
997419087 5:133751644-133751666 CGGTAGCAGATGGAGGGGGAGGG + Intergenic
997588751 5:135060253-135060275 CTGTGGAAGAGGTGGGGGCCAGG + Intronic
997846635 5:137292217-137292239 CTCTGGATGAGGGATGAGGAAGG + Intronic
998583700 5:143404516-143404538 TCGGGGAAGAGGGTGGGGGACGG - Intronic
998662025 5:144249417-144249439 TTGTGGGAGAGGGGAGGGGAAGG - Intronic
998782554 5:145674302-145674324 ATGGGGTAGAGGGAGGGGGGAGG - Intronic
998936705 5:147236647-147236669 CTGTGGAAGGGGGAAGCAGATGG - Intronic
999075463 5:148791398-148791420 CTGTGGATGTGGGTGGGGGATGG - Intergenic
999125337 5:149242068-149242090 CTGTCTTTGAGGGAGGGGGAGGG + Intronic
999126735 5:149251568-149251590 CAGGGGAAAAGGGAGGGGGTGGG - Intronic
999145717 5:149391947-149391969 CTGGGGAAGAGGGCAGGGCATGG - Intronic
999373376 5:151069611-151069633 CTCTGGTACAGGGAGGTGGAAGG + Intronic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
999455824 5:151714857-151714879 CGTGGGGAGAGGGAGGGGGAGGG + Intergenic
1000194280 5:158942900-158942922 TAGTAGAAGAGGGAGGGGGAAGG + Intronic
1000194291 5:158942949-158942971 TAGTAGAAGAGGGAGGGGGAAGG + Intronic
1000263745 5:159615314-159615336 CTCTAGAGGCGGGAGGGGGAGGG - Intergenic
1000648670 5:163787737-163787759 ATGTGGAAGAGGAAGGCAGAAGG - Intergenic
1000846918 5:166293140-166293162 CTGTGGGGAAGGCAGGGGGAGGG - Intergenic
1001397021 5:171424845-171424867 AGGGGGAAGGGGGAGGGGGAGGG + Intronic
1001401254 5:171447856-171447878 TTGTGGGTGAGGGAGGGGCAGGG + Intronic
1001442376 5:171753659-171753681 GTGGGGTAGAGGGAGGGGGGAGG + Intergenic
1001568449 5:172715147-172715169 CTGGGGAAGTGGGATGGGAAGGG + Intergenic
1001706001 5:173741660-173741682 CTGAGAGAGAGGGAGGGAGAGGG + Intergenic
1001939926 5:175733145-175733167 CCGTGGAGGAGGAAGGTGGAGGG + Intergenic
1001996947 5:176169714-176169736 CCAAGGAAGAGAGAGGGGGAGGG + Intergenic
1002330198 5:178435653-178435675 ATGAGGAAAAGCGAGGGGGAGGG + Intronic
1002429364 5:179194163-179194185 CTGCGGAGGAGGGAGGAGGGAGG + Intronic
1002582180 5:180215583-180215605 ACGTGGAAGAGGGAGGCAGAAGG + Intergenic
1003060405 6:2858268-2858290 GGGTGGAAGGGGGAGGGGGAGGG - Intergenic
1003487533 6:6592507-6592529 CAGTGGAAGAAGCAGGGTGAGGG + Intronic
1003507481 6:6751700-6751722 CTGGGGGAGGGGGAGGGGGAGGG - Intergenic
1003596056 6:7475246-7475268 CTTTGGGAGGTGGAGGGGGATGG - Intergenic
1003863592 6:10343786-10343808 CAGGGGAACAGGTAGGGGGAAGG - Intergenic
1004204029 6:13574777-13574799 CTGGAGACCAGGGAGGGGGATGG + Intronic
1004334142 6:14748742-14748764 CAAAGGAAGAGGGAGGGGAAGGG + Intergenic
1004515152 6:16316251-16316273 GATGGGAAGAGGGAGGGGGATGG - Intronic
1005038061 6:21575405-21575427 CTTTGGAAGACCGAGGGGGGCGG - Intergenic
1005229258 6:23681342-23681364 TTATAGAAGAGGAAGGGGGATGG - Intergenic
1005424298 6:25684994-25685016 ATATGGAAGAGGGAGGCAGAAGG + Intronic
1005710703 6:28501544-28501566 CCGTGCAAAAGGGAGGGGGAGGG - Intergenic
1005890176 6:30130976-30130998 CTGTGTAAGAGGAAGAGGGGTGG - Intergenic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1005929651 6:30474460-30474482 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
1005930143 6:30477125-30477147 CTTTGGAAGACTGAGGGGGGTGG + Intergenic
1006076402 6:31535293-31535315 CTGAGGAAGAGGGCGAGGAAGGG + Intronic
1006191119 6:32210156-32210178 CTGTGGAAGAGGGGTTGGGAAGG + Intronic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1006562972 6:34929771-34929793 AAGGGGAAGGGGGAGGGGGAGGG - Intronic
1006839787 6:37021489-37021511 CTGGGGTGCAGGGAGGGGGAGGG - Intronic
1006929510 6:37679334-37679356 CTGTGGATGCGGGAGGAGGGAGG + Intronic
1007088927 6:39169823-39169845 GTGTGGCATTGGGAGGGGGAAGG - Intergenic
1007111896 6:39317650-39317672 CTGTGAAAGAGGAAGGGTGAAGG - Intronic
1007335659 6:41153545-41153567 GTGTGGAAGGGGGAAAGGGATGG + Intronic
1007375129 6:41451334-41451356 CTGTGGAAAAGGCAGGAGGGAGG - Intergenic
1007520381 6:42447557-42447579 GTGTGGCTGAGGGAGGAGGAAGG - Intronic
1007627597 6:43255141-43255163 ATGTGGAGGTGGGAGGGGCAAGG + Intronic
1007651334 6:43424615-43424637 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
1007654908 6:43446042-43446064 CTGGGGACAAGGGATGGGGAAGG + Intronic
1007733399 6:43965453-43965475 CTGGCTAAGAGGGAGGGAGATGG - Intergenic
1007764439 6:44152514-44152536 CAGGGAAGGAGGGAGGGGGAAGG - Intronic
1007780109 6:44247748-44247770 CGGTGGAGGAGGGGCGGGGAGGG + Intronic
1007835779 6:44672524-44672546 CTGTGGGAGAGGATGGGGGATGG + Intergenic
1008354583 6:50537135-50537157 TGGGGGAAGAGGGAGGGGGGAGG - Intergenic
1008400565 6:51058004-51058026 GTGTGGTGGGGGGAGGGGGAAGG - Intergenic
1008545025 6:52576765-52576787 CTGGGGAGGAGGGAGCTGGAGGG - Intronic
1008611520 6:53188621-53188643 CTGTGGATAAGGGAGCGGGAGGG + Intergenic
1008863258 6:56176978-56177000 GGGAGGAAGAGGGAGGAGGAAGG + Intronic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1009869340 6:69434069-69434091 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
1009948905 6:70372384-70372406 AGGTGGGACAGGGAGGGGGATGG - Intergenic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1010016065 6:71105844-71105866 CTGGGGAAGAGACATGGGGAGGG - Intergenic
1010107860 6:72189940-72189962 CTGGGGAAGAGGTACGTGGATGG - Intronic
1010887421 6:81261880-81261902 GAGGGGAAGAGGAAGGGGGAGGG + Intergenic
1011361322 6:86527949-86527971 GTGGAGTAGAGGGAGGGGGAGGG - Intergenic
1011406729 6:87022932-87022954 AAGTGGGGGAGGGAGGGGGAGGG + Intergenic
1011427009 6:87240369-87240391 CGGTGGGTGGGGGAGGGGGAGGG + Intronic
1011474383 6:87736832-87736854 CGTGGGGAGAGGGAGGGGGAGGG + Intergenic
1011709127 6:90033206-90033228 TTGGGGAGGAGGGAGGGGGGAGG + Intronic
1011735613 6:90308115-90308137 CTTTTTAAGAGGGAGGAGGAGGG - Intergenic
1011823444 6:91279142-91279164 CTGGGGAAGAGTGTGGAGGAGGG - Intergenic
1012002038 6:93665554-93665576 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012344674 6:98170951-98170973 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012489390 6:99764188-99764210 CTGGGGTGGCGGGAGGGGGAAGG - Intergenic
1012548699 6:100448679-100448701 CTGAGGCAGAGGGATAGGGAGGG + Intronic
1012826799 6:104156430-104156452 GTGGGGAGTAGGGAGGGGGAGGG - Intergenic
1012873290 6:104696523-104696545 CTGCAGAAGAGGAAAGGGGAAGG + Intergenic
1012899762 6:104991996-104992018 CGTGGAAAGAGGGAGGGGGAGGG + Intronic
1012925214 6:105260848-105260870 CCGAGGGAGAGGGAGGGGGGAGG - Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1012982066 6:105841257-105841279 CTGAGGAAGAGGGTTGGGAAGGG + Intergenic
1013231953 6:108167800-108167822 GAGTGAAAGGGGGAGGGGGAGGG - Intronic
1013299377 6:108789482-108789504 GTGGGGTTGAGGGAGGGGGAAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013847661 6:114473612-114473634 CTTTGGCAGAGGGAAGGGGCCGG - Intergenic
1014146397 6:118002450-118002472 GTGGGGTAGGGGGAGGGGGAGGG + Intronic
1014489521 6:122044918-122044940 CTGTGGCAGAGGTTGGGAGATGG + Intergenic
1014789034 6:125650822-125650844 CTGTGGAAGAAAGTGGTGGAGGG + Intergenic
1015095359 6:129408970-129408992 CTGGGGAAGAGGTATGTGGATGG - Intronic
1015196140 6:130526549-130526571 CAGAGGAAGAGGGAGAGAGAAGG + Intergenic
1015205187 6:130629714-130629736 ATGGGGGAGAGAGAGGGGGAGGG + Intergenic
1016032881 6:139356218-139356240 TTGTCAAAGAGGGAGGGGGAAGG + Intergenic
1016285659 6:142469844-142469866 CCTTAGAAGAGGGAGGGAGAGGG - Intergenic
1016326145 6:142904009-142904031 CTGAGGAATATGGAGGGGGCAGG + Intronic
1016417763 6:143851013-143851035 AGGTGGAAGAAGGAGGGGGAGGG + Intronic
1016480055 6:144471050-144471072 GAGGGGGAGAGGGAGGGGGAGGG + Intronic
1016958971 6:149653522-149653544 CTGGTGAAAAGAGAGGGGGAGGG - Intergenic
1017014226 6:150087168-150087190 CTGGGGAAGAGGGGAGGGCATGG + Intergenic
1017014439 6:150088827-150088849 CAGTGGTGGAGGGAGGGGAAGGG + Intergenic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017446338 6:154510298-154510320 CTGTGGCAGCTGGAGGGAGAGGG - Exonic
1017601034 6:156081479-156081501 CACTGGAAGAGGGTGGGTGATGG + Intergenic
1017720657 6:157241017-157241039 CTGAGGAAGAGGGTGGAGGGAGG + Intergenic
1017728684 6:157295273-157295295 TTATGGAAGAGGGAGTGGGGAGG - Intronic
1017866590 6:158449248-158449270 ATGTGGAGGAGGGAGGGTGAAGG + Intronic
1017888493 6:158620486-158620508 GTGAGGAAGAGAGAGGGAGAGGG + Intronic
1017903564 6:158739001-158739023 CTGTGTGAGTGGGAGGGGAAAGG - Intronic
1017916881 6:158838024-158838046 CTTTTCCAGAGGGAGGGGGAAGG + Intergenic
1018096684 6:160393431-160393453 GTGTGGTAGGGGGAGGGGGGAGG - Intronic
1018270732 6:162074479-162074501 GTGTGGTGGGGGGAGGGGGAGGG + Intronic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1018415781 6:163601080-163601102 CTGTTGATGGGGGTGGGGGATGG - Intergenic
1018490902 6:164292340-164292362 ATGGGGTAGGGGGAGGGGGAGGG - Intergenic
1018533514 6:164794037-164794059 CTGTGGCCAAGGGAGAGGGAGGG - Intergenic
1018824531 6:167399122-167399144 CCGTGGAAGATGCAGGGGCAGGG + Intergenic
1018865998 6:167747628-167747650 CTGTGGAAGGGAGGGGGGGAGGG + Intergenic
1018912194 6:168108253-168108275 TTGAGGAAGAGAGAGAGGGAGGG + Intergenic
1018948436 6:168363331-168363353 GAGAGGAAGATGGAGGGGGAGGG + Intergenic
1019042357 6:169117809-169117831 CTGTGGGAGAGGGAGCGTGCAGG - Intergenic
1019158240 6:170052874-170052896 CAGAGGGAGGGGGAGGGGGAGGG - Intergenic
1019164467 6:170088814-170088836 CTGTGAAAGAGGGCGAGGCACGG - Intergenic
1019372663 7:671087-671109 CTGAGGAAGAAGGAGGTGGACGG - Intronic
1019459318 7:1147968-1147990 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
1019949482 7:4359735-4359757 ATGGGGTGGAGGGAGGGGGAAGG + Intergenic
1020115558 7:5474166-5474188 CTGGGGCTGAGGGAGGGGGCTGG + Intronic
1020795293 7:12671566-12671588 AGGAGGAAGAGAGAGGGGGAAGG - Intergenic
1022728691 7:33003309-33003331 ATGTGGAAGAGGCAGGGAGCTGG - Intronic
1022801969 7:33785429-33785451 GTGTAGAAAAGGGAAGGGGAAGG + Intergenic
1022834389 7:34100052-34100074 CAGTTGAAGAGAGAGAGGGAGGG - Intronic
1023057154 7:36299763-36299785 CGGGGGAAGGGGGCGGGGGAGGG - Exonic
1023058320 7:36307250-36307272 GTTTGGAAGAGGGAGGAGGGAGG - Intergenic
1023160401 7:37291926-37291948 CAGAGGGAGAGGGAGGGGGAGGG - Intronic
1023399201 7:39779561-39779583 AAGTGGAAGAGGGAGGCAGAAGG - Intergenic
1023623841 7:42097342-42097364 CCCTGGAAGATGGAGGGGCAGGG + Intronic
1023700739 7:42889421-42889443 AAGAGGAAGAGGGAGAGGGAGGG + Intergenic
1023882085 7:44326294-44326316 CTTTGGAGAAGTGAGGGGGAAGG - Intronic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024651242 7:51405144-51405166 AAGTGGAAGAGGGAGGCAGAAGG + Intergenic
1024910543 7:54443488-54443510 CGTAGAAAGAGGGAGGGGGAGGG - Intergenic
1025016272 7:55441230-55441252 CTGGGGAGGAGGGAAGGGGGAGG + Intronic
1025044956 7:55684680-55684702 ATGTGGAAGAGGCAGGGAGCTGG + Intergenic
1025055375 7:55760725-55760747 AAGTGGAAGAGGGAGGTAGAAGG + Intergenic
1025133447 7:56390954-56390976 AAGTGGAAGAGGGAGGCAGAAGG + Intergenic
1025198808 7:56949750-56949772 AGGAGGGAGAGGGAGGGGGAGGG - Intergenic
1025288475 7:57688889-57688911 CTGTGGAATAGAGAGGTGGAAGG - Intergenic
1025673138 7:63627183-63627205 AGGAGGGAGAGGGAGGGGGAGGG + Intergenic
1025850107 7:65238042-65238064 ATGTGAAAGTGGGTGGGGGAGGG + Intergenic
1025910589 7:65825438-65825460 ATGTGGAAGAGGGAGGCAGAAGG - Intergenic
1025979696 7:66395060-66395082 TGGAGGGAGAGGGAGGGGGAGGG + Intronic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026041902 7:66875200-66875222 CTTTGGGAGACTGAGGGGGAGGG - Intergenic
1026044765 7:66899383-66899405 ATGTGGAAGAGGGAGGCAGAAGG - Intergenic
1026136088 7:67662324-67662346 CTGAGGATGAGGGAGGTGGAGGG - Intergenic
1026214912 7:68339959-68339981 CTTTGGGAGAGGGAGTGAGAAGG - Intergenic
1026285045 7:68955407-68955429 AAGGGGAAGAGGCAGGGGGATGG + Intergenic
1026312778 7:69202148-69202170 CTGTGGATGAGAGAGGGACAGGG - Intergenic
1026315711 7:69225378-69225400 ATGTTGAAGAGGGAGGGGCTGGG + Intergenic
1026325668 7:69307074-69307096 CAGTGGCAGAGGAAGAGGGAGGG + Intergenic
1026488837 7:70845643-70845665 GGGAGGGAGAGGGAGGGGGAGGG + Intergenic
1026843698 7:73685061-73685083 CTGTGGGAGGCGGAGGTGGACGG + Intronic
1026867526 7:73832712-73832734 CTGTGGAGGTGGGTGGGGAAGGG + Intergenic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027131805 7:75596627-75596649 CTTTGGAAGGTGGAGGCGGATGG - Intronic
1027183121 7:75953305-75953327 CGTGGAAAGAGGGAGGGGGAGGG + Intronic
1027208498 7:76123887-76123909 CTGTGGAAGAAGCATGGAGACGG - Intergenic
1027406972 7:77872363-77872385 CTGGGGAAGAGGTATGTGGATGG - Intronic
1027486798 7:78771330-78771352 CTCTGGGAAAGGGAGGGGGGCGG + Intronic
1027581000 7:79995662-79995684 GTGTGGTAGGGGGAGAGGGAAGG - Intergenic
1027832604 7:83199140-83199162 CAGTGGAAGAAGGAGGGGCAAGG + Intergenic
1028440172 7:90850597-90850619 CTGTGGAAGAGGGAACAGAAAGG + Intronic
1028534781 7:91880537-91880559 CTTTGGAGGAGGAAGAGGGATGG - Intronic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1029378141 7:100194541-100194563 CTTTGGGAGAGTGAGGTGGAAGG + Intronic
1029469154 7:100742869-100742891 ACGAGGGAGAGGGAGGGGGAGGG + Intronic
1030036498 7:105411768-105411790 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
1030114114 7:106050253-106050275 GCATGGAAGAGGGATGGGGAGGG - Intergenic
1030277626 7:107737264-107737286 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1030494114 7:110275162-110275184 TGGCGGAAGAGGGAGGGTGATGG - Intergenic
1030632036 7:111906708-111906730 CCTTGAAAAAGGGAGGGGGAAGG + Intronic
1030706504 7:112698039-112698061 CGTGGGAAGAGGGAGAGGGAGGG + Intergenic
1030738305 7:113077617-113077639 CTGTGAAAGTGGGAGCAGGAAGG - Intergenic
1030967821 7:116015860-116015882 CTGTGGAACATGTAAGGGGAAGG + Intronic
1031053120 7:116965400-116965422 CTGTGGAAGGGTGGGGGGCAAGG + Intronic
1031183691 7:118448722-118448744 CTCTGGGAGAGGGAGAGAGATGG + Intergenic
1031586689 7:123539020-123539042 CTGAGGGAAAAGGAGGGGGAGGG + Exonic
1032157086 7:129477184-129477206 CGTGGGGAGAGGGAGGGGGAGGG + Intronic
1032168150 7:129561984-129562006 CTGGGGAAGAGGGAGGGAGTGGG + Intergenic
1032290779 7:130588645-130588667 GTGGGGCAGGGGGAGGGGGAAGG + Intronic
1032338467 7:131048510-131048532 TTGTGGAAGAGGCAGAGGGGTGG - Intergenic
1032365331 7:131293563-131293585 CTTTGGAAGACTGAGGTGGAAGG + Intronic
1032390646 7:131553338-131553360 CTGTGGGAGAGGGAGGCATATGG - Intronic
1032589210 7:133176936-133176958 CGTGGGAAGGGGGAGGGGGAGGG - Intergenic
1032981069 7:137283852-137283874 ATGTGTATGAGGGAGGAGGATGG - Intronic
1033219921 7:139521047-139521069 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
1033293897 7:140114178-140114200 CCGTGGAAAGGGGAGGGGAAGGG - Intronic
1033422283 7:141214404-141214426 GGGTGGAGGAGGGTGGGGGATGG + Intronic
1033476087 7:141694502-141694524 CTTTGGAAGACAGAGGTGGAAGG - Intronic
1033565518 7:142574893-142574915 CAGGGGGAGGGGGAGGGGGAGGG - Intergenic
1033565522 7:142574899-142574921 CAGAGGCAGGGGGAGGGGGAGGG - Intergenic
1033565526 7:142574905-142574927 CAGAGGCAGAGGCAGGGGGAGGG - Intergenic
1033589515 7:142797630-142797652 CTGGGGAAGAGGGAGGGGGTGGG + Intergenic
1033838734 7:145347831-145347853 GTGGGGTAGAGGGAGGGGGAGGG - Intergenic
1033933318 7:146551280-146551302 GTGGGGTGGAGGGAGGGGGAAGG - Intronic
1034014378 7:147566323-147566345 GAGGGGTAGAGGGAGGGGGAGGG + Intronic
1034034311 7:147802773-147802795 GAGAGGGAGAGGGAGGGGGAGGG + Intronic
1034168282 7:149042653-149042675 AGGAGGAAGAGGGAAGGGGAGGG + Intergenic
1034169895 7:149054902-149054924 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1034211627 7:149368683-149368705 CTGTTGTAGGGGGAGGGGGAGGG - Intergenic
1034439661 7:151080333-151080355 CTGTGGGAGAGGGAGGTGGTCGG - Intronic
1034451867 7:151141508-151141530 CACTGGGAGAGGGTGGGGGAAGG - Intronic
1034711748 7:153198758-153198780 ATGTGGAAGACTGAGGAGGAAGG - Intergenic
1034724836 7:153325835-153325857 GTGGGGTGGAGGGAGGGGGAAGG - Intergenic
1034782610 7:153894668-153894690 CTGGGGAAGAGGTCGGGGGCAGG - Intronic
1034944934 7:155255677-155255699 AAGGGGGAGAGGGAGGGGGAGGG + Intergenic
1035070398 7:156140485-156140507 CTGAGGCAGAGAGAAGGGGAAGG + Intergenic
1035293896 7:157857117-157857139 CTGGGGATGCTGGAGGGGGAGGG + Intronic
1035314894 7:157991550-157991572 CTCTGGCTGAGGGAGGGTGAGGG + Intronic
1035336759 7:158134289-158134311 GTGTGTGAGAGGGAGCGGGAGGG - Intronic
1035634484 8:1133993-1134015 CTGTGGGAGGTGGAGGGGGGAGG - Intergenic
1035695270 8:1591289-1591311 GTTAGGAAGAGGGAGGGGGAGGG - Intronic
1035862293 8:3042225-3042247 CCTTGGAAGAGAGAGGTGGATGG + Intronic
1036409804 8:8489003-8489025 CTGGGGTGGAGGTAGGGGGATGG - Intergenic
1036547092 8:9782463-9782485 CACTGGAAGATGGAGAGGGAGGG - Intergenic
1036561979 8:9905854-9905876 GGGTGGAGGAGGGAGGGGGAGGG + Intergenic
1036565446 8:9934202-9934224 CTTTGGAAGGCGGAGGCGGAAGG + Intergenic
1036600729 8:10258081-10258103 CTGGGGGATAGGGAGGGGGTAGG + Intronic
1036653774 8:10662577-10662599 CAGGGGAAGCGGGAGGGTGATGG - Intronic
1036662168 8:10715607-10715629 CTGAGGAAGAGGGCGGCGGCTGG - Intergenic
1036796868 8:11762522-11762544 CTGTGTCAGAGGGAGGGAGAGGG - Exonic
1037497045 8:19450211-19450233 GGGAGGAAGAGGGAGGGGGAGGG + Intronic
1037816678 8:22116235-22116257 CTGTGGCACAGGGAGGTGGGAGG + Intronic
1038040730 8:23722239-23722261 GTGGGGGAGAGGGAGGAGGATGG + Intergenic
1038070047 8:24003752-24003774 ATGTGGAAGAGGGTGGGTGTTGG + Intergenic
1038091523 8:24259092-24259114 AAGTGTAAGAGGGAGTGGGAAGG + Intergenic
1038415032 8:27388948-27388970 CTGGTGAAGAGGGTGGGTGAGGG - Intronic
1038429760 8:27491006-27491028 CCGGGAAAGAGGCAGGGGGAGGG - Exonic
1038446932 8:27611007-27611029 CTGTGGAGGTGGCATGGGGAGGG - Intronic
1038497412 8:28013361-28013383 ATGGGGAAGAGAGAGGGGGAGGG + Intergenic
1039125826 8:34200605-34200627 GTGGGGTAGGGGGAGGGGGAGGG - Intergenic
1039385515 8:37132085-37132107 CTGTGGAGGAGGCAGGTGGCGGG - Intergenic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1039608891 8:38903551-38903573 CTGCAGAAGTGGGAAGGGGAAGG + Intronic
1039897250 8:41725209-41725231 CGGTGGAAGAGGGGAGGGGCGGG + Intronic
1040013680 8:42682973-42682995 CAGGGGAAGAGAGAAGGGGAAGG + Intergenic
1040818471 8:51533495-51533517 GAGAGGGAGAGGGAGGGGGAGGG - Intronic
1041352354 8:56960403-56960425 CTGTGTCAGAGGGAGAGGGGTGG - Exonic
1041513763 8:58677266-58677288 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
1041778433 8:61550839-61550861 CTGAGCAAGAGGGAGGGTGAGGG + Intronic
1041839838 8:62256167-62256189 CTGTGGGAGACTGAGGGGGGAGG + Intronic
1041924398 8:63221581-63221603 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1042104884 8:65315797-65315819 CTGTGGAAGAGGATGGCAGAAGG - Intergenic
1042323645 8:67504884-67504906 CTGTGCAGGAGGGAGGAGGATGG + Intronic
1042785134 8:72537531-72537553 CTGTGGCGGCGGCAGGGGGATGG + Exonic
1042803365 8:72745103-72745125 CTCTGGATCAGGGAGGTGGAGGG - Intronic
1042894758 8:73653971-73653993 GTTAGGAAGAGGGAAGGGGAGGG + Intronic
1043479291 8:80637049-80637071 CTGGGGGTGGGGGAGGGGGACGG - Exonic
1043510895 8:80949222-80949244 GTGTGGATGTGGGAGTGGGATGG + Intergenic
1043961779 8:86424822-86424844 GAGAGGGAGAGGGAGGGGGAGGG + Intronic
1044384711 8:91573780-91573802 AAGTGGAGGAGGGAGGGGGATGG + Intergenic
1044506590 8:93027254-93027276 CTGGCCAAGAGAGAGGGGGAGGG + Intergenic
1044512348 8:93097168-93097190 CTTAGGAAGAGGGAGGCAGAGGG - Intergenic
1044603282 8:94026783-94026805 CTGGGGAAGGGGTAGGGGAATGG - Intergenic
1044656506 8:94553782-94553804 CGGTGGATGGAGGAGGGGGAGGG + Intergenic
1044999912 8:97869781-97869803 TTGTGGAAGAGGGAGAGAAAGGG + Intronic
1045195482 8:99926588-99926610 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
1045305866 8:100956180-100956202 CTGTGGGAGGGTGAGGTGGATGG + Intergenic
1045516441 8:102864269-102864291 CCGGAGAAAAGGGAGGGGGACGG + Exonic
1045527714 8:102955726-102955748 CTTTGGAAGATCGAGGGGGGTGG + Intronic
1045737422 8:105313060-105313082 CTGTGGAAGAGGATTGGGAATGG + Intronic
1046362897 8:113185420-113185442 CTGGGAAAGAGGGATGGGGAAGG - Intronic
1046557701 8:115796124-115796146 GTGGGGTGGAGGGAGGGGGAAGG - Intronic
1046612904 8:116445296-116445318 CGGGGGAGGAGAGAGGGGGAGGG + Intergenic
1046709378 8:117492596-117492618 TTGTGGTGGAGGGAGAGGGAGGG + Intergenic
1047167917 8:122461311-122461333 CTGAGTAAGAAGGAGGGGGCTGG + Intergenic
1047177233 8:122553446-122553468 CTATGGACCAGGGTGGGGGAAGG + Intergenic
1047248089 8:123161333-123161355 CTGGGGAGGAGGGTGGGAGAAGG - Intergenic
1047256182 8:123215125-123215147 CTGTGAAAGAGAGAGGAGGGGGG + Intergenic
1047284244 8:123472797-123472819 CTGTGGAAGAGAAAGAGGCAGGG + Intergenic
1047572264 8:126111867-126111889 ATGGGCAAGAGGGAGGAGGAAGG - Intergenic
1047614918 8:126556280-126556302 CTGTGGACGGGGGAGGAGGAAGG - Exonic
1047621006 8:126608002-126608024 CTGGGGTGGGGGGAGGGGGAGGG - Intergenic
1047733802 8:127748342-127748364 CTGTGATAGAGGAAGGGGGGAGG - Intergenic
1047749078 8:127866489-127866511 CTGAAGGAGAGGGAGTGGGAGGG - Intergenic
1047775870 8:128069978-128070000 CTATGGAGGAGGGAAGGGAATGG - Intergenic
1047907191 8:129484740-129484762 CTGGGGAAAAGGGAAGGGCAGGG - Intergenic
1048027769 8:130602276-130602298 CTGAGGAAAATGGAAGGGGATGG - Intergenic
1048319433 8:133386898-133386920 CTTTGGAAGAGGGAGGGGTGGGG - Intergenic
1048354588 8:133642794-133642816 CTGTGGAAGGCGGAAGGGGCTGG + Intergenic
1048364929 8:133730254-133730276 CTGCGGAGGAGGGTGGAGGAAGG + Intergenic
1048451230 8:134535491-134535513 GGGAGGGAGAGGGAGGGGGAGGG - Intronic
1049009388 8:139877218-139877240 CAGTGGAAGAGGCAGGCGGAGGG + Intronic
1049270625 8:141693736-141693758 CTGAGGGAGAGGGAGGGGCACGG + Intergenic
1049273442 8:141708090-141708112 CTGGGGAAGCGGGTGAGGGAGGG + Intergenic
1049361095 8:142212919-142212941 ATGGGAGAGAGGGAGGGGGAGGG - Intronic
1049545376 8:143228373-143228395 CTGCGGGAGAGGGAGGCGGGGGG + Intergenic
1049654271 8:143790886-143790908 CTGTGCTAGTGGGTGGGGGATGG + Intergenic
1049784214 8:144442897-144442919 CTCGGGAGGAGGGAGGGGGTAGG - Intronic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1049976176 9:862503-862525 CCGTGCAATGGGGAGGGGGAGGG + Intronic
1049986350 9:955164-955186 CTGGGGAGGAGGGAGAGGGTAGG + Intronic
1050186949 9:2984703-2984725 CTGTGGGAGAGTGAGGAGGAAGG + Intergenic
1050290469 9:4148875-4148897 CTGTGGAGGAGAGAGGAGAATGG - Intronic
1050417438 9:5432501-5432523 CGTAGAAAGAGGGAGGGGGAGGG - Intronic
1050437892 9:5629088-5629110 GTGTGGGGGAGGGAAGGGGAGGG - Intronic
1050482761 9:6103231-6103253 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1050690750 9:8223835-8223857 CAGGAGAAGAGGAAGGGGGAAGG + Intergenic
1051169657 9:14307521-14307543 CTGTGGAAGACAGAGGGGTGAGG + Intronic
1051189121 9:14492565-14492587 AGGAAGAAGAGGGAGGGGGAAGG + Intergenic
1051338949 9:16093352-16093374 CTGTGGAGGTGGGAGAGGCAGGG + Intergenic
1051366355 9:16324150-16324172 CTGAGGAAAAAGGAAGGGGAGGG + Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051784339 9:20725425-20725447 CTGAGAAAGAGAGAGGGGGGTGG + Intronic
1051800051 9:20922404-20922426 AAGTGGAAGGGAGAGGGGGAAGG + Intronic
1052028661 9:23603843-23603865 CTGGGGAAGAGCGAAGGGGCGGG - Intergenic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1052493023 9:29190037-29190059 GAGAGGGAGAGGGAGGGGGAGGG + Intergenic
1052561478 9:30089360-30089382 CTGGGGAAGAGGTATGTGGACGG - Intergenic
1052685756 9:31753523-31753545 CTCAAGAAGAAGGAGGGGGAGGG - Intergenic
1052930058 9:34048786-34048808 CCCTGGAAGAGGGAAGGAGAGGG + Intronic
1052951812 9:34219726-34219748 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1053125381 9:35576632-35576654 CTGTGGAAGAGAGGAAGGGAAGG - Intergenic
1053699543 9:40675859-40675881 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1054206127 9:62131476-62131498 CTGAGGAAGAGGCAAAGGGAGGG - Intergenic
1054310832 9:63475260-63475282 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1054409621 9:64799411-64799433 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1054632231 9:67456891-67456913 CTGAGGAAGAGGCAAAGGGAGGG + Intergenic
1054768373 9:69061668-69061690 GTGGGGTGGAGGGAGGGGGAAGG - Intronic
1054918705 9:70520460-70520482 CTGTGGAGGAGGATGGGCGAGGG + Intergenic
1055009767 9:71552675-71552697 CTGTGCAGGATTGAGGGGGAGGG + Intergenic
1055068223 9:72140352-72140374 GTGTGGAAGAGAGAAGGAGAAGG + Intronic
1055931618 9:81565129-81565151 CTGGGGAGGGGGGAGGGGGGAGG + Intergenic
1055948085 9:81709512-81709534 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
1055953336 9:81751152-81751174 CTGTGGGAGGCGGAGGTGGACGG - Intergenic
1056112581 9:83410295-83410317 CTGTGGGGGAGGGAGGGACAAGG - Intronic
1056271930 9:84955191-84955213 CTTAGCAAGAGGGACGGGGAGGG + Intronic
1056640499 9:88365967-88365989 CTGTGGAAGTGTGAGGTGGGTGG - Intergenic
1056811985 9:89772085-89772107 CTGTGGATGAATGTGGGGGAGGG - Intergenic
1057037099 9:91818918-91818940 CTGCAGAAGAGGGAGGGGGCAGG - Intronic
1057345444 9:94246747-94246769 CTGTGGAAGGAGGAGGGATAAGG - Intergenic
1057476956 9:95411283-95411305 CTGTGGGAGTGGGCGGGGGCGGG + Intergenic
1057477963 9:95420676-95420698 CTGTGACAGAAGGAGAGGGAGGG - Intergenic
1057519720 9:95751575-95751597 CTGTGGAAGGGAGGGAGGGAGGG + Intergenic
1057522835 9:95773416-95773438 TTGCGGAAGAGGGTGGGTGAGGG + Intergenic
1057630662 9:96716507-96716529 AAGTGGGAGAGGGAGGGGGACGG + Intergenic
1057731884 9:97616533-97616555 GTGTGGAAGAGAGAAGGGAACGG + Intronic
1057782494 9:98061231-98061253 CTTTGGGAGACTGAGGGGGATGG + Intronic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058049456 9:100392208-100392230 GAGAGGGAGAGGGAGGGGGAAGG - Intergenic
1058139462 9:101342426-101342448 GAGGGGAAGAGGGAAGGGGAGGG + Intergenic
1058139511 9:101342527-101342549 GAGTGGGAGGGGGAGGGGGAAGG + Intergenic
1058228323 9:102394252-102394274 GTGGGGTAGGGGGAGGGGGAAGG + Intergenic
1058522742 9:105828367-105828389 TTGAGGAAAGGGGAGGGGGAAGG - Intergenic
1058549656 9:106100628-106100650 CTGTCGAAGAAGCAGGGAGAGGG - Intergenic
1058609134 9:106756052-106756074 ATCTGGAAGAGGGTGGGCGAAGG - Intergenic
1058617163 9:106843267-106843289 ATTTGGAAGAGGGTGGGGGTAGG + Intergenic
1058626538 9:106939251-106939273 GTGTGGAAGTTGGAGTGGGAAGG + Intronic
1058754365 9:108070658-108070680 CTGTGGACCAGGGAGAAGGATGG + Intergenic
1058994538 9:110286751-110286773 CTGCTGAAGAGGGTGGGGGAGGG + Intergenic
1059250279 9:112881988-112882010 CTGTGGCTGAGGGTTGGGGAGGG + Intronic
1059392409 9:114007518-114007540 CTGGGTAAGAGGGAGGAGGGAGG - Intronic
1059434222 9:114266671-114266693 CTGGGGAGGAGGGAAGGGAAGGG - Intronic
1059471961 9:114511862-114511884 CAGAGGAAGAGGTAGGGGAAAGG + Intergenic
1059525003 9:114983215-114983237 CTTTGGAAGAAAGAGTGGGAAGG + Intergenic
1059583795 9:115583070-115583092 CTGTTGACGAGGCAGGGGGTTGG - Intergenic
1059891933 9:118813556-118813578 CTGGGGAAGAGGGAGTGGGGCGG - Intergenic
1060055224 9:120407341-120407363 CTTAGGAAGGGGGAGGGCGATGG - Intronic
1060190354 9:121588602-121588624 ATGGGGAAGAGGGAAGGGAAGGG + Intronic
1060207802 9:121692861-121692883 CCGGGGAACAGGGAAGGGGAGGG + Intronic
1060238548 9:121884146-121884168 CTCTGGGAGGGGGAGGTGGATGG - Intronic
1060454101 9:123774009-123774031 CAGTGAAAGAGGAAGGGGAAGGG + Intronic
1061177769 9:129007956-129007978 CTGTGGAAGAGTGGGGCAGAGGG + Intronic
1061283516 9:129610199-129610221 GGGGGGAGGAGGGAGGGGGAGGG + Intronic
1061338476 9:129959818-129959840 CTGAGGAAGATGGAGGGTGACGG - Intronic
1061507195 9:131038097-131038119 CAGAGGAAGAGGGGGCGGGAAGG - Intronic
1061531634 9:131218647-131218669 CAATGGAAGAGCCAGGGGGAAGG - Intronic
1061637473 9:131922022-131922044 ATGGGGAGGGGGGAGGGGGAGGG + Intronic
1061805879 9:133137617-133137639 CGGGGGAAGAGCGAGGAGGAAGG + Intronic
1061811162 9:133163503-133163525 CAGAGGAAGAGAGAGGGAGAGGG - Intronic
1061900030 9:133668297-133668319 GTGGGGGAGAGGGAGGGAGAGGG - Intronic
1061900040 9:133668319-133668341 ATGAGGGAGAGGGAGAGGGAGGG - Intronic
1061900048 9:133668345-133668367 GTGAGGGAGAGGGAGGGTGAGGG - Intronic
1061900101 9:133668495-133668517 GTGAGGGAGAGGGAGGGTGAGGG - Intronic
1061900107 9:133668511-133668533 GTGAGGGAGAGGGAGGGTGAGGG - Intronic
1061900113 9:133668527-133668549 GTGAGGGAGAGGGAGGGTGAGGG - Intronic
1061900126 9:133668560-133668582 GTGAGGGAGAGGGAGGGTGAGGG - Intronic
1061900132 9:133668576-133668598 GTGAGGGAGAGGGAGGGTGAGGG - Intronic
1061900147 9:133668615-133668637 GTGAGGGAGAGGGAGGGGGAGGG - Intronic
1061900174 9:133668680-133668702 GTGAGGGAGAGGGAGGGTGAGGG - Intronic
1061900180 9:133668696-133668718 GTGAGGGAGAGGGAGGGTGAGGG - Intronic
1061900195 9:133668735-133668757 GTGAGGGAGAGGGAGGGGGAGGG - Intronic
1061900215 9:133668783-133668805 GTGAGGGAGAGGGAGGGTGAGGG - Intronic
1061900234 9:133668833-133668855 GTGAGGGAGAGGGAGGGTGAGGG - Intronic
1061900246 9:133668866-133668888 GTGAGGGAGAGGGAGGGTGAGGG - Intronic
1061900252 9:133668882-133668904 GTGAGGGAGAGGGAGGGTGAGGG - Intronic
1061900318 9:133669076-133669098 GTGAGGGAGAGGGAGGGTGAGGG - Intronic
1061900324 9:133669092-133669114 GTGAGGGAGAGGGAGGGTGAGGG - Intronic
1061900386 9:133669270-133669292 GTGAGGGAGAGGGAGGGTGAGGG - Intronic
1061933143 9:133843649-133843671 ATGTGAAGGAAGGAGGGGGAAGG + Intronic
1062024098 9:134332514-134332536 CTGTGGAGGAGGGGTGGGGGAGG + Intronic
1062046548 9:134427062-134427084 CTGTGGCCCAGGGAGGGGAAGGG - Intronic
1062068088 9:134539768-134539790 CTGTGGCCGAGGGAGAAGGATGG + Intergenic
1062068161 9:134540041-134540063 CTGTGGGACAGGGAGGAGGTAGG - Intergenic
1062122684 9:134842134-134842156 CTGGGGAAGAGGGAGACAGATGG - Intronic
1062135563 9:134925636-134925658 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1062143715 9:134976690-134976712 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1062164555 9:135100984-135101006 CCTGGGAAGAGGGAGGAGGAAGG - Intronic
1062167505 9:135115295-135115317 CTTCGGAAGAGGGAGGAGGCCGG + Intronic
1062169899 9:135129193-135129215 CTGGGGAAGTGGGGTGGGGATGG + Intergenic
1062212923 9:135374183-135374205 CTGTGGAAGTAGGTGGAGGAGGG - Intergenic
1062361451 9:136190214-136190236 ATGAGGCAGGGGGAGGGGGAGGG - Intergenic
1062571458 9:137187643-137187665 CAGAGTAAGAGGAAGGGGGAAGG - Exonic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1203612064 Un_KI270749v1:18113-18135 CTGTGGAATAGAGAGGTGGAAGG + Intergenic
1185791578 X:2931473-2931495 CTTTGGGAGACTGAGGGGGAAGG + Intergenic
1186344377 X:8676488-8676510 CTGTTGAAGTGTGAGGGGAAGGG + Intronic
1186389820 X:9147937-9147959 CTGTGGCTGGGGGTGGGGGAGGG - Intronic
1186410566 X:9342197-9342219 GGGAGGAGGAGGGAGGGGGATGG - Intergenic
1186424052 X:9449457-9449479 CTGGTGAAGAGGGAGGGAGAGGG + Intergenic
1186506589 X:10098306-10098328 CTGGGGAGGGGGGAGGGGGAAGG - Intronic
1186624968 X:11283659-11283681 ATGTGGAACAGGGAGGCAGAAGG + Intronic
1186718143 X:12275241-12275263 AGGTGGAAAAGAGAGGGGGAGGG - Intronic
1187178247 X:16916624-16916646 CTGTTGGGGGGGGAGGGGGAGGG - Intergenic
1187500347 X:19833606-19833628 CTGTGGAAAGGCGAGGTGGATGG - Intronic
1187864934 X:23715371-23715393 CTGGGGAATAGGGATGGGGGAGG - Intronic
1187889955 X:23924663-23924685 GTGGGGATGAGGGAGGGGGGAGG + Intronic
1187962654 X:24581441-24581463 CTGTGGCAGAGTGAGGGGAGGGG - Intronic
1188079133 X:25815164-25815186 GGGAGGAAGAGGGAGGGAGAGGG - Intergenic
1188214140 X:27457839-27457861 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
1189201654 X:39201435-39201457 GTGTGTAAGAGGAAGTGGGAAGG - Intergenic
1189220730 X:39369442-39369464 CTGTGCAAGAGGGAGGTGCCAGG - Intergenic
1189268663 X:39735493-39735515 CTGGGGAAGAGGGAGGGGGAGGG + Intergenic
1189307998 X:40001717-40001739 CTGTGGTAGAGGGAGAGGTCTGG + Intergenic
1189341513 X:40207951-40207973 CTGGGGAAGAAGGAGGGGGGTGG + Intergenic
1189364737 X:40379939-40379961 AGGAGGAAGAGGGAGGAGGAAGG - Intergenic
1189514942 X:41704028-41704050 TAGGGGAAAAGGGAGGGGGAGGG - Intronic
1189555803 X:42144128-42144150 CTGTGGGAGAGGGAATGGAAAGG + Intergenic
1189999494 X:46671896-46671918 CAGTCAAAGAGGGAGTGGGAGGG + Intronic
1190066632 X:47245866-47245888 GTGTGGAGGAGGGAGGAGGAAGG - Intronic
1190174571 X:48138562-48138584 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
1190205115 X:48396464-48396486 CGGGGGAGGGGGGAGGGGGAGGG - Intergenic
1190321225 X:49180449-49180471 CTTTGGAAGAGGGATGGGAGCGG - Intronic
1190403809 X:50066011-50066033 GTGGGGAGGGGGGAGGGGGAAGG + Intronic
1190633345 X:52410974-52410996 CTGGGAAACAGGGAGGTGGATGG - Intergenic
1190751777 X:53368276-53368298 TTGTGCACAAGGGAGGGGGAGGG - Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1190895428 X:54613804-54613826 CTGTGGAGGTGGCAGGGGCAGGG + Intergenic
1191767347 X:64712674-64712696 GTGGGGCAGGGGGAGGGGGAAGG - Intergenic
1191912337 X:66164286-66164308 GGGAGGATGAGGGAGGGGGAAGG - Intronic
1191982402 X:66940812-66940834 CTCTGGAAGATGGAGTGGGTAGG + Intergenic
1192188799 X:68978293-68978315 CGGTGGACGGGGGTGGGGGAGGG - Intergenic
1192213977 X:69145085-69145107 GTGAGGAGGAGGGAGGGGGGAGG + Intergenic
1192264403 X:69529179-69529201 CTGGGGAAGAGGGAGGAGGCCGG + Intronic
1192284556 X:69721198-69721220 CTCTGGAAGAAGGAAGGGCATGG + Intronic
1192418357 X:71005082-71005104 AAGAGGAAGAGGGATGGGGATGG - Intergenic
1192451877 X:71249918-71249940 CTGTGGAAAGGGGAGTGGGGAGG - Intronic
1192844496 X:74891874-74891896 CTGTGAAAGGGTGAGGGGAAAGG - Intronic
1193345437 X:80397939-80397961 CCGTGGGAGAGGGCGAGGGAGGG + Intronic
1194125422 X:90010647-90010669 CTGGGGAAGAGGGGGTGGAAGGG - Intergenic
1194191986 X:90848607-90848629 CTGTGGGAGATGGTGGGGGGTGG + Intergenic
1194239293 X:91423868-91423890 CTGTGGATGAGGGATGGACAAGG + Intergenic
1194373867 X:93109248-93109270 CGGTGAGAGAGGGAGTGGGAGGG + Intergenic
1195119766 X:101738447-101738469 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
1195520317 X:105822304-105822326 CAGTGGACGTGGGAGGGGGCAGG + Intergenic
1195688299 X:107604266-107604288 CTGTGGATCGGGGAGGGGGGTGG + Exonic
1195708775 X:107757713-107757735 CTGTGGGAACGGGAGGGGAAAGG - Intronic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1195997449 X:110745436-110745458 CTGTGTAGGAGGGAGGAGGCTGG - Intronic
1196051841 X:111313881-111313903 GAGAGGAAGAGAGAGGGGGAGGG + Intronic
1196117571 X:112014082-112014104 CAGTAGAAGTGGGATGGGGATGG + Intronic
1196178326 X:112664569-112664591 CTGGGGAAGATGGCGGGGGTGGG - Intronic
1196283950 X:113857910-113857932 CTGTTGGAGTGGCAGGGGGAGGG - Intergenic
1196303505 X:114072921-114072943 CTTTGTAAGTTGGAGGGGGAGGG + Intergenic
1197116020 X:122834906-122834928 GAGGGGAAGAGAGAGGGGGAGGG - Intergenic
1197116034 X:122834941-122834963 GAGGGGAAGAGAGAGGGGGAGGG - Intergenic
1197346317 X:125327926-125327948 CTGTGGTTGAGGAAGGGGGCAGG - Intergenic
1197452767 X:126640744-126640766 GAGAGGGAGAGGGAGGGGGAGGG - Intergenic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1197816401 X:130503080-130503102 GAGAGAAAGAGGGAGGGGGAGGG - Intergenic
1197847867 X:130822626-130822648 GTGGGGTAGGGGGAGGGGGAAGG + Intronic
1197974680 X:132154089-132154111 CTTTGAAAGATGGAGGGTGAAGG + Intergenic
1197983572 X:132244177-132244199 GTGAGGTAGGGGGAGGGGGAGGG - Intergenic
1198246682 X:134838678-134838700 CGTGGGGAGAGGGAGGGGGAGGG - Intronic
1198322581 X:135533263-135533285 CTTTGGAAGAGTGAGAGTGAGGG + Intronic
1198322598 X:135533544-135533566 CTGTGAATGGGGGTGGGGGAAGG - Intronic
1198997151 X:142586048-142586070 GGGGGGAAGGGGGAGGGGGAAGG + Intergenic
1199386875 X:147233172-147233194 GGGTGGAAGAGGGAGAGAGAAGG - Intergenic
1199451343 X:147981712-147981734 CTGGGGGAGGGGGAGGGGGAGGG + Intronic
1199491728 X:148407343-148407365 TTGTGGAGGGGGGAGGGGGGAGG + Intergenic
1199535269 X:148895595-148895617 GTGTAAGAGAGGGAGGGGGAGGG + Intronic
1199583743 X:149389065-149389087 ATGGGGAATAGGGACGGGGACGG + Intergenic
1199601992 X:149546532-149546554 CGCTGGGAGAGGCAGGGGGAGGG - Intronic
1199648396 X:149932952-149932974 CGCTGGGAGAGGCAGGGGGAGGG + Intronic
1199800742 X:151248365-151248387 CTGGAGCAGAGGGAGGGGGAGGG + Intergenic
1199800746 X:151248371-151248393 CAGAGGGAGGGGGAGGGGGAGGG + Intergenic
1199825742 X:151497922-151497944 TTGGGGAAGAGGATGGGGGAGGG - Intergenic
1199859168 X:151784270-151784292 AAGAGGAAGAGGGAGAGGGAAGG - Intergenic
1200063109 X:153492303-153492325 CTGAGGAGGGGGGAGTGGGAGGG + Intronic
1200099795 X:153684847-153684869 CTGAGGAGGAGGGAGAGGGGAGG - Intronic
1200100605 X:153687823-153687845 ATGCGGGAGGGGGAGGGGGAGGG + Intronic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200305468 X:155022118-155022140 CTGGAGTAGAGGGAGGGTGAAGG - Intronic
1200681896 Y:6223310-6223332 CGGTGAGAGAGGGAGTGGGAGGG + Intergenic
1200804824 Y:7422490-7422512 CTGGGGAAGGGAGAGGGGGCAGG - Intergenic
1201550344 Y:15211626-15211648 AGGTGCAAGAGGGAGAGGGAGGG + Intergenic
1202332871 Y:23773144-23773166 GTGTGGTGGCGGGAGGGGGAAGG - Intergenic
1202537898 Y:25896919-25896941 GTGTGGTGGCGGGAGGGGGAAGG + Intergenic
1202628283 Y:56882878-56882900 GTGGGGTAGGGGGAGGGGGAAGG - Intergenic