ID: 1128255645

View in Genome Browser
Species Human (GRCh38)
Location 15:66194649-66194671
Sequence CTTTGGGGACTCAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2126
Summary {0: 2, 1: 28, 2: 199, 3: 616, 4: 1281}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128255638_1128255645 23 Left 1128255638 15:66194603-66194625 CCGTCTCAAAAAACAAACAAACA 0: 1553
1: 1485
2: 3354
3: 104356
4: 89187
Right 1128255645 15:66194649-66194671 CTTTGGGGACTCAGGGAAGAAGG 0: 2
1: 28
2: 199
3: 616
4: 1281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128255645 Original CRISPR CTTTGGGGACTCAGGGAAGA AGG Intronic
Too many off-targets to display for this crispr