ID: 1128260444

View in Genome Browser
Species Human (GRCh38)
Location 15:66229278-66229300
Sequence GCCCTGGTGCGCATTGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 146}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128260444_1128260452 12 Left 1128260444 15:66229278-66229300 CCAGCCCCAATGCGCACCAGGGC 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1128260452 15:66229313-66229335 GTCCACAAGCCCCAGGCTCCCGG 0: 1
1: 0
2: 1
3: 23
4: 339
1128260444_1128260458 22 Left 1128260444 15:66229278-66229300 CCAGCCCCAATGCGCACCAGGGC 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1128260458 15:66229323-66229345 CCCAGGCTCCCGGTGGGCCATGG 0: 1
1: 0
2: 2
3: 40
4: 305
1128260444_1128260461 30 Left 1128260444 15:66229278-66229300 CCAGCCCCAATGCGCACCAGGGC 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1128260461 15:66229331-66229353 CCCGGTGGGCCATGGCGACCTGG 0: 1
1: 0
2: 2
3: 6
4: 82
1128260444_1128260454 15 Left 1128260444 15:66229278-66229300 CCAGCCCCAATGCGCACCAGGGC 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1128260454 15:66229316-66229338 CACAAGCCCCAGGCTCCCGGTGG 0: 1
1: 0
2: 1
3: 15
4: 245
1128260444_1128260455 16 Left 1128260444 15:66229278-66229300 CCAGCCCCAATGCGCACCAGGGC 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1128260455 15:66229317-66229339 ACAAGCCCCAGGCTCCCGGTGGG 0: 1
1: 0
2: 0
3: 14
4: 133
1128260444_1128260451 5 Left 1128260444 15:66229278-66229300 CCAGCCCCAATGCGCACCAGGGC 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1128260451 15:66229306-66229328 CAGGACTGTCCACAAGCCCCAGG 0: 1
1: 0
2: 0
3: 26
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128260444 Original CRISPR GCCCTGGTGCGCATTGGGGC TGG (reversed) Intronic