ID: 1128260444

View in Genome Browser
Species Human (GRCh38)
Location 15:66229278-66229300
Sequence GCCCTGGTGCGCATTGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 146}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128260444_1128260458 22 Left 1128260444 15:66229278-66229300 CCAGCCCCAATGCGCACCAGGGC 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1128260458 15:66229323-66229345 CCCAGGCTCCCGGTGGGCCATGG 0: 1
1: 0
2: 2
3: 40
4: 305
1128260444_1128260451 5 Left 1128260444 15:66229278-66229300 CCAGCCCCAATGCGCACCAGGGC 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1128260451 15:66229306-66229328 CAGGACTGTCCACAAGCCCCAGG 0: 1
1: 0
2: 0
3: 26
4: 229
1128260444_1128260454 15 Left 1128260444 15:66229278-66229300 CCAGCCCCAATGCGCACCAGGGC 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1128260454 15:66229316-66229338 CACAAGCCCCAGGCTCCCGGTGG 0: 1
1: 0
2: 1
3: 15
4: 245
1128260444_1128260461 30 Left 1128260444 15:66229278-66229300 CCAGCCCCAATGCGCACCAGGGC 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1128260461 15:66229331-66229353 CCCGGTGGGCCATGGCGACCTGG 0: 1
1: 0
2: 2
3: 6
4: 82
1128260444_1128260455 16 Left 1128260444 15:66229278-66229300 CCAGCCCCAATGCGCACCAGGGC 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1128260455 15:66229317-66229339 ACAAGCCCCAGGCTCCCGGTGGG 0: 1
1: 0
2: 0
3: 14
4: 133
1128260444_1128260452 12 Left 1128260444 15:66229278-66229300 CCAGCCCCAATGCGCACCAGGGC 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1128260452 15:66229313-66229335 GTCCACAAGCCCCAGGCTCCCGG 0: 1
1: 0
2: 1
3: 23
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128260444 Original CRISPR GCCCTGGTGCGCATTGGGGC TGG (reversed) Intronic
900213405 1:1468316-1468338 GCCCTGGCGTGCATTTGGGGTGG + Intronic
900220966 1:1509137-1509159 GCCCTGGCGTGCATTTGGGGTGG + Intergenic
900225971 1:1533858-1533880 GCCCTGGCGTGCATTTGGGGTGG + Intronic
900302891 1:1986744-1986766 GGCCTGGAGGGCACTGGGGCTGG - Intronic
901067710 1:6502291-6502313 GCCATGGGGCACCTTGGGGCAGG + Intronic
902308731 1:15564106-15564128 GCCCCTGTGAGCATCGGGGCTGG + Exonic
902633519 1:17719948-17719970 GCCCTGGTCCCCATTGGGCAGGG + Intergenic
902843856 1:19094041-19094063 GCCCTGGAGCACACTGGGGTTGG + Exonic
903275057 1:22216297-22216319 GCCCTGGTGCGGGTTGAGGTCGG + Intergenic
903998376 1:27322464-27322486 GGCTTGCTGCGCGTTGGGGCCGG - Intronic
906102648 1:43273032-43273054 GCCCTGCTGCGCAGTGGTGGAGG + Exonic
907955625 1:59225435-59225457 CCCTGGGTGGGCATTGGGGCTGG + Intergenic
910188838 1:84574466-84574488 GGCCTGCTGCGCGTCGGGGCAGG + Intronic
912409171 1:109467566-109467588 GCCCTGGTGGGTTTGGGGGCAGG - Intronic
913331499 1:117671817-117671839 GCTCTGGTGTGTATTTGGGCTGG - Intergenic
914337680 1:146730464-146730486 GCGCTGGGGTGCACTGGGGCCGG - Intergenic
914928293 1:151907793-151907815 GCACTGGTGACCATTGGGGTGGG - Intronic
915310572 1:155004060-155004082 GCCCTGGGGGGCAGGGGGGCGGG + Intronic
917738148 1:177938943-177938965 GCCTTGGTGCCCAGTGGAGCAGG - Intronic
919880560 1:201897990-201898012 GCCCTGGAGGGCAGTGGGGCTGG + Exonic
922620362 1:226984824-226984846 GCCCTGGTGCTCCATGGTGCGGG - Intronic
922731986 1:227953455-227953477 GCCTTGGTGGGCATGGTGGCGGG - Intergenic
1063663770 10:8050179-8050201 GCCCCGGTGCGTACTGCGGCGGG + Intergenic
1065558157 10:26937022-26937044 ACCCTTGTGCCAATTGGGGCTGG + Intergenic
1067838349 10:49655500-49655522 GCCGTGGTGCCCATTCTGGCAGG - Intronic
1069563526 10:69448582-69448604 GCCTTGGAGCTCTTTGGGGCTGG - Intergenic
1070531757 10:77343123-77343145 CCCCAGGTGAGCATTGAGGCCGG + Intronic
1076190805 10:128482138-128482160 TCCCTCGTGCCCAGTGGGGCAGG + Intergenic
1076743043 10:132497552-132497574 CCCCTGGGGCCCCTTGGGGCTGG - Intergenic
1077056595 11:597035-597057 GCCCATGTGCGCCTTGGGACGGG - Intronic
1077843241 11:5997485-5997507 GCCCTGGTGGGCTGTGGGGAGGG - Intergenic
1077922112 11:6649426-6649448 GTCCAGGTGAGCATGGGGGCAGG + Intronic
1079205623 11:18412203-18412225 GCCCTGGAGCGCAGTGTGGGTGG - Intergenic
1083278463 11:61610974-61610996 GCCCTGATGTGCATGGGGGAGGG - Intergenic
1083641622 11:64148820-64148842 CCCCTGGTGGGCACAGGGGCTGG + Intronic
1084429048 11:69101315-69101337 TCCCTGGTGCACACTGGGGGTGG - Intergenic
1084752571 11:71213997-71214019 GTCCTGGGGCGCGTTAGGGCAGG - Intronic
1084892733 11:72244383-72244405 GGTCTGGTCCGGATTGGGGCAGG - Intronic
1084942014 11:72617971-72617993 GCCCTGGGGAGCATGGTGGCTGG - Intronic
1085269354 11:75261092-75261114 GACCTGGTGCTCAGTGGGGATGG - Intergenic
1086935699 11:92743554-92743576 GCCCTGGGGCCCATTTGGCCAGG - Intronic
1088401204 11:109423625-109423647 GCCCTGGCACTCATTGGCGCGGG - Exonic
1092023661 12:5223078-5223100 GAGCTGGTGAGCTTTGGGGCAGG - Intergenic
1092810271 12:12266482-12266504 GGCCAGGTCCGCATTGTGGCCGG + Intronic
1093094261 12:14954427-14954449 GCCCAGGTGCACATGGGTGCAGG + Intronic
1096124474 12:49109622-49109644 GCCCTGGTGAGCTCTGGGGAAGG + Intronic
1103895126 12:124268031-124268053 ACCCTGGTGCCCAGAGGGGCTGG - Intronic
1106720094 13:32427814-32427836 GCCCGGGAGCGGCTTGGGGCAGG + Intronic
1110853873 13:80276458-80276480 CCCCTGGTGGGCATTGGGAAAGG - Intergenic
1117549300 14:56817698-56817720 GCCCTGGCTCACACTGGGGCGGG - Intergenic
1117788633 14:59314539-59314561 GCCCTGGGGGGCTTAGGGGCTGG + Intronic
1125675693 15:41501554-41501576 ACACTGGTGAGCAGTGGGGCGGG + Exonic
1128260444 15:66229278-66229300 GCCCTGGTGCGCATTGGGGCTGG - Intronic
1128430489 15:67588395-67588417 TCCCTGGTGTGCACTGGGGATGG - Intronic
1129158786 15:73735305-73735327 GGTCTGGTGTGCCTTGGGGCTGG - Intergenic
1132465996 16:77745-77767 GCCCTGGTCCGGAGTGGGCCGGG - Intronic
1132700886 16:1221583-1221605 GGCCTGATTCGCATCGGGGCCGG - Exonic
1132710178 16:1262946-1262968 GACCTGGTGGGCATTGTGGGGGG - Intergenic
1132712664 16:1276463-1276485 GACCTGGTGGGCATTGTGGGGGG - Intergenic
1139996601 16:70986864-70986886 GCGCTGGGGTGCACTGGGGCCGG + Intronic
1140480177 16:75258124-75258146 GCCCTGGTGCCCAGCGGGGTGGG - Intronic
1141638244 16:85326988-85327010 CCCCTGGTGCCCTGTGGGGCAGG - Intergenic
1142234633 16:88915813-88915835 GCCCTGGTGGGCTGTGTGGCTGG + Intronic
1142499997 17:326939-326961 GCCCTGGGGCAGCTTGGGGCTGG + Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1144679910 17:17186343-17186365 GCCCTTCTGCACATTGGGGGCGG - Exonic
1147139642 17:38453917-38453939 GGCCTGGGGCGTACTGGGGCCGG + Intronic
1148547690 17:48530063-48530085 GACCTGGTGTGCATGGGGGATGG - Intronic
1150626089 17:66842084-66842106 GGCATGGTGGGCAGTGGGGCCGG - Intronic
1156718762 18:40044374-40044396 GCCAAGGTGGGCATTGGGGATGG + Intergenic
1158451456 18:57569700-57569722 GCCCTAGTGAGCATGGGGGTGGG - Intronic
1159135816 18:64335621-64335643 CCCCTGGAGGGCATTGAGGCTGG + Intergenic
1159947640 18:74456520-74456542 GCTCTGGAGCGCAGGGGGGCCGG + Intronic
1160272167 18:77397148-77397170 GCTCTGGTGGGCACTGGGGGTGG + Intergenic
1160953473 19:1678881-1678903 GCCCTGGTGGGCCTTGGTGCTGG + Intergenic
1161696442 19:5771215-5771237 GCCCTGGGGGCCAGTGGGGCTGG - Intronic
1162435107 19:10653630-10653652 ACCCGGGCGCGCATTGGCGCCGG + Intergenic
1162478698 19:10915725-10915747 GGCCAGGTGCTCCTTGGGGCAGG + Intronic
1163547358 19:17948164-17948186 GCCGCAGTGCGCATGGGGGCGGG + Intergenic
1163797666 19:19346653-19346675 ACCCTGGTTCCCAGTGGGGCTGG - Intronic
1166829467 19:45630099-45630121 GCCTTGGTGGGCATGGGGGGAGG - Intronic
1167150582 19:47707099-47707121 GCCCTGATGTGCAGTTGGGCAGG - Intergenic
1167395327 19:49224660-49224682 GCCCTGGAGCAACTTGGGGCTGG - Intergenic
1167461052 19:49624985-49625007 GCCCAGGTGGGCACTGGGGCTGG + Exonic
1167523130 19:49968915-49968937 GCCCAGGTGGTAATTGGGGCTGG + Intergenic
927215482 2:20666147-20666169 GCCCTGGGGCGCACTCGCGCGGG - Intergenic
927442335 2:23128061-23128083 GCCCTGCTGGGCTCTGGGGCTGG - Intergenic
930781178 2:55225699-55225721 CCCCTGGCACGCAGTGGGGCTGG - Intronic
932339855 2:70956365-70956387 GCCCTGGAACCCATGGGGGCAGG - Intronic
933188299 2:79303431-79303453 CCCCTGGAGCTCATTAGGGCAGG - Intronic
940350234 2:152676702-152676724 GCCATGGTGCTCATTGTGGTCGG + Exonic
944119679 2:196227583-196227605 GCTCTAGTGGGCAGTGGGGCTGG - Intronic
947113953 2:226749354-226749376 GCCCTGGTGAGTATTGCTGCTGG - Intronic
948061848 2:235048001-235048023 TGCATGGGGCGCATTGGGGCGGG + Intronic
1173551292 20:43934660-43934682 GCCATGGAGGGCTTTGGGGCAGG + Intronic
1174395511 20:50244506-50244528 GCCCTGCTGGGGATTGAGGCTGG + Intergenic
1174407305 20:50310625-50310647 GCCCAAGTGGGGATTGGGGCAGG + Intergenic
1175150263 20:56928249-56928271 GCCCTGGTGGGGATGGGGGAGGG + Intergenic
1175226029 20:57444554-57444576 GCCCTGGGGCGCCCTGGGCCTGG - Intergenic
1175852220 20:62099666-62099688 ACGCTGGTGAGCATCGGGGCTGG - Intergenic
1175900978 20:62359828-62359850 CCCCTGGTGTGCGGTGGGGCAGG - Intronic
1176075921 20:63248179-63248201 GCACAGGTGGGCACTGGGGCAGG - Intronic
1181752802 22:25001484-25001506 GGCCTGGTCCACATTGGGGCAGG - Intronic
1184334010 22:43842650-43842672 ACCCTGGAGCGCCTTGGGGTGGG - Intronic
950655864 3:14435831-14435853 GGACTGGTGCCCACTGGGGCTGG - Intronic
951394679 3:22151186-22151208 CCCCTGGAGTGCATTGGGGCTGG + Intronic
952847919 3:37703971-37703993 TCCTTGGTGAGTATTGGGGCTGG + Intronic
954809305 3:53238377-53238399 TCCTTGGTGAGCCTTGGGGCAGG - Intronic
964305897 3:155339337-155339359 GCCATGGTGGGCCCTGGGGCAGG + Intergenic
968758038 4:2426933-2426955 GCCCTGGGGCGCCTGGGGGATGG - Intronic
969835075 4:9833871-9833893 GCCCTGGTGGGCATTTGAGCAGG + Intronic
984601326 4:181730193-181730215 GCCCATGTGCACTTTGGGGCAGG + Intergenic
985197155 4:187443571-187443593 GCCCTGGGGCGATTTAGGGCAGG + Intergenic
986318965 5:6612264-6612286 GCCCTGGTGTGCATTGGAATGGG - Intronic
987034997 5:14011072-14011094 GCCTCGGTGCGCATCGGAGCAGG - Intergenic
988610036 5:32714389-32714411 GCCCTGGTGGGCCTGGGGACTGG + Intronic
989469464 5:41798377-41798399 GCACTATTGAGCATTGGGGCTGG + Intronic
991610941 5:68449047-68449069 GACCTGGTGTGCAGTGGGCCAGG - Intergenic
997425760 5:133801632-133801654 GCCCTGGCTGGCAGTGGGGCGGG - Intergenic
998729214 5:145054571-145054593 GCCCTTGTGGGCATAGGGCCTGG - Intergenic
999384572 5:151145167-151145189 GCCCTGGGGCTCTGTGGGGCTGG + Intronic
1001527384 5:172438362-172438384 GCCCTGGGGGCCCTTGGGGCAGG + Intronic
1002576637 5:180177621-180177643 GCCCTGGTGCCACTTGGGGAAGG + Intronic
1003066956 6:2911997-2912019 GCCATGGTGCTCATAGGGACAGG - Intergenic
1006300524 6:33191598-33191620 GCTCTGGGGAGCACTGGGGCTGG - Intronic
1007323450 6:41043183-41043205 GCCCTGGTACCCAATGGGGTGGG + Intronic
1007634193 6:43288013-43288035 GCCCTGGTGGGCATGGGGTGGGG + Exonic
1007725752 6:43914769-43914791 GCTCTGGTGAGTGTTGGGGCTGG - Intergenic
1010428285 6:75749580-75749602 GCCCTGGGCAGCAGTGGGGCCGG + Intronic
1010775134 6:79876853-79876875 GACCTGGTGCTCATTGAGGAAGG + Intergenic
1023930286 7:44701165-44701187 GCCCTGGTGCTTCTTGGTGCTGG + Intronic
1029627522 7:101729639-101729661 ACCCTGGTGCACACTGGGGGTGG + Intergenic
1031584482 7:123517990-123518012 GCCCTGGTGGGCATTCAAGCTGG - Intronic
1033602448 7:142897939-142897961 GCCCTGGTGGTGGTTGGGGCAGG + Intergenic
1034242491 7:149621234-149621256 GCCCTGGGGCGCCCTGGGGTTGG - Intergenic
1034441362 7:151087437-151087459 GCCCTGCTCCGCAGTGGGGCGGG + Intronic
1034547023 7:151795676-151795698 GGCCTGCTGCGGATTGGGGGAGG - Intronic
1034581114 7:152043440-152043462 GCCCTGGTTTGAAATGGGGCCGG + Intronic
1035282115 7:157784934-157784956 GGCCAGGTGAGCAGTGGGGCTGG + Intronic
1035826451 8:2649189-2649211 GCCCAGGTGTGCACTGAGGCAGG - Intergenic
1036680817 8:10872006-10872028 GCCCTGGGGAGCAATGGGGCTGG + Intergenic
1037579740 8:20237271-20237293 GCCCTGGTGCCCGTGGGGGTGGG + Intergenic
1037886117 8:22597367-22597389 GCCCTGGCGGGCACGGGGGCAGG - Intronic
1038733644 8:30149912-30149934 GCCCTGGTTTGGAATGGGGCCGG + Intronic
1039765129 8:40620351-40620373 GCCCTGCCGCGCTTTGGGGAAGG - Intronic
1044564631 8:93649628-93649650 GCCCTGGTGGTGCTTGGGGCTGG + Intergenic
1044730691 8:95226454-95226476 GCCCTGGGGTGGAGTGGGGCTGG - Intergenic
1055500899 9:76901356-76901378 GCCCTGGTTTGCAATGGGGCAGG + Intronic
1056667012 9:88589185-88589207 GCCCTGCTGGGCTGTGGGGCAGG + Intergenic
1059104687 9:111501351-111501373 GCCCTGGTCCACAGTGGGGCTGG - Intergenic
1061475450 9:130862859-130862881 GGCTTGTTGCGCTTTGGGGCTGG - Exonic
1062095530 9:134701351-134701373 GCCCTGGTGGGCACAGGGGTTGG - Intronic
1062533702 9:137012528-137012550 GCCCTGGTGCCAAATGAGGCTGG + Exonic
1062612887 9:137382948-137382970 GCCCGGGTGGCCACTGGGGCAGG - Intronic
1190911394 X:54775282-54775304 GCCCTGGTGGGCATGGGATCGGG - Intronic
1190919824 X:54840933-54840955 GCCCTGGTGGGCATGGGGTGGGG + Intergenic
1192967467 X:76194809-76194831 GACCTGATGGGCATGGGGGCAGG - Intergenic
1193715903 X:84934590-84934612 GCCCTGCTGAGCAGTGGGGCTGG - Intergenic