ID: 1128260731

View in Genome Browser
Species Human (GRCh38)
Location 15:66231227-66231249
Sequence CCCCCACCATCCCCCAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 477}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128260724_1128260731 -5 Left 1128260724 15:66231209-66231231 CCCTACTTCACACCCCAACCCCC 0: 1
1: 0
2: 1
3: 47
4: 572
Right 1128260731 15:66231227-66231249 CCCCCACCATCCCCCAAGGCAGG 0: 1
1: 0
2: 3
3: 45
4: 477
1128260723_1128260731 13 Left 1128260723 15:66231191-66231213 CCTGCAGGTAAAGAGGAGCCCTA 0: 1
1: 0
2: 1
3: 6
4: 106
Right 1128260731 15:66231227-66231249 CCCCCACCATCCCCCAAGGCAGG 0: 1
1: 0
2: 3
3: 45
4: 477
1128260725_1128260731 -6 Left 1128260725 15:66231210-66231232 CCTACTTCACACCCCAACCCCCA 0: 1
1: 0
2: 2
3: 114
4: 829
Right 1128260731 15:66231227-66231249 CCCCCACCATCCCCCAAGGCAGG 0: 1
1: 0
2: 3
3: 45
4: 477

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128260731 Original CRISPR CCCCCACCATCCCCCAAGGC AGG Intronic
900174537 1:1285968-1285990 CCACCACCACCACCCAAGGAGGG + Exonic
900291852 1:1927068-1927090 CACCCACCATCGGCCCAGGCCGG + Intronic
900431677 1:2605783-2605805 CCCCCACCATCACTCGGGGCAGG - Intronic
900568965 1:3349011-3349033 CCCCCACCCCCACCAAAGGCAGG - Intronic
900614789 1:3560648-3560670 CACCCAGCCTCCCCCAAGCCTGG - Intronic
900765337 1:4501130-4501152 CCCCCCCCATATCCCAAGGTAGG - Intergenic
901018877 1:6245997-6246019 CCCCCAGCCTCCCCCAACCCGGG + Intergenic
901083643 1:6597647-6597669 GCCCCACCATCCCCCCAGACAGG - Intronic
901233089 1:7652051-7652073 CCCCCACCATACCCCAAATGAGG + Intronic
901293078 1:8139851-8139873 CCCACACCATCCCCCACTGTTGG - Intergenic
902519675 1:17009050-17009072 CCCGCACCAACCCACAAGGTGGG + Intronic
902922065 1:19672034-19672056 CCTCCACAATCTCCCAAGGATGG - Intronic
903124695 1:21239658-21239680 CAGCCCCCAGCCCCCAAGGCTGG - Intronic
903365857 1:22805106-22805128 CCCCCACCACCTCCCAGGGCTGG + Intronic
904464299 1:30698768-30698790 CACCCACCCTGGCCCAAGGCGGG + Intergenic
904771027 1:32881513-32881535 CCCCCTCCATCCACCAAAGGAGG - Intergenic
904884520 1:33726268-33726290 CCCTCCCCAGCCCCCAAGGAGGG - Intronic
905478710 1:38246737-38246759 CGCCATCCATCCCCCCAGGCTGG + Intergenic
905515448 1:38558906-38558928 CCCCCTCCCTTCCCCCAGGCAGG + Intergenic
906188596 1:43880977-43880999 CACCCATTATCCACCAAGGCAGG + Intronic
906613559 1:47219916-47219938 CCCCCACCAGCCCCCACCACAGG + Exonic
906673989 1:47679976-47679998 CCTCCACCACCCCTCAAGGCTGG + Intergenic
908497211 1:64706570-64706592 GCCCCAGCCTCCCCGAAGGCAGG - Intergenic
910219637 1:84877323-84877345 TACCCAGCATCCCCCATGGCTGG - Intronic
912037096 1:105331673-105331695 CCACCACCACCCCCCAACCCTGG - Intergenic
912450337 1:109764271-109764293 CCCACAGCTTCCCCCAAGCCTGG - Intronic
912542295 1:110426098-110426120 CCCCTGCCATCCCCCAACCCAGG - Intergenic
912568364 1:110605155-110605177 CAGCCACCTTCCCCCAATGCAGG - Intronic
912637016 1:111305521-111305543 CCACCACTAAGCCCCAAGGCAGG - Intronic
912703535 1:111895703-111895725 CCCCCTCCACTCCCCACGGCAGG - Intronic
913335255 1:117703766-117703788 CCCACTCCACCCCACAAGGCTGG + Intergenic
913460740 1:119083372-119083394 CCCTCACCACACACCAAGGCTGG + Intronic
913531998 1:119740253-119740275 CACCCACCAGGCACCAAGGCAGG + Intronic
914846842 1:151288182-151288204 CCCTCACCCTTGCCCAAGGCAGG - Exonic
915292025 1:154890933-154890955 CCCCCACCACCCCCAATAGCTGG + Intergenic
915606599 1:156955867-156955889 CTGCCACTGTCCCCCAAGGCTGG + Intronic
915912299 1:159922801-159922823 GCCCCCCAACCCCCCAAGGCAGG + Intronic
915912323 1:159922876-159922898 CCCCCTCCACCGCCCAACGCTGG + Intronic
916378429 1:164181998-164182020 CTCCACTCATCCCCCAAGGCTGG - Intergenic
916603995 1:166323282-166323304 CCACCACCATCTCCAATGGCGGG + Intergenic
916674397 1:167053950-167053972 CAGCCCCCACCCCCCAAGGCTGG + Exonic
916683043 1:167121567-167121589 CTCCCTCCACCCTCCAAGGCTGG - Intronic
916951147 1:169781533-169781555 CCCCCACCTACCCCCAATCCTGG - Intronic
917375562 1:174349062-174349084 CCCCCACCTCCCTCCAAGACGGG + Intronic
919471907 1:197989239-197989261 CCCCCATGGTCCCCCAGGGCCGG - Intergenic
919972921 1:202592304-202592326 CCTCCAGCATCTCCCAAGGCAGG + Exonic
920106392 1:203556330-203556352 CACCCCCCATCCCCCAACCCTGG - Intergenic
920438198 1:205961675-205961697 CTCCCACCATCCCCCAGCTCTGG - Intergenic
921601310 1:217109639-217109661 CTCCCACTAGCCCCCATGGCAGG - Intronic
921834423 1:219763004-219763026 GCCCCCCCACCCCCCAAGACAGG - Intronic
922196347 1:223363616-223363638 CCCCCGCCTTCCCCCGAGCCGGG + Exonic
922815610 1:228446700-228446722 CCCCCCCAACCCCCCAACGCTGG - Intergenic
1063296468 10:4811804-4811826 CCCACACCATTACCCAAGCCAGG + Intronic
1063371157 10:5523939-5523961 ACCCCACTATCCCCCTAAGCGGG + Intergenic
1063643194 10:7852087-7852109 CCCCCACCATCTCCCAGAGACGG + Intronic
1065046226 10:21749481-21749503 CCCCGCCCCTCCCCCAAGACAGG + Intergenic
1068867684 10:61911956-61911978 CCCCAACCCTCCACCAAGGAGGG + Intronic
1069769364 10:70887932-70887954 CCCCCACCCACCCCCGGGGCGGG - Intronic
1069883663 10:71609817-71609839 CCCCCACCAGTCCCCATGGTAGG + Intronic
1069916302 10:71789294-71789316 GCCCCACCATCCCTCAAGAAGGG + Intronic
1070580736 10:77717224-77717246 CCTCCACCATCCCCCAGGGAGGG - Intergenic
1072620242 10:97074827-97074849 CCCCCATCCTCTCCCAGGGCTGG + Intronic
1073491230 10:103854904-103854926 CCCCCACCATCCATCAAAGGCGG + Intronic
1073563248 10:104514932-104514954 CCCCCACCCTGCCCCCAGTCTGG + Intergenic
1075123064 10:119678477-119678499 CTCCCACTATTGCCCAAGGCTGG + Intergenic
1075159748 10:120012576-120012598 CCCCCACCAACCTCCAATCCCGG - Intergenic
1076068562 10:127468150-127468172 CCCCCAACATCCTCAAAGGCAGG - Intergenic
1076401186 10:130186534-130186556 ACCCCACCACCCCTCAAGGTAGG - Intergenic
1076765475 10:132630766-132630788 CCCCCACCACCGCACAGGGCAGG - Intronic
1077077049 11:706592-706614 CCCCCACCAAGCCCCAGAGCTGG - Intronic
1077111947 11:865838-865860 CCCCTACCAGCCCCCAGGGTGGG - Intronic
1077184640 11:1230703-1230725 CCCCCTCCAGCCCCCAGGCCAGG + Intronic
1077184652 11:1230727-1230749 CCCCCTCCAGCCCCCAGGTCAGG + Intronic
1077330779 11:1982984-1983006 CCGCCACCACCCCCCCAGCCTGG - Intronic
1077372756 11:2191185-2191207 CCCCGACCTTCCCGCCAGGCAGG - Intergenic
1077439177 11:2560224-2560246 ACCCCCCCATCCCCCAAGGATGG - Intronic
1077439220 11:2560338-2560360 CCCCCCCCATTCCCCCAGGATGG - Intronic
1077439252 11:2560420-2560442 CCCCCACCGTCCCCCCAGGATGG - Intronic
1077611063 11:3643204-3643226 TCCCCACCCTCCTCCAAGCCTGG - Intergenic
1077680774 11:4237942-4237964 CCCCCACCTCCCTCCCAGGCAGG - Intergenic
1077918390 11:6625616-6625638 GCCCCACCATCCCCCAACCCTGG - Exonic
1078508500 11:11968753-11968775 CCCCCACCCACACCCAGGGCGGG + Intronic
1079031545 11:16989915-16989937 CCAGCACCATCCCCCAAACCTGG + Intronic
1079654820 11:22974469-22974491 CCCCCACCTTCAACCAAGGAAGG - Intergenic
1082813619 11:57493950-57493972 CCATCACTATCCCCCAAGGCCGG + Intronic
1083148667 11:60776420-60776442 CCCCTACCATCTCCCAATGGAGG + Exonic
1083294692 11:61708935-61708957 CCCCTCCCATCACCCCAGGCAGG - Intronic
1083304341 11:61754816-61754838 CCCACACCTTCCCCCATCGCAGG - Intronic
1083891260 11:65596796-65596818 CCCACACCATACCCTAGGGCTGG - Intronic
1083891282 11:65596875-65596897 CCCACACCATACCCTAGGGCAGG - Intronic
1084065928 11:66704549-66704571 CCACCCCCACCTCCCAAGGCTGG + Intronic
1084360579 11:68666479-68666501 TCCCTGCCATCCTCCAAGGCTGG + Intergenic
1084377077 11:68784770-68784792 CCTCCACCACCCCCCAAAACAGG + Intronic
1084717919 11:70885264-70885286 CCCACTCCATCCCCCACGGAAGG - Intronic
1085518933 11:77127021-77127043 CCCTCTCCATCCTCCCAGGCTGG - Intergenic
1086122499 11:83316741-83316763 CCCCCACCTCCCTCCCAGGCGGG + Intergenic
1088139594 11:106599586-106599608 GTCCCATCCTCCCCCAAGGCTGG - Intergenic
1088250912 11:107859975-107859997 CCCACCCCAACCCCCAAAGCAGG - Intronic
1088612265 11:111589265-111589287 CACCCTCCATCCCCTAGGGCTGG - Intergenic
1089748226 11:120631875-120631897 ACCCCACCAAGCTCCAAGGCTGG - Intronic
1090078032 11:123591690-123591712 CCTCCTCCACCCCCAAAGGCGGG - Intronic
1090461558 11:126895724-126895746 CCCCCACCAGCTCCAGAGGCTGG - Intronic
1090476505 11:127026630-127026652 CTCCCACCATCCCCCAAACTTGG - Intergenic
1202813759 11_KI270721v1_random:38163-38185 CCGCCACCACCCCCCCAGCCTGG - Intergenic
1092200324 12:6578216-6578238 CCCCCACCATCCCCTACCCCTGG + Intronic
1092827407 12:12413715-12413737 CCCCCACCATCCTCCCGGACGGG + Intronic
1092955964 12:13550285-13550307 ACTCCACCATTCCCCAAGGAGGG + Exonic
1093966413 12:25331701-25331723 CTCCCAGCAGCCCCCAAGGGTGG + Intergenic
1095955339 12:47802686-47802708 CCCCAGCCATCCCCCCAGCCAGG - Intronic
1096080749 12:48830778-48830800 CCCACCCCATCTCCAAAGGCAGG + Intronic
1096496849 12:52043647-52043669 CTCCCCCCATCCCCAGAGGCCGG + Intronic
1096627634 12:52905097-52905119 TCCCCCCCATCCCCCGGGGCTGG - Intronic
1096848226 12:54419318-54419340 CCCCCGCCAGCCCCCTCGGCAGG - Exonic
1097278029 12:57826455-57826477 CCCCCACCATACCCCTAGGTGGG + Intronic
1099441770 12:82707615-82707637 TCCCTACCATTCCCCAAGTCAGG - Intronic
1100873887 12:98942233-98942255 CCCCCACCTCCCACCAAGACAGG - Intronic
1101309732 12:103565222-103565244 CCCCGACCAGCCCCCAGGGTGGG + Intergenic
1101788887 12:107910847-107910869 GCCCACCCATCCCCCCAGGCTGG - Intergenic
1102029219 12:109730393-109730415 CCCCCCCCCGCCCCCCAGGCAGG - Intronic
1102283103 12:111633991-111634013 CCCCCACTATACCCAAGGGCTGG - Intergenic
1102490565 12:113287642-113287664 GCCCCATCCTCTCCCAAGGCGGG + Intronic
1102573564 12:113842282-113842304 CCACCCCCATCCCCCAACCCCGG - Intronic
1103012905 12:117471150-117471172 CTCCCCTCATCCCCCAAGTCTGG + Intronic
1103048399 12:117758492-117758514 ACCACAGCATCCCCCAAGGTGGG + Intronic
1103082367 12:118035377-118035399 CCTCCATCATCACCCTAGGCAGG + Intronic
1103240917 12:119412765-119412787 CCCCCCCCACCCCCCCATGCAGG + Intronic
1103281789 12:119764120-119764142 CCCCGACCACCCACCAAGGTGGG + Intronic
1103817683 12:123671626-123671648 CCCCCACCCTCCCCAAAAGAGGG - Intronic
1104894875 12:132159198-132159220 CGCCCAGCACCCCCCAAGACAGG - Intergenic
1106312834 13:28568698-28568720 CCCTCACCATCCCCCGAGCTGGG + Intergenic
1107222775 13:38005429-38005451 TCCCCACCAACCCCCATGACAGG + Intergenic
1108263272 13:48679244-48679266 CTCCCCTCATTCCCCAAGGCTGG + Intronic
1109392271 13:61708539-61708561 CCCACACCACCCCACAATGCTGG - Intergenic
1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG + Intronic
1114428015 14:22638011-22638033 CCCCCACCATCCTCCCGGACGGG - Intergenic
1115336841 14:32250581-32250603 CCCCCACCACCCCCAATGTCAGG - Intergenic
1115437086 14:33387348-33387370 CCAACTCCATCCCCCAATGCTGG + Intronic
1117105784 14:52395780-52395802 CACCCACCTACCCCCAAGGATGG + Intergenic
1118338794 14:64878482-64878504 CCCCCACTATAACCCAAGGCAGG - Intronic
1118839998 14:69502711-69502733 CCCCCAGCATCTCCCAAGGAAGG - Intronic
1119242689 14:73074565-73074587 CCCCCACCTCCCCACAAGACAGG - Intronic
1119422692 14:74516974-74516996 CCTCCACCATCCTCCAGGGCTGG - Intronic
1119426153 14:74535790-74535812 CCCCCACCACTCCCCAAAGCTGG + Intronic
1119956890 14:78808489-78808511 CACCTACCATCACCCAAAGCTGG - Intronic
1120828544 14:88977259-88977281 CAGCTACCAACCCCCAAGGCTGG - Intergenic
1121314467 14:92952931-92952953 CCCACGACTTCCCCCAAGGCTGG + Intronic
1121536437 14:94694364-94694386 TCCCCACCCTCCCTCAAGACTGG + Intergenic
1121674200 14:95739348-95739370 CCCCCACCATCCCCTACCCCTGG + Intergenic
1122305467 14:100763276-100763298 CCCAAACCATCCCCCAACCCTGG - Intergenic
1122383285 14:101325802-101325824 ACCCCTCCCTGCCCCAAGGCAGG + Intergenic
1122546876 14:102527950-102527972 CCCTCCCCATCCCACAGGGCAGG - Intergenic
1122986521 14:105214147-105214169 GCCCCAGGATCCCCCCAGGCTGG - Intronic
1202852296 14_GL000225v1_random:29610-29632 TCCCCACCACCCTCCCAGGCCGG + Intergenic
1202858485 14_GL000225v1_random:65377-65399 TCCCCACCACCCTCCCAGGCCGG - Intergenic
1202923224 14_KI270724v1_random:3370-3392 TCCCCACCACCCTCCCAGGCCGG - Intergenic
1123948837 15:25251799-25251821 CACCCACCATGCCCAAGGGCAGG + Intergenic
1124355732 15:28993513-28993535 CCTCCACCCTCCGCAAAGGCTGG + Intronic
1124383383 15:29186312-29186334 CTCCCTCCTTCCCCCAATGCAGG - Intronic
1124637542 15:31374634-31374656 CGTCCACCGTTCCCCAAGGCAGG + Exonic
1125499719 15:40232034-40232056 CCCCCACCATCCCCCATCTGTGG - Intergenic
1125645266 15:41267167-41267189 CCACCACCATCCCCCAGCCCTGG - Intronic
1125861663 15:43005405-43005427 CCCCCACCTCCCTCCAAGACAGG - Intronic
1127147427 15:56038943-56038965 CTCCCACCTTCCCCCAACACTGG + Intergenic
1127831109 15:62752359-62752381 CCCACACATTCCCCAAAGGCAGG - Exonic
1128083047 15:64867568-64867590 CCCCCACCAGCAGCCATGGCTGG + Exonic
1128260731 15:66231227-66231249 CCCCCACCATCCCCCAAGGCAGG + Intronic
1128527383 15:68421695-68421717 CCCCCACCCCCCACCCAGGCTGG - Intronic
1129161812 15:73751950-73751972 CCCCCACCTTCCCCCCAGCCAGG + Intronic
1129515173 15:76152897-76152919 CCCCCACCATCAGCTAAGGTAGG - Intronic
1129684385 15:77676955-77676977 CCCCCACCATGGCCCCTGGCAGG + Intronic
1129960767 15:79682052-79682074 CAGCCACCATCCCCCAGTGCTGG - Intergenic
1132648563 16:1010221-1010243 CCCCCACACTCCCCTCAGGCCGG - Intergenic
1132896708 16:2232654-2232676 CCCGCCTCATCCCCCAAAGCTGG - Intronic
1133344623 16:5061659-5061681 CCCCCACCCTCTCCCAGGCCTGG - Intronic
1133494203 16:6300787-6300809 CCACCACCACCTCCCAAGTCAGG + Intronic
1133809757 16:9152306-9152328 CTCCCACCACCCCACTAGGCTGG + Intergenic
1134112231 16:11522824-11522846 ACCCCCAGATCCCCCAAGGCTGG - Intronic
1136179121 16:28538856-28538878 CCCCCAGCAGCCCCCAGGCCCGG - Exonic
1136919010 16:34245970-34245992 CCCCCACCTCCCTCCCAGGCGGG + Intergenic
1137613591 16:49834775-49834797 CCCCCAGCATCCCCTGGGGCGGG - Intronic
1137673203 16:50291316-50291338 GCCCCACCATCCCCACCGGCTGG - Intronic
1137676441 16:50305892-50305914 CCCCCACCCTACCCCAGGCCTGG - Intronic
1138278437 16:55753902-55753924 CCCCCTCCATCCCACCAGTCAGG + Intergenic
1138553067 16:57757697-57757719 CCCCCTCCTGCTCCCAAGGCAGG + Intergenic
1139429797 16:66905044-66905066 CCCCCACCACCCCTTAAGTCAGG + Intergenic
1139614205 16:68079270-68079292 CCCCTACCCTCACCCACGGCTGG + Exonic
1139633785 16:68245880-68245902 CCCCCACCATCCCTCAGGAGTGG - Intronic
1139853193 16:69962722-69962744 TCCCCACCATCCCCACAGGCTGG + Intronic
1139882164 16:70185630-70185652 TCCCCACCATCCCCACAGGCTGG + Intronic
1140161202 16:72496879-72496901 CCCCCACCATCCTCCCGGACGGG - Intergenic
1140262083 16:73389159-73389181 CACCCAGCATCCTCCAAAGCAGG + Intergenic
1140370344 16:74409874-74409896 TCCCCACCATCCCCACAGGCTGG - Exonic
1140479600 16:75255390-75255412 CTGACACCATCCCCCTAGGCTGG + Intronic
1140765192 16:78150766-78150788 CCCTCCTCTTCCCCCAAGGCGGG + Intronic
1141552867 16:84817826-84817848 CCCCCAACAACCCTCCAGGCTGG - Intergenic
1141601022 16:85126523-85126545 TCCCCACCATCCACGAGGGCAGG + Intergenic
1141715862 16:85726516-85726538 CCCCCAGGATCCCCGCAGGCAGG + Intronic
1141930645 16:87200253-87200275 TCCCCTCCATCCCCCAGTGCTGG + Intronic
1142265679 16:89063074-89063096 CCCCCACCTGCCCCCACCGCCGG + Intergenic
1142728244 17:1831956-1831978 CCCCCACTACCGCCCCAGGCTGG + Intronic
1142847487 17:2689336-2689358 CCCTCACCATCCACCCAGACCGG + Intergenic
1143107812 17:4538237-4538259 CTGCCACCACCCCCCAAGCCAGG + Exonic
1144418007 17:15069939-15069961 TCCCCACTATACCCAAAGGCTGG + Intergenic
1144875763 17:18396313-18396335 TCCCCCCCACCCCCCCAGGCTGG - Intergenic
1145156465 17:20548108-20548130 TCCCCCCCACCCCCCCAGGCTGG + Intergenic
1145254950 17:21317308-21317330 GCCCCCCCCTCCCCCGAGGCCGG + Intergenic
1147017787 17:37506364-37506386 CTACCCCCATCCCCCAAGCCAGG + Intronic
1147241799 17:39095373-39095395 CCCCCCCAACCCCCCAAGCCTGG + Intronic
1147657006 17:42096777-42096799 CCCCCGCCCCCGCCCAAGGCAGG - Intergenic
1147685429 17:42284132-42284154 CTCCCTCCACCCCCCAAGGAAGG + Intergenic
1147741322 17:42672387-42672409 CCCCCACCCTCCCACAGGTCCGG - Exonic
1148017403 17:44531787-44531809 CCCCCACCATTCCCCAGGTATGG - Intergenic
1148087678 17:45004252-45004274 CCTCCAACATCCCCTAATGCGGG - Intergenic
1148157336 17:45431689-45431711 CCCCTACCATCGCCCTGGGCGGG + Intronic
1148218968 17:45849230-45849252 GCCCCCACATCCCCCAAAGCAGG + Intergenic
1148577623 17:48722863-48722885 CCCTGACCCTCCCCCCAGGCTGG + Intergenic
1148694275 17:49549657-49549679 CCCGCACCATTCCCTAGGGCCGG - Intergenic
1149431282 17:56596778-56596800 CCCCCCCAACCCCCCAAGTCCGG + Intergenic
1150283642 17:63943680-63943702 CCCCCATCAGTCCCCTAGGCAGG + Intronic
1150429176 17:65101696-65101718 CAGCCCACATCCCCCAAGGCTGG - Intergenic
1151772513 17:76173644-76173666 CCCCCAGCCTCCCCAAAGGAAGG + Intronic
1152020351 17:77777002-77777024 CCCCCACCATCCTCCCGGACGGG - Intergenic
1152244110 17:79176376-79176398 CCCCCAGCACCCCCCAAGCAGGG + Intronic
1152267620 17:79305473-79305495 CCACCTCCATTTCCCAAGGCAGG + Intronic
1152524065 17:80877272-80877294 CCCCCACCCTCCCCGCAGGCAGG - Intronic
1152721333 17:81925151-81925173 CCTCCTCCAGCCCTCAAGGCTGG + Intronic
1152853616 17:82651081-82651103 CGCCCACCCTTCTCCAAGGCAGG + Intergenic
1154351774 18:13589609-13589631 CTCCCACCTTTCCCCCAGGCTGG + Intronic
1155177299 18:23312193-23312215 CCCCCACCATACCCACAGCCTGG + Intronic
1156901246 18:42302526-42302548 CCCTCACCAGACCCCAAGGCCGG - Intergenic
1157288671 18:46394499-46394521 CCTCCACCTTCCCCCCAGCCAGG + Intronic
1157801826 18:50627181-50627203 CCCAAGCCATTCCCCAAGGCTGG - Intronic
1157828467 18:50834115-50834137 CACTCCCCAGCCCCCAAGGCAGG + Intergenic
1158478621 18:57802477-57802499 CCCCCTCCATCCCTCCCGGCAGG + Intronic
1160536399 18:79596741-79596763 CCACCACCAACCTCCCAGGCTGG - Intergenic
1160694169 19:474591-474613 TCCCACCCATCCCCCACGGCTGG + Intronic
1160912588 19:1481777-1481799 CCCCCACCAAACCCCAGGTCTGG - Exonic
1161438299 19:4277154-4277176 CCCCGACCCTACCCCAAGGAGGG - Intergenic
1161719788 19:5896411-5896433 CCCCCACCCTCCTCCCAGCCTGG - Intronic
1161851799 19:6740988-6741010 CCCCCACCATGTCCCATGTCAGG + Exonic
1162084622 19:8240997-8241019 ACCCCACCCGCCCCCAAGCCTGG - Intronic
1162140172 19:8580722-8580744 CCCTCTCCATCCCCCCAGCCAGG + Exonic
1164186172 19:22871583-22871605 CCCCCACCTCCCTCCCAGGCGGG + Intergenic
1164512804 19:28911448-28911470 CCCACACCAGCCCCCAGGGATGG + Intergenic
1164694611 19:30233950-30233972 GCCCTACCAGCCCCCAAGCCTGG - Intronic
1164980953 19:32614054-32614076 ACCCCACCATCCCCAACCGCTGG - Intronic
1165101708 19:33442255-33442277 CCCCCACCCTCCACCATGCCCGG - Intronic
1165355576 19:35301894-35301916 CCCCCGGCATTCCCCACGGCTGG + Intronic
1165386782 19:35514524-35514546 CCCCACCCATCCCCCAGGCCAGG + Intergenic
1165486738 19:36101052-36101074 CCCCCTCCTTCCCCCAGGTCAGG - Intronic
1165489119 19:36113218-36113240 CCCTCTCCATCCCCCAGGGGAGG + Intronic
1165751945 19:38265366-38265388 CCCCCACCATCTCACAGGCCTGG - Intronic
1165938254 19:39402777-39402799 CCCCTCCCCTCCCCCTAGGCCGG + Intergenic
1166094909 19:40532330-40532352 TCCCCACAAGCCCCCAAGGCAGG - Intronic
1166112834 19:40633485-40633507 CCCTAACCACCCCCCAAGGCTGG - Intergenic
1166250376 19:41565324-41565346 CCCCGCCCCTTCCCCAAGGCAGG - Intronic
1166556041 19:43700407-43700429 CCCCCACCATGGGCCAAGACGGG + Intergenic
1166734535 19:45076229-45076251 GCCCCAACAGGCCCCAAGGCTGG - Exonic
1167120616 19:47514465-47514487 CTCCCTCCGTCCCCCCAGGCCGG + Intronic
1167721816 19:51184830-51184852 CCCCCTCCCTCCCCCAGAGCAGG - Intergenic
1168173815 19:54608460-54608482 CCCACATCATCCCCCAGGCCTGG - Intronic
1168293539 19:55368616-55368638 CTCCCTCCATCCCCCACGCCAGG + Intronic
1168451458 19:56469661-56469683 CCCCCACCACCCTTCACGGCTGG + Intronic
925171781 2:1754586-1754608 CCCCCACCAGCCAGCATGGCAGG - Intergenic
925487315 2:4349774-4349796 CCCCCACCCTCCTCCAATGTGGG - Intergenic
925976657 2:9146580-9146602 CCCTCCCCATCCCCCAAGTCTGG + Intergenic
926007906 2:9387061-9387083 CCCCCACCCACCACCAAGCCCGG - Intronic
926033441 2:9613665-9613687 CCACCACCATCCCACAACCCAGG + Intronic
927869751 2:26615995-26616017 CCCCCACCGCCCCCCAGCGCTGG - Intronic
928177990 2:29047910-29047932 CCCCCACCCCCACCAAAGGCTGG - Intronic
928533262 2:32214076-32214098 GCCCCACCATGCCCCACGTCTGG + Intronic
928925849 2:36578519-36578541 CTGCCACCAGCCCCAAAGGCTGG + Intronic
929739902 2:44589116-44589138 CCCCCACCACCCTCCCAGACGGG - Intronic
929765575 2:44841190-44841212 ACCCCACCACCACCCAATGCTGG + Intergenic
931488298 2:62716182-62716204 CCCCCACCACGCCCCAACCCGGG + Intronic
931667141 2:64617654-64617676 CCCCCACCATTCCCCATAGTGGG + Intergenic
932462379 2:71891298-71891320 TCCCCACTGTCCCCCAAGGCAGG - Intergenic
932812406 2:74835588-74835610 CCACCCCCATACCCCGAGGCGGG - Intronic
932903136 2:75723292-75723314 CCCTCACCATCTCCCTTGGCAGG + Intergenic
933729502 2:85446268-85446290 CCCACCCCATCCCCCAAGCAAGG - Intergenic
934518921 2:95007212-95007234 CCCCCACCACCCCCCACTCCAGG + Intergenic
935630466 2:105210300-105210322 CCCCCACCATCCTCCCGGACGGG + Intergenic
936639614 2:114297487-114297509 CTCATAGCATCCCCCAAGGCAGG + Intergenic
937272520 2:120662030-120662052 CTCCCAGCAGACCCCAAGGCTGG + Intergenic
937332216 2:121038659-121038681 CTCCAACCATCCCTCAAGGGTGG + Intergenic
938237353 2:129717198-129717220 CCCCTCTCATCCCCCAAGCCAGG + Intergenic
938289395 2:130141438-130141460 CCCCCAGAACCCTCCAAGGCAGG - Intronic
938413395 2:131084193-131084215 CCCCCACCCCACCCCAAGACAGG + Intronic
938467135 2:131531500-131531522 CCCCCAGAACCCTCCAAGGCAGG + Intronic
940918771 2:159286076-159286098 CGCCCCCCCTACCCCAAGGCAGG - Intronic
941564385 2:167088226-167088248 CCTGCACCATCCCCTAAAGCAGG + Intronic
945048399 2:205801418-205801440 CCCACCCCATCTTCCAAGGCTGG + Intergenic
945722049 2:213429359-213429381 CCACCACCTTCCCACAATGCTGG + Intronic
946128084 2:217581902-217581924 CTCTCAGCATCCCTCAAGGCTGG + Intronic
946320539 2:218951661-218951683 CCCCCACCCGCCCCCAATTCTGG + Intergenic
948595624 2:239077430-239077452 CCCCCGCTATCCTCCAGGGCAGG + Intronic
948659740 2:239499592-239499614 CCCTCACCTTCACCCAAGGAAGG - Intergenic
948915797 2:241034550-241034572 CCCCCACCCCACCCCCAGGCTGG + Exonic
1171861565 20:30405815-30405837 CCCCCACCTCCCTCCCAGGCAGG - Intergenic
1173182535 20:40815785-40815807 CCCCCTACTTCCCCCCAGGCAGG + Intergenic
1173531515 20:43773115-43773137 CTCCCACAGTCCCCCAGGGCAGG - Intergenic
1173729561 20:45318835-45318857 CCTCCACCACTCCTCAAGGCAGG + Intergenic
1173804020 20:45912228-45912250 CCCCTCCCAGCCCCCAAGGGAGG - Intergenic
1173846073 20:46189470-46189492 CCCCCACCACCCTCCACTGCAGG - Intronic
1174239616 20:49123026-49123048 CCGCCATCAGCCCCCAAGGCTGG + Intronic
1174298917 20:49568226-49568248 CCCCCACCCCGCCCCAAAGCGGG - Intergenic
1174431604 20:50473798-50473820 CCCTCACCATGACCCTAGGCGGG - Intergenic
1175206658 20:57316752-57316774 CCCCCACCACCCCTACAGGCTGG + Intergenic
1175219542 20:57409031-57409053 CCTCCACCAACCCCCAAGACAGG - Exonic
1175377678 20:58540590-58540612 CCCCCACTATCCCCCTACACAGG + Intergenic
1176146532 20:63567970-63567992 CCACCACCACCTCCCCAGGCCGG - Intronic
1176519077 21:7811643-7811665 CCCCCAGCACCCGCGAAGGCAGG - Intergenic
1178321187 21:31607074-31607096 CCCCCACCATCCCTCACCCCTGG + Intergenic
1178653105 21:34441656-34441678 CCCCCAGCACCCGCGAAGGCAGG - Intergenic
1179091676 21:38271698-38271720 GCCACACGATCCCCCAAGCCTGG + Intronic
1179584187 21:42364660-42364682 CCCCTCCTATGCCCCAAGGCAGG - Intronic
1179821681 21:43940662-43940684 CTCCCACTGCCCCCCAAGGCAGG + Intronic
1180074165 21:45454358-45454380 CAGCCACCCTCCCCCAGGGCTGG - Intronic
1180721729 22:17914392-17914414 TCACCACCATCCCGCGAGGCAGG + Intronic
1180854795 22:19039064-19039086 CTCCCACCATCCCCAGGGGCTGG + Exonic
1180911360 22:19453122-19453144 CCTCCCCCATCCCAGAAGGCTGG - Intronic
1180976651 22:19852292-19852314 CCCCCACCACCCACCAGTGCTGG - Exonic
1181038584 22:20181534-20181556 CCCCCAGCCTCCCCCATGGCAGG - Intergenic
1181087719 22:20450013-20450035 CCCACTCCATCCCCACAGGCTGG + Intronic
1181438048 22:22921739-22921761 CACACGCCATCCCCCAAGACAGG + Intergenic
1181495240 22:23283924-23283946 CCCCACCCATCACCCCAGGCTGG + Intronic
1182697465 22:32206520-32206542 CCCCGACCCTCCCCCACAGCTGG - Intergenic
1183258261 22:36777018-36777040 CCACAACCACCCCACAAGGCGGG - Intergenic
1183467108 22:37985315-37985337 CCCCTACCCTCTCCCAAGACAGG - Intronic
1184222452 22:43109903-43109925 CCCCCAATATACCCCAGGGCTGG + Intergenic
1184439253 22:44498434-44498456 CCCCCCCCACCCCCCAACTCGGG + Intergenic
1184690807 22:46116522-46116544 CCCCCACCATCCGCCCCGCCTGG + Intergenic
1184728299 22:46358598-46358620 CCCTCCCCAGCACCCAAGGCTGG + Intergenic
1185318713 22:50190451-50190473 CCCCCACCCTCCACCCAGCCTGG - Intronic
1185416869 22:50715390-50715412 CCCCCACCCTCACCCAGGGTCGG + Intergenic
950142464 3:10624928-10624950 CCCCCACCATGGCACCAGGCTGG + Intronic
950182962 3:10927916-10927938 CCTCCTCCCTCCCTCAAGGCAGG + Intronic
950230395 3:11271059-11271081 CCCCCACCCTCCCCAAAGGCAGG - Intergenic
950283146 3:11723987-11724009 CCCCCCCCATCCCCCACTGAGGG - Intergenic
950319980 3:12042626-12042648 CCCTCCCCATCCCCCAATTCAGG + Intronic
952043740 3:29292039-29292061 TTCACACCATCCCCCAATGCTGG + Intronic
952074638 3:29681501-29681523 CCCACACAATCCCCCCAGACAGG + Intronic
953533863 3:43762188-43762210 CCCCAACCACCCCACCAGGCAGG + Intergenic
954157513 3:48694773-48694795 CCCCCACCGTCCCCCCAGTGGGG + Intronic
954325039 3:49858958-49858980 GCCTCACCATTCCCCTAGGCAGG - Exonic
954361036 3:50123010-50123032 CCCCCACCATCCCCTAGTGTGGG + Intergenic
954529350 3:51304691-51304713 CCCCCACCACCAGCCAAGGGAGG - Intronic
956448623 3:69350817-69350839 CCCTCCCCACACCCCAAGGCAGG - Intronic
956463997 3:69500685-69500707 GCCCCCCCACCCCCCAAGCCAGG + Intronic
960780333 3:121313096-121313118 CCCCCACCACCCTCCCAGACGGG + Intronic
961453109 3:127011395-127011417 CCTGCAACAGCCCCCAAGGCAGG - Intronic
962737534 3:138339132-138339154 TTCCCACCACCCCCTAAGGCGGG + Intergenic
963200458 3:142580897-142580919 CCCCCACCATCTTACAAGACGGG - Intergenic
963911165 3:150820038-150820060 CCCCCACCATCCTCCCGGACGGG + Intergenic
965520195 3:169662941-169662963 CCCTCCCCTTCCCCCCAGGCGGG - Intronic
965669168 3:171128782-171128804 CCCCAACCTGCCCCCAAGGTCGG - Exonic
966868518 3:184275951-184275973 CCCCCACCCTCCCCCCACCCCGG + Intronic
967180215 3:186896863-186896885 CCCCCACCACATCCCAAGTCTGG + Intergenic
967881756 3:194306441-194306463 CCCACAGCATCCCCCACAGCGGG - Intergenic
967954799 3:194869820-194869842 CCCACAGCAGCTCCCAAGGCAGG - Intergenic
968311563 3:197687892-197687914 ACCCCACCATCCAGCAAGCCAGG + Intronic
968337346 3:197925153-197925175 CCCCCACCCTCCCCCACAGGGGG - Intronic
968484571 4:852809-852831 CGCCCAGCATCCCCCAGGGAGGG + Intronic
968664496 4:1813670-1813692 GCCCCACCAACCCCCAAGCCAGG + Exonic
969048538 4:4356350-4356372 CTCCCAGCATCCTCCACGGCAGG - Intronic
969516355 4:7650414-7650436 TCCCCAACATCCCTCAAAGCGGG + Intronic
973541627 4:51941207-51941229 CCCCCACAATCCCTCAAGGCTGG - Intergenic
973593690 4:52465537-52465559 CCCCCACCTTCCTCCCGGGCGGG - Intergenic
974672354 4:65048794-65048816 CCCCCCCCACCCCCCATGACAGG + Intergenic
975621177 4:76298388-76298410 CCCCCATCACCCTCCAAGGTAGG + Intronic
975686183 4:76918222-76918244 CCCCCACCATCCTCCCGGACGGG - Intergenic
975735528 4:77377311-77377333 CCCACACCGTCCTCCAAGGAAGG - Intronic
983190301 4:164747386-164747408 CCCCCACCTCCCTCCAAGACGGG + Intergenic
984181074 4:176482663-176482685 CTCCCACCAGCACCCAAGGAGGG + Intergenic
984837323 4:184033921-184033943 TCCACCCTATCCCCCAAGGCTGG + Intergenic
984905414 4:184621470-184621492 CCATCACCATCACCCAATGCAGG - Intergenic
986034862 5:3927760-3927782 CCCCTACCATCCTCCCAGCCAGG + Intergenic
986210946 5:5671772-5671794 CCCCCACCCTCCTCCCAGGTAGG + Intergenic
986300907 5:6477479-6477501 CCACCACCAAAACCCAAGGCTGG + Intronic
986412521 5:7494601-7494623 CCCCCACCATCTGCCAGGCCTGG - Intronic
986708676 5:10471729-10471751 CCCCCCACATCCCCCCAGGGAGG + Intronic
987038471 5:14040367-14040389 CCCCCAACATCCCCCCTTGCAGG + Intergenic
988616267 5:32778021-32778043 CCTCCAGCATCCCCCAACTCTGG - Intronic
989188912 5:38650613-38650635 CCCTCCCCCTCCCCCAAGCCCGG - Intergenic
989379849 5:40800880-40800902 CCCCCACCACCCTCCCAGACGGG - Intergenic
989379949 5:40801134-40801156 CCCCCACCACCCTCCCAGACGGG - Intergenic
989773784 5:45177774-45177796 CCCCCAACATCCCCAAATTCTGG + Intergenic
990509819 5:56480470-56480492 ACCCGCCCATCGCCCAAGGCAGG - Intronic
991774066 5:70067402-70067424 CCTCCACCACCCCCCATGCCAGG + Exonic
991853360 5:70942826-70942848 CCTCCACCACCCCCCATGCCAGG + Exonic
992262411 5:74984613-74984635 CCTCCACCATCCCCCAGGTGAGG - Intergenic
992615065 5:78539635-78539657 CCCACACCATCACCCAGGGATGG + Intronic
992616195 5:78548274-78548296 CCTTCTCCATGCCCCAAGGCCGG - Intronic
992747117 5:79830595-79830617 CCCCCACCCTGCCCCCAGGCAGG - Intergenic
992950994 5:81857748-81857770 CCTCCACCAGCCTCCTAGGCAGG - Intergenic
993026596 5:82654016-82654038 CCCCCACCTCCCCCCACCGCTGG - Intergenic
993877937 5:93329876-93329898 CAGCCACCATCCCCCAACTCTGG + Intergenic
997307576 5:132850489-132850511 CCCCCAACATCCACCATGCCTGG - Intergenic
997361322 5:133296926-133296948 CCAGCCCCAGCCCCCAAGGCAGG - Intronic
999596824 5:153214485-153214507 CCCCCACCCTCAGCCAAGGGAGG + Intergenic
1000159315 5:158582968-158582990 CCCCCACCACCCTCCCAGACGGG - Intergenic
1001642570 5:173254943-173254965 TCCCCCCCATCCCCCGGGGCTGG - Intergenic
1001663461 5:173413473-173413495 CCCCCACCATCCCCTCACCCAGG - Intergenic
1001748541 5:174110484-174110506 CACTCACCATCTCCCAAAGCCGG - Intronic
1001839972 5:174867087-174867109 CCCCCACCCAGCCCCATGGCAGG - Intergenic
1002082015 5:176743068-176743090 ACCCCACCATCCCCCAACACTGG + Intergenic
1002460391 5:179370385-179370407 CCCCCAAAGTCCCCCAAGGCAGG - Intergenic
1002559529 5:180071980-180072002 CCCCCTCCATCCCCCCGGGTCGG + Exonic
1003165293 6:3672045-3672067 CCTCCACCCTCACCCAGGGCTGG - Intergenic
1003311580 6:4973870-4973892 CCCCCACCACCCTCCATGGTAGG - Intergenic
1004874546 6:19939951-19939973 CCCCCACCTCCCTCCCAGGCGGG - Intergenic
1005577656 6:27205200-27205222 CCTCCACCATCCCCCAGGTAAGG + Intergenic
1005615971 6:27573726-27573748 CACCCACCATACCACTAGGCCGG + Intergenic
1005859194 6:29888259-29888281 CCCTCCCCATCCCCCACGGAGGG + Intergenic
1005931785 6:30490030-30490052 CCCTCCCCATCCCCCACGGACGG + Intronic
1006043183 6:31271542-31271564 CCCTCCCCATCCCCCACGGACGG - Intronic
1006300205 6:33190090-33190112 CCCACCCCATCCCCCAAACCTGG - Intronic
1006374333 6:33663587-33663609 CCCCCGCCTACCCCCAGGGCAGG - Intronic
1007784837 6:44273581-44273603 CTCCCACCTTCCCCCCAGGGAGG - Intronic
1007967161 6:46014028-46014050 CCCCCACCCCCACCCCAGGCTGG - Intronic
1008205757 6:48654357-48654379 CCCCAAGCATCCTCCAAGGTTGG - Intergenic
1009223591 6:61004015-61004037 CCCCCACCCTCCCCCAATATTGG - Intergenic
1011802756 6:91036419-91036441 ACCCCACCTTCTCCCAAGGATGG - Intergenic
1012978448 6:105805018-105805040 CTCCCACCATCCCCCAAGTTGGG - Intergenic
1013086374 6:106861346-106861368 CCCCCTCCATTCCCCAGGACTGG + Intergenic
1013346361 6:109264293-109264315 CCCCCACAAACCCCCAAGGAGGG + Intergenic
1014866525 6:126538175-126538197 TCCCCACCCTCCCCCAAGGCAGG + Intergenic
1015327716 6:131942684-131942706 CCCCCAACATCACCCAAAGATGG - Intergenic
1016879227 6:148894542-148894564 CCCCCTCCAAACCCCCAGGCAGG + Intronic
1019437530 7:1029734-1029756 CCCACACCATCTCCCCAGGCAGG - Intronic
1019477875 7:1252715-1252737 CCCACCCCCTCCCCCAGGGCAGG + Intergenic
1019732694 7:2636643-2636665 CCACCTCCACCCCCCAATGCAGG - Intronic
1019734706 7:2644965-2644987 GCCCCAGCAGCTCCCAAGGCTGG + Intronic
1019884802 7:3894433-3894455 CCCCCACCACCCCCGGAGCCTGG - Intronic
1020014396 7:4822346-4822368 CCCCCGCCAGCACCCCAGGCAGG - Intronic
1020153505 7:5702258-5702280 CTCCCAGCCTCCTCCAAGGCGGG + Intronic
1021440462 7:20669084-20669106 CCCCCACCATCCTCCCGGACGGG - Intronic
1021672201 7:23045930-23045952 CCCCCACCTTCCTCCCAGACGGG + Intergenic
1022512451 7:30948888-30948910 CACCCACCACCCCCAAAGGGAGG - Intronic
1022532673 7:31076732-31076754 CCCCCACCTACTCCCAAGGCAGG - Intronic
1022837315 7:34130636-34130658 ACTCCACCATGCCCCAGGGCTGG - Intronic
1022967514 7:35487288-35487310 CCCACACCATTGCCCAAGGGTGG - Intergenic
1023362759 7:39432683-39432705 TCCCCACCACCCCCCAACCCCGG - Intronic
1023401765 7:39796443-39796465 ACCCCACCATGCCCAAATGCAGG - Intergenic
1024051831 7:45628560-45628582 CCCCTGCCCTTCCCCAAGGCAGG + Intronic
1024056706 7:45664088-45664110 CCTCCACCAGCCCCCAGGGGAGG - Intronic
1024530839 7:50391448-50391470 CCACCACCATCACCAGAGGCTGG - Intronic
1024876422 7:54029214-54029236 TCCACACCAGCCCCCAAGGCAGG - Intergenic
1026245090 7:68612492-68612514 CCCCCACCCTACCCCCTGGCAGG + Intergenic
1026938966 7:74275654-74275676 CCCCCACCACCCAGCAAGGCAGG + Intergenic
1027614655 7:80406945-80406967 CCCCCAACACCCCCCATGACAGG + Intronic
1028580638 7:92406265-92406287 CCCCCACCATCCCTAACCGCTGG - Intergenic
1028995293 7:97093310-97093332 CCCCCACACTCCCCTGAGGCAGG - Intergenic
1029360093 7:100082012-100082034 CCGCCGCCCGCCCCCAAGGCCGG - Intronic
1029436297 7:100565831-100565853 CCCCCACCATCCCCAGAGCCTGG + Exonic
1029537936 7:101166759-101166781 CCCCCACCCCCGCCCACGGCTGG - Intergenic
1031690524 7:124782467-124782489 CCCTTCCCTTCCCCCAAGGCAGG + Intronic
1032002737 7:128275883-128275905 CCCCCACACTCTCCCAGGGCAGG - Intergenic
1032056081 7:128685312-128685334 CCCAGACCCTCCCTCAAGGCAGG - Intronic
1032582070 7:133112738-133112760 ACCCCACCCTACCCCAAGGTAGG + Intergenic
1033477015 7:141701727-141701749 CCCCCGCCCTTCCCCAAGCCCGG + Intronic
1035242459 7:157541157-157541179 CTCACACCGTCCACCAAGGCGGG - Intronic
1035354137 7:158266909-158266931 ACCCCACCACCCCTGAAGGCCGG - Intronic
1035737447 8:1898741-1898763 TCCCCTCTGTCCCCCAAGGCTGG - Intronic
1036735924 8:11316655-11316677 CCTCCATCTTCCCCCTAGGCTGG + Exonic
1036740313 8:11355201-11355223 CCCCCACCCTCCCTACAGGCAGG - Intergenic
1037463568 8:19137365-19137387 CCACCACTGTCCCCCAAGCCAGG + Intergenic
1037887068 8:22600815-22600837 CCCCCAGCATTCCTGAAGGCTGG - Intronic
1040572044 8:48619990-48620012 CTCCCACCATCACCCAGGCCAGG + Intergenic
1040900977 8:52416874-52416896 CTCCCACCAGACCCCAAGGCAGG - Intronic
1041679754 8:60576820-60576842 CCCCCACCATCCCTTAAGCTGGG + Intronic
1043184733 8:77133329-77133351 CTCACACCATCACCCAAAGCCGG + Intergenic
1043486639 8:80704587-80704609 CCCCCACCACCCCCAGAGGTTGG - Intronic
1044116562 8:88343170-88343192 CCCCCACCACCCCCCTTGACAGG + Intergenic
1044319982 8:90791318-90791340 GCCCGACCTTCCCCAAAGGCGGG - Intronic
1044449905 8:92322592-92322614 CCCCCACCAACCTCTAAGGAGGG - Intergenic
1045475320 8:102547538-102547560 CCCCTGCCATCCCCCTAAGCAGG - Intergenic
1045815585 8:106272243-106272265 CCCCCACTCTCACCCAACGCCGG - Intronic
1047266848 8:123315411-123315433 CCCCCACCTCCCTCCAAGACGGG - Intergenic
1047411554 8:124628515-124628537 CTCCCACCAGCCCCCACAGCAGG + Intronic
1048550903 8:135432916-135432938 CTCCCTCCCTCTCCCAAGGCTGG - Intergenic
1049148842 8:141021351-141021373 CCCTCACCCTCCACCAAGGCTGG - Intergenic
1049297438 8:141850195-141850217 CCCCCACCACCCCCCAGGGAAGG - Intergenic
1052816003 9:33102955-33102977 TTCCCACCTTCCTCCAAGGCGGG - Intergenic
1053405420 9:37871182-37871204 CCCCCACCTTCCCCAATAGCTGG - Intronic
1056126007 9:83537465-83537487 CGCGCTCCATCCCTCAAGGCTGG + Intronic
1057159935 9:92882422-92882444 CCCTCCCCACCCCCCAAGCCGGG - Intergenic
1057667202 9:97055393-97055415 CACCCACCATCCCCACAAGCAGG + Intergenic
1057853202 9:98581117-98581139 CAGCCACCATCCCCCACGGGAGG - Intronic
1058824103 9:108759440-108759462 CCCCCACCATCCCTCCTTGCTGG + Intergenic
1059392430 9:114007580-114007602 CCCCCAGAATCCTCCAGGGCTGG - Intronic
1060725649 9:126003934-126003956 CCCCCACCATACTCCAACTCAGG - Intergenic
1060757599 9:126224398-126224420 TTCCCTCCATCCCCCCAGGCTGG + Intergenic
1060787398 9:126461230-126461252 CCCCCACAACCGCCGAAGGCTGG + Intronic
1061619733 9:131804114-131804136 GCTCCACCATCCCCCAGGGCAGG - Intergenic
1061755406 9:132808924-132808946 TCCCCACCACTCCCCAAGCCAGG - Intronic
1061818341 9:133208989-133209011 CCTCCACCACCACCCCAGGCTGG + Intronic
1061913630 9:133737992-133738014 CCCCCACCACCCCCTGAGCCTGG - Intronic
1061948519 9:133922151-133922173 GCCCCACCACCTCCCAAGACTGG - Intronic
1062242110 9:135546369-135546391 CCTCCACCACCACCCCAGGCTGG - Intronic
1062314112 9:135957216-135957238 CCCCCAACATCCCCTCAGCCTGG - Intronic
1062431760 9:136529520-136529542 CCTCCTCCATCCCCCAGGGCTGG - Intronic
1062468198 9:136690775-136690797 CCCCGTCCAGCCCCCAAGCCAGG - Intergenic
1062630609 9:137461529-137461551 CACTCACCATCCACCATGGCGGG + Exonic
1186219682 X:7336243-7336265 CCCCCACCCGCCCCAAAGGAGGG + Intronic
1187390900 X:18886125-18886147 CCCACCCCATCCCCCGAGGAAGG + Intergenic
1187718448 X:22127724-22127746 CCCACACCATCCCCCACCTCAGG - Intronic
1188367459 X:29333285-29333307 CCCCCACCATCCTCCCGGACGGG + Intronic
1189106824 X:38245158-38245180 CCTCCACCATTCCCCAAGGGAGG - Intronic
1189740888 X:44116149-44116171 CCCCCAACAGTCCCCAGGGCTGG - Intergenic
1189837492 X:45040146-45040168 CCCCCACCATCCTCCCGGACGGG + Intronic
1192196621 X:69033022-69033044 CCCCCACCATCCCTCCAGCATGG + Intergenic
1192567966 X:72179334-72179356 CCCCCACCATCCTCCCGGACGGG - Intergenic
1192724009 X:73728701-73728723 TCCCTACCATCCACCAAGCCTGG - Intergenic
1194053414 X:89100796-89100818 CCACCCCCATCCCCCACGGTGGG - Intergenic
1194132633 X:90100709-90100731 TCCTCACCATCCCCCACGACAGG + Intergenic
1194133189 X:90106754-90106776 CCCCCACCCTCAGCCAAGGGAGG - Intergenic
1195306330 X:103586632-103586654 CCACCCCCATCCCCCAGGACAGG + Exonic
1195366945 X:104135463-104135485 GCACCACCATCACCCAAGCCTGG + Intronic
1195811150 X:108831613-108831635 CCCCTGCCATCACCCGAGGCTGG + Intergenic
1197252438 X:124229708-124229730 CCCTCTGCATCCCCCAAGGGTGG - Intronic
1197759034 X:130014995-130015017 CCCCCGCCATCTCCCCAAGCAGG + Exonic
1199711997 X:150476226-150476248 TCCCCACCCTCCCTCCAGGCTGG + Intronic
1200058277 X:153472741-153472763 CCCCCTCCCTCCCCCATGGTAGG - Intronic
1200478420 Y:3670788-3670810 TCCTCACCATCCCCCACGACAGG + Intergenic
1200787345 Y:7272607-7272629 CCCCCGCCATCCCCTGAGCCTGG - Intergenic