ID: 1128262129

View in Genome Browser
Species Human (GRCh38)
Location 15:66239834-66239856
Sequence ATTAACTCCCTTGCACCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128262129 Original CRISPR ATTAACTCCCTTGCACCTCC GGG (reversed) Intronic
904977006 1:34464390-34464412 ATCGATTCCCCTGCACCTCCTGG - Intergenic
908075846 1:60517111-60517133 ATTACCTCCCCTGCATTTCCAGG + Intergenic
908150488 1:61296296-61296318 TTAAACTCCCTTGAATCTCCAGG + Intronic
911383518 1:97145856-97145878 GTTAACTCCCTGGCACCAGCAGG - Intronic
911968314 1:104396463-104396485 ACTAACTCTCTAGCACATCCTGG + Intergenic
912261384 1:108114397-108114419 TTTAACTCCCTGGCACTTCCTGG + Intergenic
913481299 1:119291869-119291891 AGTAACTCCCTGGCACTTCTGGG - Intergenic
914912971 1:151801717-151801739 CTTGACTGCCTTCCACCTCCTGG - Exonic
920166894 1:204042381-204042403 ATTATCTCACTTGGTCCTCCAGG + Intergenic
921551632 1:216543428-216543450 AATAACTGCCTTGAACCTCAAGG + Intronic
922980973 1:229826741-229826763 ATCAGCTCCCATACACCTCCTGG + Intergenic
923558057 1:235017250-235017272 ATAAAATCCCTTGGACATCCAGG + Intergenic
1063837776 10:10035259-10035281 ATTTTCTCCCTTCTACCTCCAGG - Intergenic
1076220404 10:128729183-128729205 CTGAACGCCCATGCACCTCCAGG - Intergenic
1076273203 10:129174600-129174622 ATTATAGCCCTGGCACCTCCAGG + Intergenic
1076476663 10:130758424-130758446 CTTACCTCCCTTGCTACTCCAGG + Intergenic
1077173824 11:1179917-1179939 CTTCCCTCCCCTGCACCTCCCGG - Intronic
1081575397 11:44316094-44316116 CCTAACTCCTTTGGACCTCCAGG + Intergenic
1081730249 11:45366987-45367009 ATTAACTGCTTTGCAGCTCCTGG + Intergenic
1081789888 11:45775068-45775090 ATTACCATCCTTGCACCTGCTGG - Intergenic
1085303865 11:75474139-75474161 AATAACTCCCTTGCTCTTCCTGG + Intronic
1088151380 11:106749554-106749576 ATTAACTCCTTCTCACTTCCAGG - Intronic
1096344541 12:50834127-50834149 ATTAACTTCTTTGCACTTACAGG - Intergenic
1097101242 12:56591128-56591150 TTTGACTCCCTTGCACTTCAAGG + Exonic
1099996694 12:89786535-89786557 ATTAACTTCTGTGCACCTGCAGG - Intergenic
1103453453 12:121046151-121046173 GTTAACTCCCTTGAACTTGCAGG + Intergenic
1104345453 12:127992492-127992514 ATTAATTTCCTTGAACCTCAGGG + Intergenic
1104554165 12:129785094-129785116 CTTAATTCCCTTGCACCAGCTGG + Intronic
1107962479 13:45570750-45570772 ATTCACTCCATTGCAGCTGCAGG + Intronic
1107962495 13:45570886-45570908 ATTCACTCCATTGCAGCTGCAGG + Intronic
1111396780 13:87675991-87676013 CTTAACGCACTTGGACCTCCGGG + Exonic
1113405711 13:110037706-110037728 ATTAACTATATTGCACCTGCTGG + Intergenic
1113973637 13:114210479-114210501 ATTAGCATCCTTGCCCCTCCTGG + Intergenic
1114143357 14:19942745-19942767 ATTAACATCCTTTCACCTCATGG - Intergenic
1114661724 14:24350471-24350493 ACTAACTCCCTTGCACTTCTTGG + Intergenic
1115970987 14:38944661-38944683 ATTGACTCCATTCCAGCTCCAGG + Intergenic
1116119698 14:40706346-40706368 CTTAACTCCTGTGCACCTGCAGG + Intergenic
1116405997 14:44567413-44567435 ACTAAATCCATTGCAGCTCCAGG - Intergenic
1117533077 14:56677524-56677546 TTTATCTCCCTTTCTCCTCCTGG + Intronic
1119215512 14:72866322-72866344 AGTAACTCCCCAGCACCTGCAGG + Intronic
1120084685 14:80257449-80257471 GCTAACTCCCTTGCACTTCTAGG - Intronic
1120926188 14:89799834-89799856 TTTAATTCCCTAGTACCTCCTGG - Intronic
1121072447 14:91036820-91036842 ATTAACTTCCTAGCACTTCCAGG + Intronic
1121362500 14:93274439-93274461 GTTCACTCCCTTGCATCTCATGG - Intronic
1121823195 14:96988343-96988365 AATAACTCCCTAACACCTCCTGG - Intergenic
1124024674 15:25954421-25954443 CCAAAATCCCTTGCACCTCCTGG + Intergenic
1126495806 15:49289526-49289548 ATTAACTCCCTAGCACTTTCAGG - Intronic
1128262129 15:66239834-66239856 ATTAACTCCCTTGCACCTCCGGG - Intronic
1135838090 16:25846196-25846218 ATAAACTTCCTTGCAGCTTCTGG - Intronic
1137002869 16:35246483-35246505 ACAACCTCCCTTGCACCTTCAGG + Intergenic
1138314418 16:56056633-56056655 ATGAACTCCCCTGCATGTCCAGG + Intergenic
1141153836 16:81583165-81583187 AGCAACTCCCTTGCAACCCCAGG - Intronic
1142947111 17:3439189-3439211 AACAACTCCCTTGCACTTTCTGG - Intergenic
1143581399 17:7829432-7829454 ATTCAATTCCTTGCATCTCCAGG + Intronic
1148743828 17:49907645-49907667 ATTACCACCTTGGCACCTCCGGG + Intergenic
1149402823 17:56316242-56316264 ATTAACTTCCTTGCTTCTCTTGG + Intronic
1154461372 18:14591107-14591129 ATTAACATCCTTTCACCTCATGG - Intergenic
1157000382 18:43515612-43515634 ATTCACCCCCTTGCAACACCGGG - Intergenic
1165371909 19:35413759-35413781 ACTAGTTCCATTGCACCTCCCGG + Intergenic
1166573882 19:43818513-43818535 ATTAACTCCGCTGTACTTCCAGG + Intronic
925565607 2:5250802-5250824 ATTAACTCCCCTGCACTTCCAGG - Intergenic
925657998 2:6170369-6170391 ATTAACGCCCGTACACTTCCAGG + Intergenic
926272548 2:11377632-11377654 AGGAACTTCCTTGGACCTCCTGG + Intergenic
935948956 2:108311832-108311854 ATTGACTTCCATGCACCTGCAGG - Intergenic
942833616 2:180265856-180265878 ATTTCCTCCCTTGCACCATCAGG - Intergenic
946045565 2:216818135-216818157 ATTAACTGCTCTGCACTTCCAGG - Intergenic
1170618117 20:17970524-17970546 ATTAACTCACTTGATCCTCATGG + Intronic
1171978255 20:31608854-31608876 ATTAACTCCTTAACCCCTCCTGG + Intergenic
1176813135 21:13566740-13566762 ATTAACATCCTTTCACCTCATGG + Intergenic
1177148362 21:17430287-17430309 ACTAACTCTCCTGCACTTCCAGG - Intergenic
1178621655 21:34182612-34182634 GTTGACTCCCTTACACTTCCAGG - Intergenic
1180713723 22:17857508-17857530 ATCAACTCTCCTGCACCTGCGGG - Intronic
1181929496 22:26388699-26388721 ATTAACTCCTAGGCACCTCTGGG + Intergenic
1182522099 22:30890549-30890571 ATCACCTCCCTGGCCCCTCCTGG - Intronic
1182926092 22:34126647-34126669 ACTAATTGCCTTGCACTTCCAGG - Intergenic
1183364550 22:37400100-37400122 TTGCACTCCCTTGCCCCTCCCGG - Intronic
1184244951 22:43231166-43231188 TTTACCTCCCTGGCTCCTCCTGG + Intronic
1184354203 22:43967727-43967749 AGTGACTCCCTTTCACCTGCAGG + Intronic
949820710 3:8112579-8112601 ATTAACTCCCCTGCATTTCCAGG + Intergenic
950009249 3:9711185-9711207 AATAATTCGCTTGCACATCCAGG - Intronic
950602484 3:14046740-14046762 ATTTACACACTTTCACCTCCAGG + Intronic
951598613 3:24346221-24346243 ATTAAGTCCCTTGCATTTTCTGG + Intronic
953152121 3:40334126-40334148 ATTAACTCCCTGGCACTTCCGGG - Intergenic
953216865 3:40926936-40926958 GTTAACTCCCTTGCATTTCCAGG + Intergenic
953382831 3:42486970-42486992 ATTAACTCCCCTGCACTTCCTGG - Intergenic
954580622 3:51701021-51701043 AATCACCCCCTTTCACCTCCCGG - Intronic
956678950 3:71760032-71760054 ATTGCCTCCCTTGCCCCTCAGGG - Intergenic
957742074 3:84283102-84283124 ATTAACTTCCTTGTACTTCCAGG + Intergenic
958882644 3:99690541-99690563 AATCACTGCCTTGCACCCCCAGG + Intronic
959228390 3:103616108-103616130 ATCACCTCCCAGGCACCTCCGGG - Intergenic
963043897 3:141088579-141088601 GTTAACTCCCCTGCACATCCCGG - Intronic
964118578 3:153160801-153160823 GGCATCTCCCTTGCACCTCCCGG + Intergenic
965645398 3:170875268-170875290 GTTAACTCCCTTGCATTTTCAGG + Intergenic
967720497 3:192811069-192811091 ATTAACTCCCCTGCACTTCCTGG - Intronic
970154467 4:13127823-13127845 ATTAATCCCCTTGCACATCCAGG + Intergenic
970316074 4:14829477-14829499 ATTAATTCCTTTGCAGCTGCAGG + Intergenic
970350316 4:15195536-15195558 ATTAACTGGCTTGCACTCCCTGG + Intergenic
971854881 4:32030408-32030430 ATTAGCTCTCTTGTACTTCCAGG + Intergenic
973735463 4:53866888-53866910 ATAAATTCCCTTGCAACACCAGG - Intronic
973845786 4:54911869-54911891 ATTATCACCCCTGCTCCTCCTGG - Intergenic
976690087 4:87859405-87859427 ATTAATTCCCCAGCACTTCCAGG - Intergenic
978618781 4:110619966-110619988 ATTAGCTCTCTTGCACATCAAGG - Intronic
981125625 4:141102908-141102930 ATTACCACCCTGGCCCCTCCAGG - Intronic
983247559 4:165305708-165305730 CTTACCTGCCCTGCACCTCCTGG - Exonic
985417698 4:189753449-189753471 CTTGACTCCTTTGCACCTGCAGG - Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
997260511 5:132462573-132462595 GTTCACTCCCCTGCACCTCCAGG + Exonic
998006955 5:138663382-138663404 ATTAACTGCCCTGCACCACTGGG - Intronic
998642914 5:144032377-144032399 CAAAACTCCCTTGCAGCTCCTGG + Intergenic
999696540 5:154191992-154192014 ATACACTCACTAGCACCTCCTGG - Intronic
1001021682 5:168188350-168188372 AATAACTTGCTTGCACCTCCTGG - Intronic
1001265035 5:170268102-170268124 ATTAAGTCCGTGGCACCTACTGG - Intronic
1003005295 6:2375616-2375638 AGGAACGCCCTCGCACCTCCCGG - Intergenic
1007245056 6:40455477-40455499 GTTAACTCCCCTGCACTTCCAGG - Intronic
1009629991 6:66184768-66184790 ATTAACTGCCTTCCACTTCTAGG - Intergenic
1012144023 6:95658952-95658974 ATTAACTCCTTCGTACTTCCAGG + Intergenic
1012366198 6:98443783-98443805 ATTAACTCCCCTGTACTTCCAGG + Intergenic
1013273660 6:108562824-108562846 ATTAACTCCTCTGCCCCTGCTGG + Intronic
1017453353 6:154575205-154575227 AGTAACTCCCTTGCATTTCCAGG + Intergenic
1018502925 6:164431784-164431806 ATTAAGTCCCTAGTACCTCTGGG + Intergenic
1023285126 7:38611294-38611316 ATTTCCCCCCTTGCATCTCCTGG - Intronic
1025021344 7:55482637-55482659 TTTAACTCCCTTCCTCCTCTTGG - Intronic
1025021411 7:55483331-55483353 ATCAACTGCCTCGCACCTGCTGG - Intronic
1028490940 7:91411044-91411066 GCTAACTCCCTTGCACGTTCAGG - Intergenic
1028716940 7:93981720-93981742 ATTAAATCCATTGTACTTCCAGG + Intronic
1028859968 7:95638099-95638121 ATTAACTCGCTTGCACTTCCAGG + Intergenic
1028967400 7:96817442-96817464 TTTAACTTCCTGGCAGCTCCTGG + Intergenic
1033332578 7:140428658-140428680 CTTAACACCCTTGGACTTCCTGG + Intergenic
1033608283 7:142943189-142943211 ATAACCTCCCTTTCCCCTCCAGG + Intronic
1033856516 7:145568147-145568169 ATTTAGTTCCTTGCACCTACGGG + Intergenic
1039328291 8:36509113-36509135 ATTAATTCACTTGTACTTCCAGG - Intergenic
1041021623 8:53643926-53643948 ATTATTTCCACTGCACCTCCAGG + Intergenic
1041943358 8:63413163-63413185 ATTAACTCCTATGCATCGCCAGG - Intergenic
1042374357 8:68032337-68032359 ATTATCTCCCCTGTGCCTCCTGG - Intronic
1045797492 8:106062998-106063020 AATGACTCCCTTGTACTTCCTGG - Intergenic
1050188743 9:3002718-3002740 ATTAACTCCCTTACACTTCAAGG - Intergenic
1058847122 9:108972079-108972101 CTTGACTCCCATGCTCCTCCCGG + Intronic
1059980173 9:119762792-119762814 ATTACATCCCTAGCACCACCTGG - Intergenic
1060025632 9:120168622-120168644 ATTATCTCTCTTACACCTTCAGG + Intergenic
1060971100 9:127738603-127738625 AGCATCTCCCTTGCACCTCCAGG - Exonic
1186705659 X:12137653-12137675 ATTAACTCAGTTCTACCTCCTGG - Intergenic
1186727646 X:12374414-12374436 ACTAACTCCCTAGCCCCGCCAGG + Intronic
1187173665 X:16875094-16875116 ATCAACGGACTTGCACCTCCAGG - Intergenic
1189273704 X:39769726-39769748 GTTAACTCCCCTACAGCTCCAGG + Intergenic
1189706312 X:43762288-43762310 GTTAACTCCCTTGAACTTCCAGG - Intergenic
1198952326 X:142085677-142085699 TTTAACTCACTTTCAGCTCCTGG + Intergenic
1199196748 X:145041268-145041290 ATGAATTCCCCAGCACCTCCAGG - Intergenic
1201484684 Y:14480066-14480088 ATTAAGTTACTTGCAGCTCCAGG + Intergenic
1202189376 Y:22224860-22224882 ATCAACTCTCTTGCATCTCTGGG + Intergenic