ID: 1128263564

View in Genome Browser
Species Human (GRCh38)
Location 15:66250153-66250175
Sequence GTGCAGATCTTCTGCCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128263564_1128263569 26 Left 1128263564 15:66250153-66250175 CCTTCCTGGCAGAAGATCTGCAC 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1128263569 15:66250202-66250224 GTCACCACTGCAGCTGCCTTTGG 0: 1
1: 0
2: 2
3: 24
4: 213
1128263564_1128263566 4 Left 1128263564 15:66250153-66250175 CCTTCCTGGCAGAAGATCTGCAC 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1128263566 15:66250180-66250202 GTTCTCCAATGCTGCCTCTAAGG 0: 1
1: 0
2: 0
3: 11
4: 112
1128263564_1128263570 27 Left 1128263564 15:66250153-66250175 CCTTCCTGGCAGAAGATCTGCAC 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1128263570 15:66250203-66250225 TCACCACTGCAGCTGCCTTTGGG 0: 1
1: 0
2: 0
3: 13
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128263564 Original CRISPR GTGCAGATCTTCTGCCAGGA AGG (reversed) Intronic
900399678 1:2467795-2467817 GTGCAGAGCTCCTCCCAGCAGGG + Intronic
900719454 1:4165845-4165867 TTACAGATCATCTCCCAGGAAGG - Intergenic
904592218 1:31621285-31621307 GTGTAGATGTCCTTCCAGGAGGG + Intronic
904881039 1:33697271-33697293 GAGCAGATCTCAGGCCAGGAAGG - Intronic
905533149 1:38698133-38698155 TTGAAGATCTCCTCCCAGGAAGG + Intergenic
906803597 1:48758828-48758850 ATGCAGATCCTCTTCCAGGAAGG - Intronic
908641136 1:66224687-66224709 GTCTTGATCTGCTGCCAGGATGG - Intronic
911385327 1:97168286-97168308 GTGAAGAGCTGCTGCCAGCAAGG - Intronic
912369425 1:109162095-109162117 ATGCAGCTGCTCTGCCAGGAAGG - Intronic
913403484 1:118462206-118462228 CTGCAGCCCTGCTGCCAGGAAGG + Intergenic
915572126 1:156750528-156750550 GTGAAGATCTTCCGCCAGAACGG - Intronic
922135384 1:222820147-222820169 GGGCAGATTTTCTGTAAGGAGGG + Intergenic
1065813753 10:29465611-29465633 GTACAGATCTTCCTGCAGGAAGG + Exonic
1068488323 10:57688420-57688442 GGGCAGATTTTATGGCAGGACGG + Intergenic
1069926583 10:71854815-71854837 GTGCAGGATTTCAGCCAGGAGGG + Intergenic
1070086183 10:73239362-73239384 CTGCAGATCCCCTGCCAGGTCGG - Exonic
1074235367 10:111579491-111579513 ATTCAGATCTTCAGCCTGGATGG + Intergenic
1074892286 10:117745732-117745754 AATCAGCTCTTCTGCCAGGAAGG - Intergenic
1076124599 10:127963829-127963851 GTGCAGAACTTCTGCCCCAAGGG - Intronic
1078481450 11:11679630-11679652 GTGCAGACCTTCATCCTGGAAGG - Intergenic
1081216201 11:40401705-40401727 GTGCACATTTTCTGGCAGGAAGG + Intronic
1083227836 11:61295614-61295636 GTGCAGACCTTCTGGCAGGCTGG - Intergenic
1083680288 11:64348592-64348614 GTGCAGTTATTAAGCCAGGAAGG + Intronic
1084529771 11:69719973-69719995 GTGCTGATCCTGTGCCAGGGTGG - Intergenic
1089609952 11:119663577-119663599 TTGCAGAGCTTCTGCCATGTGGG + Exonic
1095698488 12:45166291-45166313 GTGCACATCAGCTTCCAGGAAGG - Intergenic
1096028620 12:48390602-48390624 GTGGTAATCTTGTGCCAGGAGGG + Intergenic
1098466639 12:70794643-70794665 GTGCAGAGCTTCAGCCCAGAGGG + Intronic
1103402168 12:120650507-120650529 GTGCCGTTCTTCCTCCAGGACGG - Intronic
1104215163 12:126727092-126727114 GTGCAGATCTGGCGCCAGGGGGG + Intergenic
1105434361 13:20363971-20363993 GTGCACATCTTCAGCCAGTGAGG - Intergenic
1110546792 13:76764974-76764996 GTGCAATTCTCCTGCCAGGTTGG - Intergenic
1113766665 13:112885836-112885858 GCCCAGACATTCTGCCAGGAGGG - Exonic
1114344077 14:21777337-21777359 GTGCAGATGTGCTACCAGAAAGG - Intergenic
1117286654 14:54291925-54291947 GTGCAGAGCTGCTGCCTGGGAGG - Intergenic
1118846498 14:69551310-69551332 GTGCAAAGCTCCTCCCAGGACGG - Intergenic
1120800503 14:88682940-88682962 GTTCAGAGATTCTGCCTGGAGGG + Intronic
1120879215 14:89401688-89401710 GTGCACATGTTCTGCTAGGTGGG + Intronic
1122690144 14:103528430-103528452 GTGCAGAGCTGCTTCTAGGAGGG - Intergenic
1123999131 15:25740341-25740363 CTGCAGGTCTGCTGCCAGCAGGG + Intronic
1126060964 15:44782202-44782224 GTGCAAACCTTCAGCCAGGGAGG - Intergenic
1127392425 15:58517378-58517400 CTGCATATCTTCACCCAGGAGGG + Intronic
1128263564 15:66250153-66250175 GTGCAGATCTTCTGCCAGGAAGG - Intronic
1128767953 15:70262504-70262526 GTGAAGCTCTTCTCCCAGGTGGG + Intergenic
1132739997 16:1407306-1407328 GTGCAGAACTCCTGTCTGGATGG - Intronic
1133087730 16:3378142-3378164 GTGCATACCTTCCACCAGGAGGG - Intronic
1136749057 16:32616647-32616669 GTGCAGCTCTTCTGTCTGGATGG + Intergenic
1138750810 16:59418160-59418182 GAGCATATCATCTGCCAGGTAGG + Intergenic
1139936307 16:70573877-70573899 CTGCAGAACCTCTGCCAGTAAGG - Exonic
1141481304 16:84308561-84308583 GTGCTGGTCCTCTGCCTGGAAGG - Intronic
1203051190 16_KI270728v1_random:875861-875883 GTGCAGCTCTTCTGTCTGGATGG + Intergenic
1142809472 17:2388533-2388555 GTGCAGACCAGCAGCCAGGAGGG - Intronic
1144410540 17:14996261-14996283 GTGCAGACATTTTGGCAGGAGGG + Intergenic
1145322533 17:21774630-21774652 GTCCAGAGCTTCTTCCAGGGTGG + Intergenic
1147743174 17:42680094-42680116 GCGCTGCTCTTCAGCCAGGATGG - Exonic
1148851438 17:50557422-50557444 GTGCACATCTCATCCCAGGAGGG - Intergenic
1149665951 17:58364845-58364867 GGGCAGGTCTCCTGCCAGGCAGG + Intronic
1149794286 17:59505298-59505320 GTGCAGACCTACTGCTAGGGTGG - Intergenic
1152535711 17:80949342-80949364 CTGCAGCACGTCTGCCAGGAAGG + Intronic
1156858034 18:41805697-41805719 CTGCAGAACTTTTGCCTGGAGGG + Intergenic
1157426460 18:47588616-47588638 ATGCTGATGTCCTGCCAGGAGGG - Intergenic
1158831557 18:61284904-61284926 GTCCAGATATTGTGCAAGGATGG + Intergenic
1160571354 18:79819471-79819493 CTGCATGCCTTCTGCCAGGAGGG - Intergenic
1162568744 19:11458499-11458521 GAGCAGCTCTTCTCCCAGTACGG - Exonic
1163174875 19:15557222-15557244 GTGCAAATCCTCTATCAGGAGGG - Intergenic
1163889806 19:20000686-20000708 GCATAGATCTTCAGCCAGGAAGG - Intronic
1163991170 19:21000377-21000399 GTGCAGGGCTTCTGCGTGGAAGG + Intergenic
1165143630 19:33717992-33718014 CTGGGGGTCTTCTGCCAGGATGG - Intronic
1165999034 19:39866771-39866793 GTCCACATCTTCTTCCAGGATGG - Exonic
1167403495 19:49288699-49288721 ATGCAGAACCTCTGCCAGGGAGG + Intergenic
1167423400 19:49416875-49416897 GTGCACTTCTGCTGCCAGGTCGG - Intronic
925844146 2:8020487-8020509 GTGCTTCTCATCTGCCAGGAGGG + Intergenic
926493589 2:13556354-13556376 GTGAATATTTTCTACCAGGAAGG - Intergenic
927310289 2:21623282-21623304 CTGCACATTTTCTGCCCGGAGGG + Intergenic
927427498 2:22997042-22997064 CTGCAGATGTCCTGGCAGGATGG - Intergenic
927941418 2:27105361-27105383 GTTCAGAACCACTGCCAGGATGG + Intronic
929238041 2:39627025-39627047 GTGCAGCTGGTCTGCCAGGCTGG - Intergenic
929771456 2:44895761-44895783 GTGCTGTTCTTTTGCCAGGGAGG + Intergenic
932082815 2:68731149-68731171 GTGCAGATCTTCTGCACTCAAGG - Intronic
933868733 2:86547083-86547105 GTGCAGTTGTACTGCCTGGAGGG - Intronic
935212492 2:100950681-100950703 GTGCAGGGCTTATGCCTGGATGG + Intronic
935466252 2:103401914-103401936 CTGCAGTTGGTCTGCCAGGAAGG + Intergenic
935660877 2:105465894-105465916 GAGCAGAGCCTCTGGCAGGATGG + Intergenic
937668066 2:124509468-124509490 TTGTAGATCTTCTGCCAGTTAGG + Intronic
940995172 2:160141795-160141817 TTGCTGATCTTCTTCCTGGAAGG - Intronic
943479894 2:188404868-188404890 GTGCTGATCTGATGCCAGGGTGG - Intronic
943499870 2:188674348-188674370 GGGCAGATGCTCTGCCAGGGGGG + Intergenic
1169018412 20:2310339-2310361 CTCCAGATCTTCTCCCAGGGCGG + Exonic
1169165580 20:3420671-3420693 GGGAAGATCTGCTTCCAGGATGG - Intergenic
1175073814 20:56357329-56357351 GTGCAGATTGTCTGTCAGGTTGG - Intergenic
1175596212 20:60236178-60236200 GAGCATCTCTTCTGCCTGGATGG + Intergenic
1175931315 20:62495125-62495147 GTGCAGATCGAGCGCCAGGATGG + Intergenic
1177898706 21:26886553-26886575 CTGCAGATATTCTCCTAGGATGG - Intergenic
1182039274 22:27223905-27223927 TTGCAGATCTTCTCCCTGGGAGG - Intergenic
1183829555 22:40410527-40410549 GTGGAGAGCTCCTGGCAGGAAGG + Exonic
950408072 3:12816875-12816897 GTGCAGTGCCTCGGCCAGGATGG - Exonic
950520708 3:13496205-13496227 GTGCATCCCTTTTGCCAGGAAGG + Intronic
956384916 3:68706259-68706281 GTCCAGATTTTCTCCCAAGAGGG + Intergenic
956599219 3:71001265-71001287 CTGCAGAACTTCTCCCTGGAAGG - Intronic
958081150 3:88747522-88747544 GTGCAGTGGTTCTGCCAGCATGG + Intergenic
967939698 3:194756424-194756446 GGGCAGATCCTCTGCCAACATGG - Intergenic
968565241 4:1309164-1309186 GAGTAGTTTTTCTGCCAGGAAGG + Intronic
968896365 4:3406192-3406214 GTGCAGAACTCCGGCCAGGGCGG + Intronic
968921976 4:3527092-3527114 GCGCAGAGCATCTACCAGGAGGG - Intronic
973558746 4:52112779-52112801 AAGCAGATTTTCTGCCAGCAGGG + Intergenic
977184162 4:93916228-93916250 TTGCTGATTTTCTGGCAGGAGGG - Intergenic
983264943 4:165498966-165498988 TGGCAGATCTTCTGTCAGAATGG - Intergenic
984176342 4:176422844-176422866 GGGCAGAACTTCTGCCAGGATGG - Intergenic
988150250 5:27368212-27368234 CTGCAGCTCATCTGTCAGGAGGG + Intergenic
990548660 5:56850225-56850247 GTGAATTTCTTCTGCTAGGAAGG + Intronic
991125130 5:63061136-63061158 GTGAGGATCCTCTTCCAGGAAGG - Intergenic
991958785 5:72021360-72021382 GTGTTGATTTTCTGGCAGGAAGG - Intergenic
992186181 5:74246900-74246922 GTGCGAATCATCTGGCAGGATGG - Intergenic
995041048 5:107588340-107588362 GAGAAGATCCTCTTCCAGGACGG - Intronic
999786921 5:154899135-154899157 TAGGAGAGCTTCTGCCAGGAAGG - Intronic
1001990963 5:176115139-176115161 GTGCAGCTCTTCCGTCTGGATGG + Intronic
1001997507 5:176173965-176173987 GTGCAGCTCTTCTGTCTGGATGG - Intergenic
1002225909 5:177723001-177723023 GTGCAGCTCTTCCGTCTGGATGG - Intronic
1002267938 5:178048211-178048233 GTGCAGCTCTTCCGTCTGGATGG + Intronic
1005668980 6:28085776-28085798 CTGCAAATCTCCTGGCAGGATGG - Exonic
1006505943 6:34488684-34488706 GAGCTGATCTCCTGCAAGGATGG - Intronic
1010058727 6:71596601-71596623 TTGCAGATCTTGGGCAAGGAGGG + Intergenic
1017013761 6:150083546-150083568 CTCCTGCTCTTCTGCCAGGAGGG + Intergenic
1018419910 6:163632035-163632057 GTGCACATCTCCTCTCAGGAAGG + Intergenic
1018775066 6:167007093-167007115 ATTCAGTTCTTCTGTCAGGAAGG + Intronic
1024730568 7:52249405-52249427 GTGCAGAGCTTCCTCCAGGAAGG - Intergenic
1025811512 7:64878602-64878624 GTGCAAAGCTTCTGCAATGAAGG - Intronic
1026732893 7:72926445-72926467 GCGAAAATCTTCTGTCAGGAGGG - Exonic
1026933302 7:74237323-74237345 GAGCGGTTCCTCTGCCAGGACGG + Intronic
1027111191 7:75441442-75441464 GTGAAAATCTTCTGTCAGGAGGG + Exonic
1027283432 7:76626010-76626032 GCGAAAATCTTCTGTCAGGAGGG + Exonic
1030527094 7:110667383-110667405 GTGGACATCTTTTGCCAGGACGG - Intronic
1032993630 7:137421510-137421532 GTAGAGGTTTTCTGCCAGGAGGG - Intronic
1033141907 7:138834815-138834837 GTGCAGATGTCCTGTGAGGAGGG - Intronic
1033265638 7:139884408-139884430 GTGGATATCTTCTCCCAGGTAGG + Intronic
1036693830 8:10961785-10961807 GTCCAGTTCTTATGCCAGGCAGG + Intronic
1037691667 8:21186125-21186147 TTGCAGAGCTCCTGCCTGGACGG - Intergenic
1038395016 8:27240224-27240246 GTGCAGCTTTTCAGCCACGATGG - Intronic
1040566588 8:48573056-48573078 GTGCAGGTCCTCTGCCATGAAGG + Intergenic
1040790354 8:51221804-51221826 GTGCAGGTCTTATGTCAAGATGG - Intergenic
1042069692 8:64917565-64917587 GTGTAGATCTTCAACCTGGAGGG - Intergenic
1044728511 8:95212244-95212266 GATCTGATCATCTGCCAGGATGG - Intergenic
1044946434 8:97394122-97394144 GTGAAGCCCCTCTGCCAGGAAGG + Intergenic
1046604977 8:116361373-116361395 GCCCAGATCTTCTTCAAGGAGGG - Intergenic
1049714676 8:144084280-144084302 TTCCAGACCTTCTGCCAGAAAGG + Exonic
1056103392 9:83322489-83322511 CTGCAGAGCTGCTGCAAGGAGGG - Intronic
1056818100 9:89816298-89816320 GGGCAGATCCACTTCCAGGATGG + Intergenic
1057077048 9:92143378-92143400 GGGAAAATCTTCTGCCAGCATGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057327069 9:94075086-94075108 CTGCAGTTCCTCTGCCAGGGTGG - Intronic
1062301655 9:135876298-135876320 ATGAAGATCTTCTCCCAGGCCGG - Intronic
1062322132 9:135995378-135995400 GTGCACACGTTGTGCCAGGAGGG + Intergenic
1062628188 9:137452360-137452382 ATGCTGATTTTCTGCCAGGTGGG - Exonic
1191254078 X:58272340-58272362 GGGCTCAGCTTCTGCCAGGAAGG + Intergenic
1194661800 X:96636063-96636085 GTGTAGATCTTCTGTCATTATGG + Intergenic
1197346171 X:125327336-125327358 GGGCAGAGCTTCTACCAGGATGG - Intergenic
1197628878 X:128834729-128834751 GTTCAGAGCTTTTGCAAGGATGG + Intergenic