ID: 1128264116

View in Genome Browser
Species Human (GRCh38)
Location 15:66253071-66253093
Sequence TGCTGGGGCTTAGCGGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 85}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128264110_1128264116 3 Left 1128264110 15:66253045-66253067 CCAAAAGCAAAAGCGTGCATGGC 0: 1
1: 0
2: 1
3: 9
4: 118
Right 1128264116 15:66253071-66253093 TGCTGGGGCTTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 14
4: 85
1128264104_1128264116 17 Left 1128264104 15:66253031-66253053 CCGCCTCCCTTCTCCCAAAAGCA 0: 1
1: 0
2: 7
3: 71
4: 608
Right 1128264116 15:66253071-66253093 TGCTGGGGCTTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 14
4: 85
1128264105_1128264116 14 Left 1128264105 15:66253034-66253056 CCTCCCTTCTCCCAAAAGCAAAA 0: 1
1: 0
2: 4
3: 55
4: 554
Right 1128264116 15:66253071-66253093 TGCTGGGGCTTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 14
4: 85
1128264108_1128264116 4 Left 1128264108 15:66253044-66253066 CCCAAAAGCAAAAGCGTGCATGG 0: 1
1: 0
2: 2
3: 9
4: 118
Right 1128264116 15:66253071-66253093 TGCTGGGGCTTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 14
4: 85
1128264106_1128264116 11 Left 1128264106 15:66253037-66253059 CCCTTCTCCCAAAAGCAAAAGCG 0: 1
1: 0
2: 0
3: 13
4: 210
Right 1128264116 15:66253071-66253093 TGCTGGGGCTTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 14
4: 85
1128264107_1128264116 10 Left 1128264107 15:66253038-66253060 CCTTCTCCCAAAAGCAAAAGCGT 0: 1
1: 0
2: 2
3: 23
4: 245
Right 1128264116 15:66253071-66253093 TGCTGGGGCTTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 14
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128264116 Original CRISPR TGCTGGGGCTTAGCGGCCGC GGG Intronic
900399593 1:2467533-2467555 GGCTGGGGCTCAGGGGACGCCGG + Intronic
900579799 1:3403357-3403379 GCCTTGGGCTTAGCGGCTGCAGG - Intronic
902546963 1:17196094-17196116 TGCTGGTGCTTATAGGCTGCAGG - Intergenic
903647697 1:24904867-24904889 TCCTGGGGCTGCGAGGCCGCAGG - Intronic
903804609 1:25996279-25996301 TGCTGGGGCTTGGGAGCCGGAGG + Intronic
904379694 1:30102317-30102339 TGCTGGGACTCAGGGGCCCCAGG + Intergenic
912643447 1:111369179-111369201 TGCTGGGACTTAGGGTCCCCAGG + Intergenic
915517485 1:156421643-156421665 TGCCGGGGCTCAGCGGGCGCCGG + Intronic
922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG + Exonic
1077021074 11:417402-417424 TGCCGGGGCTACGCCGCCGCCGG - Intronic
1078086238 11:8234448-8234470 TGCTGGAGCTGAGGGGCAGCTGG - Intronic
1083173073 11:60934376-60934398 TGCTGGTGATTAGGAGCCGCCGG + Intronic
1084418484 11:69048719-69048741 TTCTGGGGCTTAAGGGCCGAGGG - Intergenic
1084966519 11:72747411-72747433 TGCTGGGGCTTTGCTACAGCAGG - Intronic
1097225615 12:57475490-57475512 TGCTGCGCCTCAGCAGCCGCCGG - Exonic
1102536792 12:113587843-113587865 CGCTGGGGCTCAGCGGGGGCTGG - Intergenic
1105725681 13:23160233-23160255 TGCTGGGACTTGGCGGCGCCTGG + Intergenic
1106995067 13:35471324-35471346 GGCCGAGGCCTAGCGGCCGCGGG + Intronic
1107412268 13:40168910-40168932 TGCTGGGGCATAGGGGCACCTGG - Intergenic
1112846742 13:103653016-103653038 TGCTGGGGCTTAGCTGATGTGGG + Intergenic
1121062775 14:90931367-90931389 TGCTGGGGGTTAGGGGACGGGGG + Intronic
1121320262 14:92987966-92987988 AGCTGGCGCTTAGCCGCCCCAGG + Intronic
1121368041 14:93332691-93332713 GGCTGGGGCCAAGCCGCCGCGGG - Intronic
1122736523 14:103847054-103847076 TGCTCGGCCTCCGCGGCCGCGGG - Intronic
1122940246 14:104978019-104978041 TTCTGGGCCTTCCCGGCCGCTGG - Intronic
1128264116 15:66253071-66253093 TGCTGGGGCTTAGCGGCCGCGGG + Intronic
1130915212 15:88299596-88299618 TGCTGGGGCTTAACAGCCCTGGG - Intergenic
1133624959 16:7562584-7562606 TGCTGGGGCTCAGGTGCCACTGG - Intronic
1135149357 16:19992041-19992063 TGCTGGGGCTTCAAGGCCACAGG - Intergenic
1141756640 16:85995803-85995825 TGCTGGGGGCTGGGGGCCGCAGG - Intergenic
1142143847 16:88484503-88484525 CCATGGGGCTTGGCGGCCGCAGG + Intronic
1142421280 16:89972166-89972188 TGTTGGGGCCGTGCGGCCGCAGG + Exonic
1143014821 17:3886070-3886092 TGCTGGGGCTGAGCTGACCCTGG - Intronic
1145353968 17:22119355-22119377 GGATGGGGCATAGCGGCCGAGGG + Intergenic
1146299737 17:31678642-31678664 AGCTGGAGCTTAGGGGCTGCTGG + Intergenic
1149296273 17:55265027-55265049 CGCTGGGGAGCAGCGGCCGCCGG + Exonic
1152823549 17:82449603-82449625 TGCTGGGGGCTAGCGGCCTCAGG - Intronic
1153329974 18:3863726-3863748 TGGTGGGGCTGAGCGGGCCCTGG - Intronic
1158563833 18:58537381-58537403 TGCTGGGGCTTGGCTGCTCCTGG + Exonic
1160531302 18:79566426-79566448 GGATGGGGCTTAGCCGCAGCAGG + Intergenic
1161031814 19:2061207-2061229 TGCCGGGGCTGATCGGCTGCTGG + Intergenic
1163503235 19:17688247-17688269 GGGTCGGGCTCAGCGGCCGCTGG + Intronic
1167258070 19:48442906-48442928 TGCGGGGGCTGAGCGGCCGGCGG - Exonic
1167429061 19:49443816-49443838 CGCTGAGGCTCAGAGGCCGCTGG - Intergenic
1168335223 19:55593432-55593454 TGCGGGGGCTCAGGGGCCGGCGG - Exonic
932766244 2:74472294-74472316 TGCTGGGGCTTAGGGGCGCGCGG + Intronic
935742555 2:106163073-106163095 GGCTGAGGCTCAGCGGCCTCGGG + Intronic
938958359 2:136319298-136319320 TGCTGGGGCTGAGGAGCCGTTGG - Intergenic
941949264 2:171136301-171136323 TGCTGGGGCCTAGGGGCAGAGGG + Intronic
945257445 2:207814060-207814082 TGCTGGGGCTCAGGGCCTGCTGG + Intergenic
946389149 2:219405101-219405123 TGCTGGGACTGAGAGGGCGCTGG - Intergenic
1170239075 20:14142362-14142384 TGCTGCTGCTTAGCGACCACAGG + Intronic
1172010623 20:31844001-31844023 TGCTGGGACTTAGCCCCCGTAGG - Intergenic
1172771342 20:37384319-37384341 AGCTTGGGCTCGGCGGCCGCGGG - Exonic
1175825433 20:61934143-61934165 TACTGGGGCTCAGCGCCCACCGG - Exonic
1176663227 21:9660204-9660226 TGCTGGGCCTTAGCTGCCTCCGG + Intergenic
1179979264 21:44887958-44887980 GGCTGGGGCTGGGGGGCCGCTGG - Intronic
1180833918 22:18920309-18920331 TGCTGGTGCTCAGAGGCCGTGGG + Intronic
1181942073 22:26485821-26485843 TGCTGGGGCTCAGAGACTGCAGG - Intronic
1182475375 22:30574139-30574161 TGCTGGGGCTGAGCTGGAGCTGG - Intronic
1203284004 22_KI270734v1_random:145607-145629 TGCTGGTGCTCAGAGGCCGTGGG + Intergenic
954028656 3:47802944-47802966 TGCTGGGGCATCCCGGGCGCTGG + Exonic
960087525 3:113606981-113607003 TGCTGGGGCTCAGAGGACGGAGG + Intronic
961087011 3:124076784-124076806 AGCTGGGGCTGAGTGGCTGCTGG - Intergenic
968010502 3:195271122-195271144 CGCCGGGGCTAAGTGGCCGCCGG - Exonic
969636802 4:8374069-8374091 TGCAGGGACTCAGAGGCCGCAGG + Intronic
984952614 4:185018480-185018502 CGCAGGGGCGCAGCGGCCGCGGG - Intergenic
985412096 4:189695848-189695870 TGCTGGGCCTTAGCTGCCTCCGG - Intergenic
989068994 5:37490670-37490692 TGCTGGGGCTTTGTTGCCGGGGG + Intronic
990984064 5:61625978-61626000 CGCCGGGGCTTGGCGGCCTCTGG + Intergenic
993054393 5:82965307-82965329 TTCTGGGGCTTAGAGGCCATTGG - Intergenic
997235802 5:132271394-132271416 TGCTTGGGCTCCGCGGCCACGGG - Exonic
999271998 5:150302237-150302259 GGCTGGGGCGGAGCGGCCGAGGG + Exonic
1002625378 5:180523718-180523740 TGCTGGGGGTTAGCGGGAGCTGG - Intronic
1002841657 6:911763-911785 AGCTGGGGCTTGGCGTCCCCTGG + Intergenic
1003645546 6:7910681-7910703 TGCTGGGCCATGGCGGCGGCGGG - Exonic
1004493471 6:16140698-16140720 TCCTGGGGCATAGCAGCTGCAGG + Intronic
1008013155 6:46490640-46490662 TGCTTGGGATTAGCGGCCTTGGG - Intronic
1016182114 6:141159817-141159839 TGCTAGGGGTTAGGGGCTGCGGG - Intergenic
1018516541 6:164585820-164585842 TGCTGGGACTTAGAGGCAGGAGG + Intergenic
1026913488 7:74106287-74106309 TGCTGGGGCTCAGGGGCTGTGGG + Intronic
1036710766 8:11077208-11077230 TGCTTGGGCTTCCCGGCAGCTGG - Intronic
1041304613 8:56446638-56446660 TCCCGGGGCTTAACGGCTGCTGG + Intronic
1043388278 8:79768397-79768419 GGCGGGGGCTGGGCGGCCGCCGG + Intergenic
1049357510 8:142196068-142196090 TGCTGGGGCTCTGAGGGCGCTGG - Intergenic
1049361946 8:142216118-142216140 AGCTGGGGCTGAGGGGCGGCAGG - Intronic
1049752606 8:144292212-144292234 CTCTGGGGCATAGCGTCCGCTGG - Intronic
1058792865 9:108468886-108468908 TACTGGGGCTTAGCTGCGGAGGG - Intergenic
1062129741 9:134885908-134885930 TGCTGGGGCTTGGGGGTCGGGGG + Intronic
1203662872 Un_KI270753v1:61561-61583 TGCTGGGCCTTAGCTGCCTCCGG - Intergenic
1203670498 Un_KI270755v1:7133-7155 TGCTGGGCCTTAGCTGCCTCCGG + Intergenic
1187888025 X:23907508-23907530 TACTGGGGATGAGCGGCTGCCGG - Intronic
1188574390 X:31629303-31629325 TCCGGGGGCTTTGCTGCCGCTGG - Intronic
1189247471 X:39574745-39574767 TGAGGGGGCTTAGCCACCGCAGG + Intergenic
1202119971 Y:21511240-21511262 TGCTGGGGCGGAGCGGCCTCAGG + Intergenic
1202122422 Y:21534781-21534803 TGCTGGGGCGGAGCGGCCTCAGG + Intronic
1202156583 Y:21894602-21894624 TGCTGGGGCGGAGCGGCCTCAGG - Intronic
1202159031 Y:21918143-21918165 TGCTGGGGCGGAGCGGCCTCAGG - Intergenic
1202185480 Y:22183058-22183080 TGCTGGGGCGGAGCGGCCTCAGG - Intergenic
1202205880 Y:22403338-22403360 TGCTGGGGCGGAGCGGCCTCAGG + Intronic