ID: 1128264137

View in Genome Browser
Species Human (GRCh38)
Location 15:66253149-66253171
Sequence GACCCCGGCGGGGAAGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 250}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128264125_1128264137 7 Left 1128264125 15:66253119-66253141 CCTGCTGCGTCCCCGCAGGCTCT 0: 1
1: 1
2: 2
3: 20
4: 210
Right 1128264137 15:66253149-66253171 GACCCCGGCGGGGAAGGCGCCGG 0: 1
1: 0
2: 1
3: 24
4: 250
1128264123_1128264137 14 Left 1128264123 15:66253112-66253134 CCGAAAACCTGCTGCGTCCCCGC 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1128264137 15:66253149-66253171 GACCCCGGCGGGGAAGGCGCCGG 0: 1
1: 0
2: 1
3: 24
4: 250
1128264121_1128264137 20 Left 1128264121 15:66253106-66253128 CCGCCGCCGAAAACCTGCTGCGT 0: 1
1: 0
2: 0
3: 4
4: 30
Right 1128264137 15:66253149-66253171 GACCCCGGCGGGGAAGGCGCCGG 0: 1
1: 0
2: 1
3: 24
4: 250
1128264128_1128264137 -5 Left 1128264128 15:66253131-66253153 CCGCAGGCTCTGCCTCCCGACCC 0: 1
1: 0
2: 9
3: 78
4: 741
Right 1128264137 15:66253149-66253171 GACCCCGGCGGGGAAGGCGCCGG 0: 1
1: 0
2: 1
3: 24
4: 250
1128264120_1128264137 24 Left 1128264120 15:66253102-66253124 CCGGCCGCCGCCGAAAACCTGCT 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1128264137 15:66253149-66253171 GACCCCGGCGGGGAAGGCGCCGG 0: 1
1: 0
2: 1
3: 24
4: 250
1128264127_1128264137 -4 Left 1128264127 15:66253130-66253152 CCCGCAGGCTCTGCCTCCCGACC 0: 1
1: 1
2: 2
3: 62
4: 585
Right 1128264137 15:66253149-66253171 GACCCCGGCGGGGAAGGCGCCGG 0: 1
1: 0
2: 1
3: 24
4: 250
1128264126_1128264137 -3 Left 1128264126 15:66253129-66253151 CCCCGCAGGCTCTGCCTCCCGAC 0: 1
1: 0
2: 0
3: 32
4: 377
Right 1128264137 15:66253149-66253171 GACCCCGGCGGGGAAGGCGCCGG 0: 1
1: 0
2: 1
3: 24
4: 250
1128264122_1128264137 17 Left 1128264122 15:66253109-66253131 CCGCCGAAAACCTGCTGCGTCCC 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1128264137 15:66253149-66253171 GACCCCGGCGGGGAAGGCGCCGG 0: 1
1: 0
2: 1
3: 24
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128264137 Original CRISPR GACCCCGGCGGGGAAGGCGC CGG Intronic
900342887 1:2197095-2197117 GACCCAGGCAGGGAAGGAGATGG - Intronic
900648375 1:3719105-3719127 GACCCCGGCCGGGGTGGCTCAGG - Intronic
901109862 1:6785702-6785724 GACCCGGCCGGGGAGGGGGCCGG + Intronic
901443461 1:9293115-9293137 GGCCCGGGAGGGGGAGGCGCGGG + Intronic
901483079 1:9539510-9539532 GGCCACGCCGCGGAAGGCGCGGG + Exonic
902005099 1:13225790-13225812 GACCCAGGTGGGGAGGGCCCAGG - Intergenic
902024324 1:13371584-13371606 GACCCAGGTGGGGAGGGCCCAGG - Intronic
903420963 1:23217546-23217568 GAGCCCGGCGAGGGAGGAGCTGG - Intergenic
903539468 1:24089038-24089060 GACCCCGGCGGGGATGAGGCAGG - Intronic
903652275 1:24929554-24929576 GACCCGGGGCGGGAGGGCGCCGG - Intronic
903693709 1:25192529-25192551 CACCCCAGTGTGGAAGGCGCAGG + Intergenic
903921606 1:26804041-26804063 CACCCCGGCGGGGAGGGAGGTGG - Intergenic
904724954 1:32539860-32539882 GAAGGCGGCGGGGACGGCGCCGG + Intronic
905038222 1:34930539-34930561 GGCCACGGTGGGGAAGCCGCAGG + Intergenic
905369287 1:37474654-37474676 GGCCTCGGCGGGGAAGCGGCAGG + Intronic
905630080 1:39513735-39513757 GACCCAGGCGAGGGAGGTGCTGG + Intronic
905643806 1:39610335-39610357 GACCCCGCCTGGGGAGGCGCAGG - Intergenic
905667679 1:39772455-39772477 GACCCAGGCGAGGGAGGTGCTGG - Intronic
910430034 1:87151458-87151480 GACCCCGGCGGTAGAGTCGCCGG - Intronic
910936452 1:92486809-92486831 GCCCCCGGCGGAGAGGGCCCTGG + Intronic
912603527 1:110963993-110964015 GACTCCGCCGGAGCAGGCGCAGG + Exonic
914197391 1:145454548-145454570 GGCCCCGGCAGGGAGGGCGCGGG + Intergenic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
918282915 1:183023395-183023417 GCCCCCGGGGAGGAAGGAGCAGG - Intergenic
922766411 1:228158708-228158730 GGCCGCCGCAGGGAAGGCGCAGG - Exonic
922894190 1:229088073-229088095 GACCCCGGCGTGGGAGGGGCTGG - Intergenic
923684191 1:236142588-236142610 GACCCCCGCGGGGGCGGCGGCGG + Exonic
1063357243 10:5412727-5412749 GACCGCGGAGGCGAAGCCGCCGG + Exonic
1063369602 10:5512516-5512538 GCCCACGGCGAGGAAGGGGCGGG - Intergenic
1064028794 10:11869976-11869998 CCCCGCGGCGGGGAAGGCGCCGG - Exonic
1065636775 10:27742670-27742692 GAACCCGGAGGGGGAGGCCCCGG - Intronic
1066370405 10:34814823-34814845 GGCGGCGGCGGGGACGGCGCCGG - Intronic
1067806185 10:49395182-49395204 GGCCCAGGCGGGGAGGGAGCTGG + Intronic
1068544937 10:58334929-58334951 GGGCGCGGCGGGGAGGGCGCAGG + Intergenic
1069713540 10:70506402-70506424 GACCCCTGGAAGGAAGGCGCTGG + Intronic
1069976591 10:72218059-72218081 GATCCCGGAGGGGGAGGCGGAGG + Intronic
1070032724 10:72692551-72692573 CACCAGGGCGGGGAAGGCACGGG + Intronic
1074008942 10:109457049-109457071 GGCCGCGGCGGGGCAGGCGTAGG + Intergenic
1074169373 10:110918606-110918628 GACCCCAGCGGGGAATGGGCGGG - Intronic
1075748139 10:124742760-124742782 GAGCGCGGCGGCGAAGGCGACGG + Intronic
1075801811 10:125159297-125159319 GGCCCGGGCGGGGAAGGTGGGGG + Intronic
1076852569 10:133100197-133100219 GGCCCCGGCGGAGGAGTCGCTGG + Intronic
1077014743 11:394537-394559 GACAGCGGCGGGGATGGCGGTGG + Intronic
1077063644 11:628234-628256 GGCCGCGGCGGCGAAGGCGGAGG - Intergenic
1077214688 11:1390452-1390474 GGCCCCGGCCGCGAAGCCGCAGG + Intronic
1078679553 11:13463050-13463072 GAACTCGGCGGGGGCGGCGCGGG - Intronic
1078814170 11:14802268-14802290 GGCCCCGGTGGGGTAGGCACCGG + Intronic
1081870881 11:46382002-46382024 GCCCCCGGTGGGGAAGGGGACGG + Intronic
1082206002 11:49434599-49434621 GGCCACGCCGCGGAAGGCGCGGG - Intergenic
1083424474 11:62575960-62575982 GACCCCGGGAGGAACGGCGCTGG + Exonic
1083618323 11:64036887-64036909 GACCCCGGGGAGGAAGGCTGGGG + Intronic
1083747570 11:64744400-64744422 GAGCCAGGCGGGGACGGCTCTGG - Intronic
1084301657 11:68256449-68256471 GACAGCGGCGGGGGAGGAGCGGG - Intergenic
1084607482 11:70180991-70181013 GACCCCGATGGGGAAGGCTGAGG - Intronic
1085457011 11:76670918-76670940 GACCTCGGCCGGGAAGGGGCGGG + Intergenic
1085640240 11:78188785-78188807 GACACCGGCGGGGACGAGGCGGG - Exonic
1089810569 11:121128160-121128182 GAACTCGGAGGGGAAGGCGTAGG - Exonic
1090279874 11:125446409-125446431 CAACCCTGCGGGGTAGGCGCAGG - Intronic
1092538106 12:9405049-9405071 AGCCCCGGGGGGAAAGGCGCTGG - Intergenic
1095097597 12:38156638-38156660 GACCCCCCCGGGACAGGCGCAGG - Intergenic
1096605221 12:52760264-52760286 GACCCTGGAGGTGAAGGCCCAGG - Intergenic
1101493874 12:105235857-105235879 GCCCCCGGCCGGGCAGCCGCGGG - Intronic
1101982825 12:109422400-109422422 GTCCCCAGCAGGGAAGGGGCTGG - Intronic
1102029033 12:109729455-109729477 GCCTCTGGCGGTGAAGGCGCTGG - Intronic
1103410800 12:120710385-120710407 GGGCCCGGCGGGGAAGGGGCGGG - Intergenic
1103856005 12:123972224-123972246 GACCCCGCGGGGGCGGGCGCGGG + Intronic
1104929262 12:132329495-132329517 GGGGGCGGCGGGGAAGGCGCGGG + Intergenic
1106447581 13:29850345-29850367 GGCGGCGGCGGGGAAGGCGGAGG - Exonic
1106720010 13:32427554-32427576 CACGGCGGCGGGGAAGGGGCCGG + Intronic
1109006683 13:56886308-56886330 GAGCCCGGCTGGAAAGGCCCTGG + Intergenic
1111672644 13:91348635-91348657 GGCCACGGCGGGGAAGTTGCGGG - Intergenic
1112509483 13:99997341-99997363 GACCCCCGCGCGGATGGCCCAGG + Intergenic
1112692914 13:101916701-101916723 GGCACCGGAGGGGAAGGCGGCGG + Intronic
1113378208 13:109783232-109783254 GACGCCAGCAGGGGAGGCGCGGG + Exonic
1113473380 13:110562092-110562114 GACCGCAGCTGGAAAGGCGCTGG - Intergenic
1114648800 14:24270273-24270295 GACCCAGGCAGTGCAGGCGCAGG + Intronic
1114957796 14:27845645-27845667 GAGCCCGCAGGGGAAGGCGCGGG - Intergenic
1117353500 14:54902621-54902643 GGCACCGGCGGAGAAGCCGCGGG - Exonic
1118220718 14:63852937-63852959 GCGGCGGGCGGGGAAGGCGCGGG + Intergenic
1118576001 14:67241591-67241613 GAGCGCGGCGGGGGAGGGGCGGG + Intronic
1121408318 14:93732820-93732842 GAGCCCGGCGGGGCTGGGGCTGG + Intronic
1122544846 14:102516754-102516776 GCCCGAGGCGGGGAAGGGGCCGG + Intergenic
1122546410 14:102524970-102524992 GATCCCGGCGAGGGAGACGCGGG + Intergenic
1122904403 14:104795321-104795343 GGCCTGGGCGGGGAGGGCGCGGG - Intronic
1122905694 14:104800590-104800612 CGCCCCGGCGGGGAGGGCGCGGG - Intronic
1122935491 14:104954163-104954185 GACCCTGGAGGGGCAGGCACAGG - Exonic
1123781654 15:23634323-23634345 CACCCCAGCAGGGAAGGTGCAGG - Intergenic
1124248990 15:28095276-28095298 CACCCGGGCGGGGAGTGCGCAGG - Intronic
1124427121 15:29571141-29571163 GAGAGGGGCGGGGAAGGCGCAGG + Intergenic
1128264137 15:66253149-66253171 GACCCCGGCGGGGAAGGCGCCGG + Intronic
1128309629 15:66622177-66622199 GCCCACGGCCGGGAGGGCGCAGG - Intronic
1128451596 15:67808976-67808998 GACCCCGGCCAGGAAGACCCTGG + Intergenic
1128638767 15:69320053-69320075 CACCCCAACGGGGAAGGCTCTGG - Intronic
1130342534 15:83011606-83011628 ATCCCCGCCTGGGAAGGCGCCGG + Exonic
1132484001 16:180908-180930 GGCCCCGGCGGGGTGGGTGCGGG + Intronic
1132843657 16:1990330-1990352 GAGGCCGGCGGGGGAGGGGCCGG - Intronic
1132930320 16:2455692-2455714 CTCCCCGGCGGGGCAGGAGCTGG - Intronic
1133239902 16:4408094-4408116 GAGCCCTGTGGGGATGGCGCTGG + Intronic
1133464736 16:6018965-6018987 GACCGCGGCGGCGGCGGCGCTGG + Intergenic
1135335845 16:21600037-21600059 ACGCCCGGCGGGGAAGGCGCGGG - Intronic
1136129618 16:28211675-28211697 GACCCCCGCGGGGGAGGCTGCGG + Exonic
1137582300 16:49640798-49640820 GCCCCCGGGGGAGAAGGTGCTGG - Intronic
1137614515 16:49838775-49838797 GGGGCCGGCTGGGAAGGCGCAGG - Intronic
1137708017 16:50548613-50548635 GACCGCGGCGGCGACGGCGGCGG - Intronic
1137787381 16:51150528-51150550 AACCCCAGCGGGTCAGGCGCTGG + Intronic
1139528459 16:67530165-67530187 GAAGCGGGCGGGGAGGGCGCGGG + Intronic
1140096882 16:71883610-71883632 GGCCCCGGCGGGGACGGCCCCGG - Intronic
1141436705 16:84003807-84003829 GAGCCCTGAGGGGAAGGGGCAGG + Intergenic
1141959177 16:87392781-87392803 CACCCCGCCGCGGAGGGCGCGGG - Intronic
1142690971 17:1605896-1605918 GGACCCGGCCGGGAAGGCACAGG - Intronic
1142737248 17:1908714-1908736 GCAGCCGGCAGGGAAGGCGCGGG - Intergenic
1143007458 17:3846160-3846182 GGCCCCGGCGGGGCCGGCCCTGG - Exonic
1143500613 17:7336602-7336624 GACCTCCGCGGGGAAGGGCCTGG - Exonic
1144777924 17:17794084-17794106 GATCCCTGCGGGGAAGGCCCCGG - Exonic
1145094191 17:20009938-20009960 CACCCCGGCCAGGAAGGGGCGGG - Intronic
1146060100 17:29600440-29600462 GACCCAGGTAGGGAAGGGGCTGG + Intronic
1147331131 17:39700180-39700202 GGACCCGGCTGGGAGGGCGCGGG - Exonic
1147393322 17:40122811-40122833 CAGCCGGCCGGGGAAGGCGCGGG - Intronic
1147657370 17:42098494-42098516 GGGCCCGGCGGGGCAGGGGCGGG + Intergenic
1148401643 17:47367492-47367514 GACGCCGGCAGAGAAGGAGCCGG + Intronic
1150292293 17:63988706-63988728 GAGCCCTGCCGGGAAGGCGAGGG - Intergenic
1150802279 17:68291599-68291621 GACCCCGGCGGCGCTGGCGGGGG - Intronic
1152020733 17:77779063-77779085 GGCCCTGGCCGGGATGGCGCTGG + Intergenic
1152597776 17:81246310-81246332 GACCCCGCCAGGGAAGCCGGGGG - Exonic
1154230636 18:12553135-12553157 CACCACAGCGGGGAAGGGGCTGG - Intronic
1154294476 18:13136957-13136979 GAGCGCGGAGGGGAAGGTGCGGG - Intergenic
1155083496 18:22432762-22432784 GAACCCGGCAGGCAAGGCTCTGG - Intergenic
1156008622 18:32471130-32471152 GGCCTGGGCGGGGAAGGAGCCGG - Intergenic
1157762630 18:50275641-50275663 GACCAGGGCGGGGAGGGCGAAGG + Exonic
1160453463 18:78980205-78980227 GCGGCCGGCGGGGACGGCGCGGG - Intergenic
1160703301 19:518227-518249 GGCCCCGGCTGGGTAGGGGCTGG + Intronic
1160834720 19:1119305-1119327 GAGCCTGGCGGGGACGGGGCAGG + Intronic
1161175809 19:2841672-2841694 GGCCCCGGCGAGGGCGGCGCAGG + Intronic
1161597457 19:5157906-5157928 GACCCCGGAGGCGAAGGCTCTGG + Intergenic
1161990300 19:7680926-7680948 CACGCCCGCGGGGAAGGGGCCGG - Intronic
1162798242 19:13097662-13097684 GACCTCTGCGGGGGAGGGGCCGG - Intronic
1163700713 19:18785321-18785343 GGCCCGGGAGGAGAAGGCGCGGG - Intronic
1163845776 19:19637490-19637512 GGCCAGGGCGGCGAAGGCGCGGG + Exonic
1165349887 19:35269574-35269596 GCCCCAGGCGGGGACGGCCCAGG + Exonic
1165859191 19:38898387-38898409 GACCCAGGCAGGGAAGGTGCAGG - Exonic
1166358628 19:42242374-42242396 GAGCCCGGCGGCGGAGGCGGAGG - Exonic
1167797583 19:51719776-51719798 CACCCCGGCGGCGTAGGCCCAGG + Exonic
1168078182 19:53991794-53991816 GAACCCGACCGGGAAGGCCCTGG + Intergenic
1168335212 19:55593402-55593424 GGCCCCGAGGGGGCAGGCGCGGG - Exonic
926154933 2:10448421-10448443 GACACCGCCGGGGGAGGGGCGGG + Exonic
926285165 2:11482557-11482579 GAACCCGGGTGGGAGGGCGCAGG + Intergenic
927787262 2:25982452-25982474 GGCGGCGGCGGGGAAGGCGGAGG - Exonic
927888215 2:26731260-26731282 GACCCCGGCAGGGGAGGGGGTGG - Exonic
932492022 2:72128337-72128359 GACCCGGGCGGGGCAGAGGCTGG + Intergenic
932567456 2:72918536-72918558 GACCTACGCGGCGAAGGCGCGGG - Intronic
934479505 2:94622288-94622310 GAGCCCACGGGGGAAGGCGCGGG + Intergenic
935866468 2:107392559-107392581 GCCCACGGCGGGGTAGCCGCGGG - Intergenic
938537426 2:132257432-132257454 GACTCGGAAGGGGAAGGCGCGGG + Intronic
942045454 2:172097003-172097025 GCCCCCGGCGGGGCTGGAGCCGG + Intergenic
942450918 2:176107629-176107651 GGCCCCGGCGGGGGCGGCGGCGG + Exonic
943692415 2:190881639-190881661 GTTGCGGGCGGGGAAGGCGCGGG - Intronic
948479334 2:238240234-238240256 GACCCCCGCGGGGGCGGCACCGG + Intronic
948939653 2:241189495-241189517 GACCCCCGGGGCGAAGGTGCGGG + Intronic
1168894321 20:1313161-1313183 GACCCGGGCGGGGCTGGTGCTGG - Intronic
1169211737 20:3769551-3769573 GAACCCGGCGGGGGAGGGGGTGG - Intergenic
1171849814 20:30300408-30300430 GACCCGGGCGGGGCGGGCGGCGG - Intergenic
1171896846 20:30815913-30815935 GACCCCGAGGGCGAAGGCGCGGG - Intergenic
1172118110 20:32583683-32583705 GGTCCCGGCGGGGGAGCCGCGGG + Intronic
1172587125 20:36092739-36092761 GAGCCCGCCGGGGCAGCCGCCGG + Intronic
1172951979 20:38728185-38728207 GACCACGGCGCGGATGGAGCCGG - Exonic
1174204269 20:48827817-48827839 GAGCCCGGCGGCGACGGGGCCGG - Exonic
1174407175 20:50310079-50310101 GACCCCGGATGGGAAGAAGCTGG - Intergenic
1175447423 20:59032572-59032594 TACCCCGGCGGGGACGACGGGGG + Intergenic
1176286362 21:5021284-5021306 GAGGGCGGCGGCGAAGGCGCAGG - Intergenic
1177431702 21:20998291-20998313 GAGCCGGGCGGGGAGGGCGGCGG - Intergenic
1179870819 21:44242191-44242213 GAGGGCGGCGGCGAAGGCGCAGG + Intergenic
1179992005 21:44953101-44953123 GACCCCGCCTGGCAAGGCCCAGG + Intronic
1183525017 22:38317528-38317550 GCCCCCAGCGCGGAGGGCGCGGG - Intronic
1183913010 22:41092652-41092674 GACCTCGGCTGGGCAGGGGCCGG + Exonic
1184270341 22:43377647-43377669 GAGCCTGGCAGGGAAAGCGCTGG - Intergenic
1184557457 22:45240964-45240986 GGCCGGGGCGGGGAAGGGGCGGG - Intergenic
1184688597 22:46107465-46107487 GGCCCAGGCGGGGGAGGGGCCGG - Intronic
1184879398 22:47295439-47295461 GCCCCCAGCTGGGAAGGAGCAGG + Intergenic
1185055203 22:48575678-48575700 GGCCGCGGCGGCGGAGGCGCGGG + Intronic
1185418448 22:50722090-50722112 GTCCCCGCTGGGGAAGGGGCCGG + Intergenic
950517902 3:13479640-13479662 TACCCCGGCGGTGAGGGTGCGGG + Intergenic
951078547 3:18425274-18425296 GGCCCCGCTGGGGAAGGCTCCGG - Intronic
952316846 3:32238916-32238938 GACCCCGGCGGGTCTGGGGCTGG - Exonic
953982169 3:47418399-47418421 GGCCCGGGCGGCGGAGGCGCGGG - Exonic
954313219 3:49786297-49786319 GACGCCCGCGGGGAGGGCGGTGG - Intronic
964720402 3:159763926-159763948 GCCGCGGGCGGGGAAGGGGCGGG + Intronic
967924187 3:194633387-194633409 GGCGGCGGCGGCGAAGGCGCCGG + Exonic
968512962 4:1003364-1003386 GCCGCCGGCGGGTAAGGGGCGGG - Exonic
968904656 4:3445712-3445734 GACCCCGGCGGGGCCAGCCCGGG + Intronic
969714242 4:8860831-8860853 GACCCCGAGGGGTAAGGGGCCGG + Intronic
971916969 4:32883687-32883709 GACCTCAGCTGGGAAGGCGGCGG - Intergenic
972162635 4:36244693-36244715 GACCCCGCTGGGGAAGCTGCGGG + Intergenic
972396546 4:38663790-38663812 GACTCCGGGGAGGAGGGCGCGGG + Intergenic
973870081 4:55157726-55157748 GAGCCGGGCGGGAGAGGCGCGGG - Intergenic
975118562 4:70705141-70705163 TACCCCGGCGATGGAGGCGCCGG + Intronic
976226333 4:82798067-82798089 GACCGCGGCGGGGTGGGGGCGGG + Intronic
978443971 4:108763113-108763135 GGCCCCGGCGGGGGAGGAGGAGG - Intergenic
985444695 4:190015470-190015492 GACCCCGAGGGCGCAGGCGCGGG + Intergenic
985497604 5:218435-218457 GACCGGGGCGGGGCAGGCGGGGG + Intronic
985521104 5:374183-374205 GACCTCGGCGGGGAGCGCCCAGG + Intronic
985579933 5:691297-691319 GACCAAGGCCGGGAAGGGGCAGG - Intronic
985594780 5:783356-783378 GACCAAGGCCGGGAAGGGGCAGG - Intergenic
985708373 5:1414451-1414473 GGGCAGGGCGGGGAAGGCGCTGG + Intronic
985708390 5:1414489-1414511 GGTCAGGGCGGGGAAGGCGCTGG + Intronic
985737718 5:1594356-1594378 GACCGGGGCGGGGCAGGCGGGGG - Intergenic
987108703 5:14664882-14664904 GACGCCGGCGCGGGAGGCGGCGG + Exonic
997470579 5:134114919-134114941 GACTCCGGCGGGGGCGGCGCGGG + Exonic
999209160 5:149872684-149872706 GACCCTGCCGGGGAAGGCCTTGG + Intronic
999272158 5:150302838-150302860 GACCCCAGAGGGGAAGGGGAGGG + Exonic
1000337775 5:160254245-160254267 GACCCCGCTGGGGATGGAGCTGG - Intronic
1000358258 5:160421930-160421952 GGCTCCGGCGGGGAAGGAGGCGG + Exonic
1001576911 5:172770701-172770723 CACCACGGCGTGGTAGGCGCCGG + Exonic
1002350011 5:178577042-178577064 GACCCCGGCGGGGAGTCCTCAGG - Intronic
1004566147 6:16799645-16799667 GAGCCTGGTGAGGAAGGCGCTGG + Intergenic
1013556214 6:111259607-111259629 GGCCCCGGCGGAGAATGAGCCGG + Exonic
1013836547 6:114342199-114342221 GTCCCCGGCGGTGGCGGCGCGGG + Exonic
1013866078 6:114697848-114697870 GACCCTGGCAGGGAAGGGGAGGG - Intergenic
1018017866 6:159727772-159727794 GCCCCCGGCGGGTAAGGGGCGGG + Intronic
1019289855 7:245150-245172 GACCCGGCCGGGGAAGCCGAGGG + Intronic
1019509994 7:1412997-1413019 GACGCGGGCGGGGAGGGCGCCGG + Intergenic
1019577945 7:1746542-1746564 GGCCTCGGCTCGGAAGGCGCGGG - Exonic
1019925813 7:4191237-4191259 GACCGCGGCGGGGGAGGGCCTGG - Intronic
1021653575 7:22854094-22854116 GCCCAAGGCGGGGAAGGCCCGGG + Intergenic
1022531436 7:31069324-31069346 CACCCGGGCAGGGAAGGTGCAGG - Intronic
1026953807 7:74364408-74364430 GGCCCCCCCGGGGAAGGGGCTGG + Intronic
1027956073 7:84880802-84880824 GCCCACGGCGGGGGAGGCTCAGG - Intergenic
1028630323 7:92926807-92926829 GGCCCCGGTGGGGTAGGCACTGG + Intergenic
1029123196 7:98281728-98281750 GGCCCCGGCGGGGGACGCGGCGG - Exonic
1032240007 7:130153257-130153279 GGCTCCGGCGGGGAAGGGGCTGG + Intergenic
1034446085 7:151115013-151115035 GGCCCCGGCGGCCGAGGCGCGGG - Intronic
1034975909 7:155449246-155449268 TCCCCCGGCGGGGAAGGGGCCGG + Intergenic
1035021388 7:155803081-155803103 GACCGCGGCGGGGACAGCGGCGG - Exonic
1037305240 8:17497298-17497320 GGGGCCGGCGGGGAAGGAGCGGG + Intronic
1037803686 8:22048384-22048406 GCCCCCAGCTGGGAAGGGGCAGG + Exonic
1041016110 8:53594536-53594558 GCCCCCGGCCGGGAAGGAACTGG - Intergenic
1043873726 8:85463486-85463508 GACCCCGGCGCGGGTGGGGCGGG + Intergenic
1047100160 8:121667531-121667553 GCCCCCGGCGGGGGCGGGGCGGG + Intergenic
1049222362 8:141433914-141433936 GACACGGGAGGGGAAGGCGGTGG + Intergenic
1049693850 8:143974200-143974222 AGCCCCGGCGCGGAAGGTGCTGG + Intronic
1052362214 9:27573444-27573466 GCCCGCGGCGGCGGAGGCGCAGG - Intronic
1053142673 9:35690939-35690961 GGCTGCGGCGGGGAAGGCGGAGG + Exonic
1053239990 9:36487596-36487618 GACTCCGGCGCGGCAGGCGCTGG + Intergenic
1053678325 9:40461293-40461315 GAGCCCACGGGGGAAGGCGCGGG - Intergenic
1053749472 9:41237210-41237232 GACCCCGAGGGTGCAGGCGCGGG - Intergenic
1054254917 9:62802090-62802112 GACCCCGAGGGTGCAGGCGCGGG - Intergenic
1054285402 9:63163655-63163677 GAGCCCACGGGGGAAGGCGCGGG + Intergenic
1054291402 9:63296830-63296852 GAGCCCACGGGGGAAGGCGCGGG - Intergenic
1054389418 9:64601368-64601390 GAGCCCACGGGGGAAGGCGCGGG - Intergenic
1054506295 9:65915002-65915024 GAGCCCACGGGGGAAGGCGCGGG + Intergenic
1057470171 9:95349853-95349875 GACCCGGGCGGGGACAGAGCGGG - Intergenic
1057516861 9:95729262-95729284 GACCCGGGCGGTGGAGGGGCCGG - Intergenic
1059061423 9:111038314-111038336 GACCCCGGCGGGGTGGGCGCAGG - Intronic
1060831939 9:126722688-126722710 GACCCCCTCCGGGAAGGCCCCGG + Intergenic
1060897007 9:127224864-127224886 GAACCCCGCGGGGCTGGCGCGGG + Intronic
1061212674 9:129202922-129202944 GGCCCGGGCGGGGCGGGCGCTGG - Intergenic
1061472047 9:130834998-130835020 AGCCCCGGCGGGGAGGGTGCAGG - Intronic
1062052780 9:134456148-134456170 GACCGCGGCCGGGAAGGAGCAGG - Intergenic
1062332425 9:136050651-136050673 GCCCCCGGCGGGGGAGGAGGGGG - Intronic
1062427483 9:136512613-136512635 GACCCCAGCAGGGTGGGCGCCGG + Intronic
1062696115 9:137877378-137877400 GGACCCGGCGGGGACGGGGCGGG + Intergenic
1062696291 9:137877877-137877899 GGCCCCGGCAGGGAGGGCGCGGG - Exonic
1203376322 Un_KI270442v1:380932-380954 GACCCCGAGGGCGCAGGCGCGGG + Intergenic
1185877680 X:3713510-3713532 GACGACTGCGGGGAAGGCGGGGG + Exonic
1186463346 X:9765618-9765640 GAGGCCGGCGGGGACGTCGCGGG + Exonic
1187507291 X:19887805-19887827 GGCCGCGTCGGGGCAGGCGCCGG + Intergenic
1190598240 X:52067023-52067045 CACCAAGTCGGGGAAGGCGCTGG - Exonic
1190610584 X:52187050-52187072 CACCAAGTCGGGGAAGGCGCTGG + Exonic
1190681350 X:52829819-52829841 GACCCAGGCAGGGACGGCGTGGG - Intergenic
1191249576 X:58254006-58254028 GACCCCCGCGGGCATGGCACAGG + Intergenic
1191251980 X:58264125-58264147 GACCCCCGCGGGCCCGGCGCAGG - Intergenic
1191252349 X:58265598-58265620 GACCCCCGCGGGACCGGCGCGGG + Intergenic
1195033439 X:100948758-100948780 CACCCCTGTGGGGGAGGCGCAGG - Intergenic
1198051458 X:132956673-132956695 CACCCCGGCTGGGCAGGTGCTGG - Intronic
1198750513 X:139932835-139932857 GACCCCAGCGCGGGAGGGGCGGG + Intronic
1200267077 X:154652464-154652486 GACCAGGACAGGGAAGGCGCTGG - Exonic
1201489447 Y:14524780-14524802 CACCGCGGAGTGGAAGGCGCAGG - Intronic