ID: 1128264195

View in Genome Browser
Species Human (GRCh38)
Location 15:66253364-66253386
Sequence CAGGGGGTCCGGCAGGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128264195_1128264203 -4 Left 1128264195 15:66253364-66253386 CCTACATCCTGCCGGACCCCCTG 0: 1
1: 0
2: 1
3: 17
4: 175
Right 1128264203 15:66253383-66253405 CCTGGCGCTCCTGCAAGCCCCGG 0: 1
1: 0
2: 2
3: 28
4: 271
1128264195_1128264211 25 Left 1128264195 15:66253364-66253386 CCTACATCCTGCCGGACCCCCTG 0: 1
1: 0
2: 1
3: 17
4: 175
Right 1128264211 15:66253412-66253434 CCTACTCCCGGAGCCAAACTCGG 0: 1
1: 0
2: 0
3: 5
4: 56
1128264195_1128264206 13 Left 1128264195 15:66253364-66253386 CCTACATCCTGCCGGACCCCCTG 0: 1
1: 0
2: 1
3: 17
4: 175
Right 1128264206 15:66253400-66253422 CCCCGGCATCCACCTACTCCCGG 0: 1
1: 0
2: 0
3: 18
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128264195 Original CRISPR CAGGGGGTCCGGCAGGATGT AGG (reversed) Intronic
900995970 1:6123958-6123980 CAGCGGGGCTGGCAGGAGGTGGG + Exonic
901679725 1:10906099-10906121 CAGGGGGTCCCTGAGGATCTGGG + Intergenic
901794412 1:11672170-11672192 CAGGAGGTGCCGCAGGGTGTGGG - Intronic
902042957 1:13505825-13505847 CAGGGGCTCCGGCTGGATACTGG + Intronic
902880484 1:19368905-19368927 CAGGGTCTCTGGCAGGATGGGGG + Intronic
903978854 1:27170737-27170759 CAGGGGATCGGGCAGGAAGCTGG + Intergenic
904704379 1:32378970-32378992 TAGGGGGTCAGGCAGGGTGAAGG + Intronic
904893113 1:33794131-33794153 CAGGGTCCCTGGCAGGATGTGGG - Intronic
906677238 1:47701960-47701982 CTGGGGGTCAGGGAGGAGGTTGG - Intergenic
907512607 1:54972910-54972932 CAGGGGTTAAGGCAGGAAGTGGG + Intergenic
910879909 1:91913920-91913942 CAGGGGATCTGGCCAGATGTAGG + Intergenic
913275635 1:117135318-117135340 CAGGAGGTGCGGTAGGAGGTGGG + Intergenic
915339054 1:155166581-155166603 CAGGGGCTGGGGAAGGATGTTGG - Intergenic
916214914 1:162386079-162386101 CAGGGGGACGGGCAGGTTGTAGG - Intronic
919818285 1:201455861-201455883 CAGGGTGCCTGGAAGGATGTGGG - Intergenic
919926428 1:202194083-202194105 CAGGGGGCCGGGCAGGCGGTGGG - Exonic
922215929 1:223519998-223520020 CAGGGTGTCAGGCTGGATGTTGG - Intergenic
922278313 1:224099892-224099914 AAGGGGGTCAGGGAGGATGCAGG + Intergenic
924437475 1:244054946-244054968 CAGGTGGATCTGCAGGATGTGGG - Exonic
1067497437 10:46773505-46773527 CCGGGGGTCAGGCAGGAGGGGGG - Intergenic
1067597215 10:47566910-47566932 CCGGGGGTCAGGCAGGAGGGGGG + Intergenic
1067761969 10:49055191-49055213 CAGGGGGCCTGGAAGGATGTTGG - Intronic
1072460628 10:95615433-95615455 AAGGGGGCCCTCCAGGATGTTGG + Intronic
1072661042 10:97363694-97363716 CAGGCGGTCCAGAAGGTTGTGGG - Intronic
1074877577 10:117626101-117626123 CAGGGGGTGCTGCAGGAGATGGG + Intergenic
1075745052 10:124721275-124721297 CAGGGGACCTGCCAGGATGTGGG - Intronic
1075916237 10:126169951-126169973 CAGGGGGTCCTGCAAGATATCGG + Intronic
1076697815 10:132255614-132255636 CAGGGGGCCCTGCAGGAAGCAGG + Intronic
1076824258 10:132959333-132959355 CAGGGGGCCCGCCTGCATGTAGG + Intergenic
1076829175 10:132985730-132985752 CAGGGGGTCAGGAAGGGTCTAGG + Intergenic
1076846654 10:133072482-133072504 CAGGAGGTCCGGCTGGAGGGCGG + Intronic
1076888335 10:133272605-133272627 CTGGGGGTCAGGCAGGGTGGCGG + Intronic
1076921297 10:133455992-133456014 GATGGGGTCCTCCAGGATGTTGG + Intergenic
1077030370 11:462789-462811 CAGGGTGTCCAGAAGGCTGTGGG + Intronic
1077101054 11:822584-822606 CAGGGGCTCCGGCGGGAAGAGGG - Exonic
1077162597 11:1120600-1120622 CCTGGGGTCCTGCAGGATGTGGG - Intergenic
1077487159 11:2844321-2844343 CCGGGGGTGGGCCAGGATGTGGG - Intronic
1078432403 11:11298133-11298155 CAGGGTATCCTGCAGGATGGGGG - Intronic
1079078017 11:17395630-17395652 GACGGGGTCCTGCAGGATGATGG + Exonic
1085238600 11:75033687-75033709 CAGGTGGTCAGGAAGGATGCTGG + Intergenic
1088157618 11:106827884-106827906 CTGGGAGTCCGGCAGCATGAAGG - Intronic
1089518966 11:119051347-119051369 CTGGGGGTGAGGGAGGATGTGGG - Intronic
1091156966 11:133383075-133383097 CAGGGTGACCAGGAGGATGTTGG - Intronic
1092279549 12:7089205-7089227 CAGGGGATCCAGGAGGAAGTTGG + Intronic
1093633495 12:21437715-21437737 CTGGGAGTCCGGCAGCATGGAGG + Exonic
1095981856 12:47978632-47978654 CAGGGGGTCCAGCAGGACCTTGG + Exonic
1096519281 12:52174987-52175009 GAGGGGGCCAGGCAGGAGGTGGG + Intronic
1096756219 12:53802261-53802283 CAGGGGGTCAGGGAGGATCAAGG - Intergenic
1101609123 12:106274463-106274485 CATGGGGTCTGTCAGGAGGTGGG - Intronic
1104610805 12:130226179-130226201 CTGGGGGACCAGCAGGACGTGGG - Intergenic
1104862385 12:131930246-131930268 CGGCGGGTCCGGCAGGATTTAGG + Intronic
1105071300 12:133235767-133235789 AGGGGGGTCCGGGAGGATGAGGG - Exonic
1106792329 13:33168374-33168396 CAGGTGGTCCGGTGGGCTGTTGG - Intronic
1110733953 13:78912700-78912722 CAGGTGGTCAAGCAGGATGAGGG - Intergenic
1114550720 14:23531424-23531446 CAGGGAGGGCAGCAGGATGTGGG - Intronic
1119193834 14:72702522-72702544 AATGGTATCCGGCAGGATGTGGG - Intronic
1119204482 14:72783883-72783905 CAGGGGCAGCGGCAGGATGGGGG + Intronic
1119757845 14:77131400-77131422 CAGGGAGACCTACAGGATGTTGG - Exonic
1121334712 14:93070230-93070252 GAGGGGGCCCGGCAGCAGGTGGG + Intronic
1121417864 14:93791335-93791357 CAGGGGCGTCAGCAGGATGTGGG - Intergenic
1122112260 14:99510674-99510696 CAGGGGGGACGGCAGGAGGTGGG - Exonic
1122375139 14:101252276-101252298 CCGGGGGACAGGCAGGAAGTGGG + Intergenic
1122416070 14:101550094-101550116 CTGAGGGTCCGGGAGGAGGTGGG - Intergenic
1123880765 15:24676111-24676133 CTGGGGGTCCTGCCGGCTGTGGG + Exonic
1124223082 15:27866349-27866371 CAGGTGGTCTGGCAGGAGGGAGG + Intronic
1127259234 15:57316310-57316332 CATGGGCTCAGGGAGGATGTGGG + Intergenic
1128264195 15:66253364-66253386 CAGGGGGTCCGGCAGGATGTAGG - Intronic
1128666349 15:69540818-69540840 CAGCGGGGCTGGGAGGATGTGGG + Intergenic
1129152757 15:73699444-73699466 CAGGGGGCCCGGTGGGATATGGG + Intronic
1131056697 15:89379166-89379188 CGGAGGGTCCGGCGGGCTGTGGG - Intergenic
1131826915 15:96329746-96329768 CTGGGTGTGTGGCAGGATGTTGG + Intronic
1132578251 16:673785-673807 CTGGGGGTCCGGCAGGAGCCAGG - Exonic
1132655727 16:1041011-1041033 CTGGGGGTCTGGGAGGAGGTGGG - Intergenic
1132655843 16:1041370-1041392 CTGGGGGTCTGGCAGGAGGTGGG - Intergenic
1132727753 16:1346096-1346118 GAGGGGAGCCGGCAGGAGGTGGG + Intronic
1133018078 16:2954100-2954122 CAGAGGGGCTGGCAGGATGGGGG - Intergenic
1138532634 16:57643131-57643153 CATGGGGACTGGGAGGATGTGGG + Intronic
1139519208 16:67470680-67470702 GAGGGAGTCCGGCAGGCAGTTGG - Intronic
1140220695 16:73041667-73041689 CAGTGTGTGCGGCAGGAGGTTGG - Intronic
1141775956 16:86122647-86122669 ATGGGGGTCCAGCAGGAAGTCGG + Intergenic
1141812220 16:86383252-86383274 CTGGGGAGCCGGGAGGATGTGGG - Intergenic
1142679142 17:1535396-1535418 CAGGGGGCTGGGCAGCATGTGGG - Intronic
1143102535 17:4512369-4512391 CTGGGGGACAGGCAGGATCTTGG - Intronic
1143452365 17:7043486-7043508 CCGGGGGTCCGGCGGGCTGGGGG + Exonic
1144754028 17:17668707-17668729 CAGGGGGTGCGGGAGGGGGTGGG - Intergenic
1147522713 17:41189917-41189939 CAGGTGGTCCTGCAGCATGTAGG - Exonic
1147522816 17:41190535-41190557 CAGGTGGTCTGGCAGCAGGTGGG - Exonic
1147526249 17:41226685-41226707 CAGGTGGTCCTGCAGCAGGTAGG - Exonic
1147526787 17:41232532-41232554 CAGGTGGTCCTGCAGCAGGTAGG - Exonic
1147527292 17:41238082-41238104 CAGGTGGTCCTGCAGCACGTAGG - Exonic
1147528413 17:41249751-41249773 CAGGTGGTCCTGCAGCATGTAGG - Exonic
1147528935 17:41255416-41255438 CAGGTGGTCCTGCAGCAGGTAGG - Exonic
1147530423 17:41271341-41271363 CAGGTGGTCCTGCAGCATGTAGG - Intergenic
1147530836 17:41275728-41275750 CAGGTGGTCCTGCAGCAGGTAGG - Exonic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1150578092 17:66447713-66447735 CAGGGGGCCCTGGAGGCTGTTGG - Intronic
1152136438 17:78506664-78506686 CCTGGGGTCTGGCATGATGTTGG + Intronic
1155240335 18:23858331-23858353 AAGGGGTTCCGCCAGGTTGTAGG + Intronic
1158343157 18:56488030-56488052 CAGGGTATCTGGAAGGATGTGGG - Intergenic
1160133592 18:76251877-76251899 CGGGAGGTCCAGCAGGATGGAGG - Intergenic
1162767248 19:12927308-12927330 CATGGGGGCAGGCAGGGTGTGGG + Intronic
1163444987 19:17340886-17340908 CCAGGGGACCGGCAGAATGTTGG - Intronic
1164562012 19:29299138-29299160 CAGGTGGGCTGGCAGGAGGTGGG - Intergenic
1165232008 19:34393176-34393198 CAGGGTTTCCGGCAGGAGGTGGG + Intronic
1165895518 19:39138901-39138923 CTGGGGGGCTGGCAGGATATGGG + Intronic
1166931336 19:46303465-46303487 CAGGGGGCCTGGGAGGCTGTAGG + Intronic
925314361 2:2909723-2909745 CAGGGGGTGCTGGAGGAAGTGGG + Intergenic
930279341 2:49351653-49351675 CAAGGTGTGGGGCAGGATGTAGG - Intergenic
931853378 2:66276181-66276203 CCTGGGGCCCTGCAGGATGTTGG + Intergenic
932344492 2:70986747-70986769 CAGGTGATCAGGAAGGATGTTGG + Exonic
934715434 2:96540346-96540368 GAGGGGGTGCGGCAGGGTGCTGG - Intronic
935259859 2:101344646-101344668 CAGGGGGTGGCCCAGGATGTGGG + Intergenic
936953710 2:118003614-118003636 CAGGGGGTTAGGCTGGATGGTGG - Intronic
937227937 2:120380449-120380471 CTGGGGGCCCTGCAGGATGCTGG - Intergenic
938110349 2:128560089-128560111 CAGGTGGGCAGGCAGGCTGTGGG + Intergenic
938201240 2:129374642-129374664 CAGGTGGCCTAGCAGGATGTGGG - Intergenic
939034719 2:137116989-137117011 CAGGGGGAAAGGCTGGATGTGGG + Intronic
942813599 2:180025086-180025108 CAGGAGGTCATGCAGGATTTCGG + Intergenic
944499163 2:200340572-200340594 GAGGGGGTGCAGCAGGAGGTGGG + Intronic
944537434 2:200725086-200725108 CAGAGGGTCCAGCAGGAAGAGGG + Intergenic
947471672 2:230406487-230406509 TAAAGGATCCGGCAGGATGTAGG + Intergenic
947933787 2:233985826-233985848 CAGGTTGACCAGCAGGATGTTGG - Exonic
948150949 2:235744323-235744345 GAGGGGCTCTGGCAGGAGGTGGG + Intronic
948219675 2:236259682-236259704 CAGTGAGCCCAGCAGGATGTTGG + Intronic
1170572834 20:17642090-17642112 CAGGGGTCCCGGCAGGCTGATGG - Intronic
1172696758 20:36828278-36828300 CAGGGGGTTCTGCAGAATGCCGG - Intronic
1173314344 20:41930140-41930162 GAGGGGGTGAGGCAGCATGTGGG + Intergenic
1175727778 20:61331559-61331581 CAGGTGGTCAGGCAGGAGGTGGG - Intronic
1175998616 20:62822143-62822165 CAGGGGGTCCGGGAGGTCCTGGG - Exonic
1176011647 20:62900099-62900121 CAGGGGGCCCAGCAGCGTGTAGG - Intronic
1176228775 20:64019713-64019735 GAGGGGGTCAGGGAGGATGCCGG - Intronic
1178431309 21:32520770-32520792 CAGGGTGGCAGGCAGGAAGTGGG - Intergenic
1178793492 21:35722089-35722111 CAGGGAGTCAGGGAGGATGCTGG - Intronic
1179409665 21:41153048-41153070 CAGAGTGGCCAGCAGGATGTGGG + Intergenic
1179510086 21:41866851-41866873 CAGGTGGTCCAGCCGGATCTGGG - Intronic
1180160724 21:45997714-45997736 CAGGGGGTCCGGCAGGTCCTGGG - Exonic
1181150364 22:20878818-20878840 TAGGGGGCTCAGCAGGATGTCGG + Intronic
1184943261 22:47783836-47783858 CTGAGGGGCCTGCAGGATGTGGG + Intergenic
1185092039 22:48781070-48781092 CTGTGGGTCCCGCAGGATGGGGG - Intronic
1185176394 22:49329697-49329719 CAGGGGCTCAGGCATGAAGTTGG - Intergenic
951736952 3:25877115-25877137 CAGGTGGTCAGGCAGGAGGCAGG - Intergenic
954364654 3:50139516-50139538 CAGGGGGTCAGGTGGGTTGTAGG - Intergenic
954538530 3:51378958-51378980 CAGTGGGTCCAGCTGGATCTGGG + Intronic
954719663 3:52550565-52550587 CAGGGGGTCCAGCTGGATGTGGG + Exonic
955992494 3:64642886-64642908 CAGGGGGTGGGGCAGTATGCAGG + Intronic
961360064 3:126361361-126361383 TAGGGGGCCCAGCAGGATGACGG + Intergenic
964365827 3:155950020-155950042 AAGGGGGTCGGGGAGGGTGTGGG - Intergenic
968126469 3:196163956-196163978 CTGTGGGTCCCGCAGGAGGTGGG - Intergenic
968554095 4:1238630-1238652 CAGAGGGTCTGGGAGGATCTCGG - Intronic
969309865 4:6346965-6346987 CAAGGGGCCAGGCAGGAGGTGGG - Intronic
969459887 4:7323525-7323547 CAGGAGGGCTGGGAGGATGTGGG + Intronic
969484862 4:7466607-7466629 CACGGGGTCCTGTAGGAGGTGGG + Intronic
969657827 4:8508327-8508349 CAGGGGCTGCGGCTGGAGGTTGG + Intergenic
971525597 4:27613817-27613839 TAGGGTGCCAGGCAGGATGTGGG - Intergenic
973330559 4:48906912-48906934 CAGGGGTTCCGGCAAGAGCTGGG - Intronic
982354674 4:154453158-154453180 CAGGAGCTCCAGCTGGATGTGGG - Intronic
985705903 5:1401204-1401226 TAAGGGGACCGTCAGGATGTTGG - Intronic
989027700 5:37086388-37086410 CAGGGGTTCAGTCAGGATGGTGG + Intergenic
990864751 5:60368407-60368429 CAGGGAGGTTGGCAGGATGTGGG + Intronic
994251543 5:97542189-97542211 CAGGAGTTCCGGGTGGATGTGGG - Intergenic
994664994 5:102695251-102695273 AAGGGGGTCCTGCAGAATGAGGG + Intergenic
1001300719 5:170531782-170531804 CAGGGGGTGGGGCATGAGGTGGG - Intronic
1001559568 5:172660230-172660252 CAGGGGGCCCGGCAGAGGGTCGG + Intronic
1002131806 5:177086769-177086791 GAGGGGGTGTGGCAGGAGGTGGG + Intergenic
1003961546 6:11213608-11213630 CAGGGGGACTGGAAGGATGGTGG - Exonic
1004999745 6:21229034-21229056 CAGGGAGACCAGCAGGATATCGG + Intronic
1005098475 6:22144221-22144243 CAGGGAGTAGGGCAGGATTTAGG - Intergenic
1007072862 6:39049287-39049309 GAGGGAGTCCGGGAGGATGCCGG - Intronic
1015826359 6:137316804-137316826 CAGTGGTTCTGGCAGGAGGTAGG - Intergenic
1017597713 6:156047018-156047040 CAGGTGGTCAGGCAGGAGGAAGG - Intergenic
1017873056 6:158502668-158502690 CAGGGGGGCCCGCGGGCTGTCGG - Exonic
1017962651 6:159234448-159234470 AAGAGGGTCTGGCAGGCTGTCGG - Exonic
1019901129 7:4021488-4021510 CAGGGGGTTGGGCAGTAGGTGGG + Intronic
1022662802 7:32382222-32382244 CAGGGAGTCAGGCAGGATGGCGG - Intergenic
1023989413 7:45119238-45119260 CAGGAGGTCCTGCAGGCTGGAGG - Intergenic
1029201269 7:98840647-98840669 GAGGGGGTCAGGGAGGAGGTGGG + Intergenic
1029201288 7:98840747-98840769 AAGGGGGTCAGGGAGGAGGTGGG + Intergenic
1029283064 7:99449117-99449139 CAGGGAGCCCGGCAGGAGGCTGG + Intronic
1031529806 7:122862620-122862642 CAGAGGGTTGGGCAGGATTTAGG - Intronic
1033200379 7:139363087-139363109 CAGGGGGACTGCCAGGAGGTGGG + Intronic
1044699373 8:94952036-94952058 CAGGGGGTCAGCCTGGAAGTGGG - Intronic
1049140364 8:140949333-140949355 CAGTGGGGCTGGCAGGAGGTGGG + Intronic
1056615496 9:88161787-88161809 CAGGGGGTGGGGGAGGTTGTGGG + Intergenic
1056731061 9:89167104-89167126 CTGGGGGTCCAGCAGGAGGGAGG + Intronic
1057076635 9:92141531-92141553 CAGGGGGCCGGGCAGGCGGTAGG - Intergenic
1060155442 9:121317000-121317022 CAGGGGGTGGGGCAAGATGGTGG + Intronic
1060200373 9:121648928-121648950 CAGGGGCGCCGGCGGGAGGTGGG + Intronic
1060556891 9:124512663-124512685 CAGGGGCTCTAGCAGGCTGTGGG - Intergenic
1061506043 9:131032340-131032362 CAGGGGACCCGGCAGGAGGTGGG - Intronic
1061846377 9:133390801-133390823 CAGGGGCTCCCCCAGGTTGTGGG + Intronic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1192225367 X:69223744-69223766 CAGGAGCTTCGGGAGGATGTAGG - Intergenic
1192980443 X:76334154-76334176 GAGGGGGTTGGGGAGGATGTAGG + Intergenic
1200125711 X:153813431-153813453 CAGGAGGACCAGGAGGATGTGGG + Intronic