ID: 1128271512

View in Genome Browser
Species Human (GRCh38)
Location 15:66314360-66314382
Sequence ATTCAACTCCACCACTTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128271512_1128271514 -3 Left 1128271512 15:66314360-66314382 CCTGGTAAGTGGTGGAGTTGAAT 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1128271514 15:66314380-66314402 AATTTGTAGCCAAGGCAGTTTGG 0: 1
1: 1
2: 3
3: 39
4: 558

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128271512 Original CRISPR ATTCAACTCCACCACTTACC AGG (reversed) Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
905460489 1:38119667-38119689 ATTCTACTGCACCACATGCCTGG - Intergenic
907167047 1:52422108-52422130 ATTTAAGTCCACCACTTAATAGG + Intronic
909545888 1:76845836-76845858 TTTCAGCTCCACCCCTTTCCTGG - Intergenic
915958867 1:160247183-160247205 ATTAAACTCCTCCAACTACCTGG - Intronic
923265804 1:232312963-232312985 AATCAACTCCACCGCTTGACAGG + Intergenic
1062993774 10:1846109-1846131 TTGCAGCTCCACCACTTACAGGG - Intergenic
1063450565 10:6147485-6147507 ATTAAACTCCTCGACTTGCCTGG - Intronic
1063465991 10:6244991-6245013 TTTAAACTCCACCACTTTACAGG + Intergenic
1065665857 10:28059699-28059721 ATTCAACACCATCACTCTCCTGG + Exonic
1067525355 10:47035273-47035295 GGTCACCTCCACCACTTCCCTGG + Intergenic
1074119801 10:110485551-110485573 ATTCAATTCTACCCCTTTCCTGG - Intergenic
1079108223 11:17587907-17587929 ATTCACTTCCATCACTTCCCTGG + Intronic
1085514862 11:77106135-77106157 ATCCAACCCCACCACTCTCCTGG + Intronic
1085876914 11:80418691-80418713 ATCTAGCTCAACCACTTACCAGG + Intergenic
1092017277 12:5169858-5169880 CTACAACTCCACAACTTAACAGG + Intergenic
1092423597 12:8355320-8355342 AGTCAACTCCTCCACTCACCAGG + Intergenic
1092961289 12:13598815-13598837 GTTCTACCCCACCACTTCCCTGG + Intronic
1103079716 12:118014092-118014114 ATTCAAATGCACCATTTTCCTGG + Intronic
1103154913 12:118676168-118676190 GTTCAATTCCACCACATGCCTGG + Intergenic
1104342274 12:127961579-127961601 ATTAAACACGACCAATTACCAGG + Intergenic
1106337287 13:28795807-28795829 ATTGATCTCCACCACGTTCCTGG - Intergenic
1107410980 13:40158590-40158612 ATTCAACTCCACCTCTTGATGGG + Intergenic
1109163665 13:59007294-59007316 ATTCAACTTGACCTCTTACAGGG - Intergenic
1110203220 13:72878639-72878661 ATTCAACACCACCAATCAACAGG - Intronic
1115229063 14:31138523-31138545 CTCCAACTCATCCACTTACCAGG + Intronic
1115718639 14:36134824-36134846 ATTCAGTTCCACAAATTACCTGG + Intergenic
1116535957 14:46030373-46030395 ACTCAATGCCACCACTTACCAGG - Intergenic
1117233292 14:53744377-53744399 ACTCAACTCCATCCCTCACCAGG + Intergenic
1121823868 14:96994385-96994407 TCTCAGCTCTACCACTTACCAGG + Intergenic
1126562714 15:50061037-50061059 ATTCAACTCCACGACCTACTGGG - Intronic
1128271512 15:66314360-66314382 ATTCAACTCCACCACTTACCAGG - Intronic
1129797159 15:78386601-78386623 ACTCCACTCCCCCACTTTCCTGG + Intergenic
1132673092 16:1109761-1109783 ATTCACCTTCACCACCCACCCGG + Intergenic
1135510273 16:23076848-23076870 ATTTAACTTCACAACTCACCCGG - Intronic
1137937888 16:52652049-52652071 TTCCAACTTCACCACTTAACTGG + Intergenic
1141348794 16:83274007-83274029 CTTCCTCTCCACCACTTACCTGG + Intronic
1142756522 17:2019532-2019554 TTTCAACTCCACCACTGGCCAGG + Intronic
1142933546 17:3308814-3308836 CTCCAACTCCACCCCTTCCCTGG + Intergenic
1144250231 17:13408988-13409010 AGTCAACTCCACCTCTTATTGGG + Intergenic
1145265775 17:21378931-21378953 ATACCCCTCCACCACTTCCCAGG - Intronic
1151406733 17:73892479-73892501 ATTAGCCTCCACCACTCACCTGG + Intergenic
1156008097 18:32467443-32467465 ATTCCACTCCACCATTTACTAGG + Intronic
1158297829 18:56018600-56018622 CATCACCTCCACCACTTACTAGG + Intergenic
1160249079 18:77185648-77185670 ATCCAACTCCCCCATTTAACAGG - Intergenic
1167408238 19:49328516-49328538 AATCAACACCATCACTTGCCTGG - Intergenic
926660888 2:15464746-15464768 ATTCAATTCAACTACTTACATGG + Intronic
928249259 2:29660478-29660500 ACTCAACTCCACCAATCCCCAGG + Intronic
928863219 2:35885659-35885681 ATTTATCTCCACCACTATCCTGG - Intergenic
929819602 2:45262680-45262702 ATTCACCTCCACCTCCTCCCAGG + Intergenic
929957215 2:46467222-46467244 GTTCACATCCAGCACTTACCAGG + Intronic
933242898 2:79942704-79942726 TCCCAACTCCACCACTTACTGGG - Intronic
933685949 2:85141322-85141344 CTTTAACACCACCACTTGCCTGG - Intronic
936248718 2:110851100-110851122 AGTCAACTCCTCCACCCACCTGG - Intronic
937954555 2:127414830-127414852 ATCCCACTCCACTTCTTACCAGG + Intergenic
938769478 2:134488875-134488897 AATCAACTTCACCAATAACCAGG + Intronic
942869999 2:180722984-180723006 CTTCAACTCCAGCACTGCCCAGG + Intergenic
943466491 2:188235468-188235490 ATAGTACTCCACCACTTACTGGG - Intergenic
944395713 2:199263692-199263714 ATTCAACTCCTCCACATGCCTGG - Intergenic
1174718099 20:52781707-52781729 AATCAAATCCTCCACTTACAAGG - Intergenic
1177646058 21:23900762-23900784 ATTAATCTCCACCATTTTCCTGG - Intergenic
1180732222 22:17990669-17990691 ATTTAGCTCCACCATTTACCGGG + Intronic
1181516910 22:23419668-23419690 ATTTAGCTCCGCCATTTACCAGG + Intergenic
1182779631 22:32857550-32857572 AATTAGCTCCACCACTCACCTGG + Intronic
1183291167 22:37002785-37002807 ATCCAACTCCAGTACTTCCCAGG - Intronic
1185227044 22:49659157-49659179 ATTCAACTCCAGCATTCTCCTGG - Intergenic
949622304 3:5827400-5827422 ATTAAACTTCACTACCTACCAGG - Intergenic
950369353 3:12515248-12515270 CTTCCACCCCACCACTAACCCGG - Intronic
952054391 3:29426986-29427008 ATCCAGCTCCACCACTAACTAGG - Intronic
953017449 3:39091827-39091849 ATACAATTAAACCACTTACCAGG + Intronic
960808825 3:121609506-121609528 ATTCAACCTCACAACTAACCTGG - Intronic
961829545 3:129616407-129616429 AGCCACCTCCACCACATACCAGG - Intergenic
964378192 3:156070213-156070235 ATTCAACTTCACTAGTAACCAGG - Intronic
966092635 3:176158871-176158893 TTTCAACTCCACCTCTTAGGAGG - Intergenic
971269814 4:25131628-25131650 ATTCAACTACTCCACTTACAGGG + Intronic
974775600 4:66476630-66476652 ATTCAAATCACCCACTCACCTGG + Intergenic
977003873 4:91540950-91540972 ATTCAACTTCAAGACTTACTAGG - Intronic
979616000 4:122743500-122743522 ATTCAACTGCACCACCTCCAAGG - Exonic
982549497 4:156779914-156779936 AGTCAACTCCACCACAGAGCAGG + Intronic
986832354 5:11593823-11593845 AATCAACTTCACTACTCACCAGG + Intronic
989564123 5:42884553-42884575 ATTCACTTTCACCAGTTACCAGG + Intronic
992623206 5:78613782-78613804 ATCCAGCTCTACCACTTACTTGG + Intronic
994078972 5:95685070-95685092 TTTCAATTCTATCACTTACCAGG + Intronic
1001868192 5:175124210-175124232 ATTAAATTTCATCACTTACCAGG + Intergenic
1006668536 6:35715272-35715294 ATCCCACTCCGCCACTTACTAGG + Intronic
1011686932 6:89830813-89830835 TTTCAGCTCTGCCACTTACCAGG + Intronic
1015058871 6:128938128-128938150 TTACAACTTCACCACTTACAAGG + Intronic
1019748932 7:2716749-2716771 AGTCAACTCCACCGCTTAAGGGG + Intronic
1021599200 7:22347877-22347899 TTTCAGCACCACCACCTACCAGG + Intronic
1023668401 7:42550248-42550270 ATTCAATGACACAACTTACCTGG - Intergenic
1026483157 7:70796111-70796133 AATCAGCTCCTCCCCTTACCAGG - Intergenic
1027617775 7:80444687-80444709 ATTAATCTCTACCACGTACCAGG + Intronic
1027733638 7:81905987-81906009 ACTCAAAACCACAACTTACCTGG + Intergenic
1031713709 7:125080810-125080832 ATTGTTCTCAACCACTTACCAGG - Intergenic
1031927129 7:127649748-127649770 CTTCAAACCTACCACTTACCTGG - Intergenic
1044114931 8:88324371-88324393 CTTCAAATCCCCCACTTCCCTGG + Intronic
1050301848 9:4266794-4266816 ATTCAACTTCACTACTGAACAGG + Intronic
1060878192 9:127098629-127098651 GATCACCTCCAACACTTACCAGG - Intronic
1190261787 X:48802155-48802177 ACTTAACTCCACCCCTTATCGGG - Intronic
1193291503 X:79778077-79778099 ATTTAACTCCACCCTTTTCCAGG + Intergenic
1193883908 X:86961041-86961063 ATTCAACTCACCCATTTCCCTGG + Intergenic
1195877560 X:109557977-109557999 CTTCAACTCCAGCCCTTACAAGG - Intergenic
1198541207 X:137641850-137641872 ATTCAACTCCACATTTTCCCTGG - Intergenic
1199926180 X:152466909-152466931 GTTCAACACCACCAATTATCAGG + Intergenic