ID: 1128276299

View in Genome Browser
Species Human (GRCh38)
Location 15:66356594-66356616
Sequence ATGAAGTTCTTGCGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128276299_1128276310 18 Left 1128276299 15:66356594-66356616 CCCTCTCCCCGCAAGAACTTCAT 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1128276310 15:66356635-66356657 TCACCTCACGCAGAAAACACGGG 0: 1
1: 0
2: 0
3: 10
4: 123
1128276299_1128276309 17 Left 1128276299 15:66356594-66356616 CCCTCTCCCCGCAAGAACTTCAT 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1128276309 15:66356634-66356656 CTCACCTCACGCAGAAAACACGG 0: 1
1: 0
2: 0
3: 11
4: 176
1128276299_1128276312 29 Left 1128276299 15:66356594-66356616 CCCTCTCCCCGCAAGAACTTCAT 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1128276312 15:66356646-66356668 AGAAAACACGGGACACAGCGCGG 0: 1
1: 0
2: 1
3: 29
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128276299 Original CRISPR ATGAAGTTCTTGCGGGGAGA GGG (reversed) Intronic
904701881 1:32362593-32362615 ATGAAGTCCTTGGGGAGAAAAGG + Exonic
907217499 1:52877781-52877803 ATGAAGTGCTTGCAGGCAGCTGG - Exonic
908748653 1:67399179-67399201 ATGCAGTTTTTCGGGGGAGAAGG + Intergenic
909190945 1:72550423-72550445 ATGAAGTTTTTGGGGGCAAAGGG - Intergenic
910689949 1:89955455-89955477 ATGAAGGTCTTCAGGGAAGAGGG - Intergenic
914786682 1:150839490-150839512 ATGAAGTCCTTGCGGGGAACTGG - Exonic
915994954 1:160552815-160552837 AGGAAGTTCTTGGGTGGACATGG + Intronic
921326776 1:213992808-213992830 AAGAAGTTATTTCGGGGAGGAGG - Intronic
921618843 1:217304237-217304259 ATAAAGTTCATGCAAGGAGAAGG - Intergenic
923276232 1:232399371-232399393 ATGTACTTTTTGAGGGGAGAAGG + Intronic
923550533 1:234959561-234959583 AAGAAGAGCTTCCGGGGAGAGGG - Intergenic
924447702 1:244149293-244149315 ATCAAGGTCTTGCTGGGAGAGGG - Intergenic
924920925 1:248628316-248628338 AGGAGGTGCTGGCGGGGAGAGGG - Intergenic
1063209343 10:3864687-3864709 TGGAAGTTCTTGCGGGGACTGGG - Intergenic
1064500157 10:15962640-15962662 GTGAACTTTTTGCGGGGAGGAGG + Intergenic
1064973394 10:21088974-21088996 GTGAAGCTCTAGAGGGGAGATGG + Intronic
1070761143 10:79025105-79025127 CTGATGTTCATGCAGGGAGAAGG + Intergenic
1074978275 10:118598373-118598395 ATGATGTGCTGGCTGGGAGAGGG - Intergenic
1076576311 10:131472039-131472061 TTGAAGTTCTTGGTGGGGGAAGG + Intergenic
1078011721 11:7577477-7577499 TTGGAGTTCTTGAGGGGGGAGGG + Intronic
1080708248 11:34719952-34719974 GTGAAGTTCTTGAGTGGTGAGGG + Intergenic
1085165977 11:74399389-74399411 AGGAAGTTGTTGAGGGAAGATGG + Intergenic
1085647877 11:78239684-78239706 ACGAAGTTCTTTTGGTGAGAAGG + Intronic
1086184779 11:83999673-83999695 ATGAAGTTCTACTGGGGAGTGGG - Intronic
1089699736 11:120237439-120237461 ATGGAGTTCTTGTGGGGATTGGG - Intronic
1090242764 11:125195665-125195687 GTGAAGTTCTTGTGGGGCAAGGG + Intronic
1090584627 11:128197605-128197627 ATAAAGCTATTGGGGGGAGAGGG + Intergenic
1093589518 12:20884436-20884458 ATGAAGGGCTTTCAGGGAGAGGG + Intronic
1093603146 12:21055468-21055490 ATGAAGGGCTTTCAGGGAGAGGG + Intronic
1095857959 12:46882000-46882022 ATTGAGTTCTTTTGGGGAGAAGG - Intergenic
1097323049 12:58246647-58246669 ATGAAGGTCTTCCAGGGAGAAGG - Intergenic
1097385338 12:58944087-58944109 ATGAAGTTCTTGCCTGGGCATGG - Intergenic
1099313273 12:81054243-81054265 ATCATGTTCTTGCAGGGACATGG + Intronic
1099506034 12:83477218-83477240 AAGAAGTTGTGGCGGGGAGGAGG - Intergenic
1102908326 12:116694322-116694344 ATGAGGGTGTTGCGGGGAGGGGG - Intergenic
1108448695 13:50537057-50537079 ATGAACTTCTTATGGGGAGAGGG - Intronic
1108449666 13:50548492-50548514 AGGAAGGTCATACGGGGAGAAGG + Intronic
1112434986 13:99385430-99385452 CTGATGTTCTTGTGGGAAGAGGG + Exonic
1116478320 14:45367037-45367059 ATGAAGGTCTTCAAGGGAGAAGG - Intergenic
1117875300 14:60245804-60245826 ATGAATTTCATTCAGGGAGAGGG - Exonic
1118009447 14:61594468-61594490 ATGTAGTAGTTGTGGGGAGATGG + Intronic
1120034490 14:79681050-79681072 ATGCAGTTCCTGAGAGGAGAGGG - Intronic
1122063200 14:99150923-99150945 AGGGAGCTCTTGCGGGGTGATGG - Intergenic
1124063492 15:26318107-26318129 GTGAAGTCCCTGTGGGGAGATGG + Intergenic
1126049505 15:44673464-44673486 GTGAAGTTCTTGAGGGGAAAAGG - Intronic
1127959777 15:63882205-63882227 ATGAGGGTCTTCCAGGGAGATGG + Intergenic
1128276299 15:66356594-66356616 ATGAAGTTCTTGCGGGGAGAGGG - Intronic
1139939972 16:70598202-70598224 AGGAAGTTCTGGGGGGCAGACGG - Intronic
1141795630 16:86271678-86271700 AGGAAGTGTTTGTGGGGAGAGGG + Intergenic
1143066894 17:4256562-4256584 ATGCAGATCTTGGGGGGAGTCGG + Intronic
1144175179 17:12698400-12698422 ACCAAGTTCTTGAGGTGAGAGGG + Intronic
1144410060 17:14992118-14992140 ATGAACTGCTTCAGGGGAGAAGG + Intergenic
1144903915 17:18624778-18624800 ATGAAGTTCTTAAGGGTGGAAGG + Intergenic
1148604077 17:48915681-48915703 ATGGAGTTAGTGAGGGGAGAGGG - Intronic
1149293891 17:55243204-55243226 ATGAAGTTTTTTTGGGGGGATGG - Intergenic
1150873101 17:68936986-68937008 TTGAAGTTCTTGCTAGGACATGG - Exonic
1151941955 17:77298294-77298316 ATGAACTTAGTGAGGGGAGATGG - Intronic
1152058839 17:78053280-78053302 ATAAAGTACTTGGGGGGATAAGG + Intronic
1155542375 18:26881922-26881944 ATGTAGTTCAGGTGGGGAGAGGG - Intergenic
1158015685 18:52780752-52780774 GTGAAGGTCTTCAGGGGAGAAGG + Intronic
1158607936 18:58912465-58912487 ATGAAGCTCTTGTGCTGAGAGGG + Intronic
1160340554 18:78085456-78085478 AGGAAGTCCTTGCGGGCAGCAGG - Intergenic
1161625222 19:5322552-5322574 AGGCAGTGCTTGCGGGGAGCAGG - Intronic
1162625612 19:11882199-11882221 TTGGAGTTCTTTAGGGGAGAGGG - Intronic
1162823185 19:13235720-13235742 ATGAAGTTATTCTGGGGAGATGG + Exonic
1163382294 19:16977060-16977082 ATAAAGTTGTTGCAGGGAGGGGG + Intronic
1163583453 19:18151867-18151889 ATGGAGTACTCGCAGGGAGAGGG - Intergenic
1165972685 19:39645827-39645849 ATGATGTATTTGCTGGGAGAAGG - Intergenic
1166565116 19:43760045-43760067 AAAAAGTTCTAGCGGGGAGGGGG + Intergenic
1167265460 19:48480844-48480866 ATGCAGTTCATCCGGGGAGGCGG - Intronic
925590404 2:5503482-5503504 ATGAAGTTCTTCAAGGAAGAAGG - Intergenic
930127653 2:47815324-47815346 ATGAGGATCTTCCAGGGAGAAGG + Intronic
932184192 2:69677879-69677901 ATGAGGGTCTTCAGGGGAGAAGG - Intronic
932617005 2:73238900-73238922 ATGAAGCCCTTACGGGGATAGGG + Intronic
937000898 2:118466672-118466694 ATGGAGTCCTTGCTGGCAGAGGG + Intergenic
937036748 2:118788485-118788507 AAGAAGATCATGTGGGGAGAGGG - Intergenic
937700368 2:124857110-124857132 ATGAAGTTGTGGGGTGGAGATGG + Intronic
939610936 2:144310080-144310102 ATAAAGTAGTTGCAGGGAGAGGG + Intronic
940036385 2:149316176-149316198 TTGATGTTCCTGCAGGGAGATGG - Intergenic
941010819 2:160297648-160297670 AGGAGGTCCTTGCAGGGAGAAGG + Intronic
941065049 2:160892446-160892468 ATCAAGTTCTTGAGGGGAGGAGG - Intergenic
941877292 2:170447053-170447075 ATGAGGGTCTTCAGGGGAGAAGG + Intronic
942961548 2:181835322-181835344 ATGAAATTCTGGCTGGCAGATGG - Intergenic
943082007 2:183267052-183267074 ATGAGGGTCTTCCAGGGAGAAGG + Intergenic
945796962 2:214377156-214377178 ATGAACTGCTCACGGGGAGATGG - Intronic
946510972 2:220355925-220355947 ATGAATTTTTTGCAGGGAGCTGG + Intergenic
947121103 2:226816159-226816181 AAGAAGTTCATGGGGGAAGAAGG - Intergenic
947404577 2:229761653-229761675 ATGCAGTTCTTCCTGGTAGAGGG - Intergenic
948686551 2:239674046-239674068 ATGATGTTCTTGCAGACAGATGG - Intergenic
948736625 2:240012150-240012172 GAGAAGTGGTTGCGGGGAGATGG - Intronic
1168880378 20:1201435-1201457 CTGAAGTTCTTGGGGGAAGGGGG + Intergenic
1170153654 20:13250398-13250420 ATGAAGTCCTTGGGGGCATATGG + Intronic
1172663314 20:36582274-36582296 GTTAACATCTTGCGGGGAGATGG - Intronic
1173534943 20:43802437-43802459 AAAAAGTTCTTGCTGGGAGATGG + Intergenic
1173705627 20:45108324-45108346 AAGTGTTTCTTGCGGGGAGAAGG - Intergenic
1173828482 20:46062744-46062766 CTGAAGCTCTTGCTGGGAGGTGG + Exonic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
1176200698 20:63858980-63859002 AGGAAGTTCTTGAGAGGAGGAGG - Intergenic
1180247314 21:46556879-46556901 ATGAAATTCAGGAGGGGAGAGGG - Intronic
1183830204 22:40414764-40414786 ATGAAGTTCTGGAGCGGATAGGG + Intronic
1184897366 22:47418420-47418442 ATGAATTTGGTGGGGGGAGAGGG + Intergenic
950917467 3:16660548-16660570 ATGGCTTGCTTGCGGGGAGAGGG - Intronic
954385835 3:50243300-50243322 AGGAAGTTGTGGCTGGGAGAAGG + Intronic
954498500 3:50988126-50988148 AGGAAGCTCCTGAGGGGAGAGGG + Intronic
957840804 3:85666735-85666757 GTGAAGATCTTCAGGGGAGAAGG + Intronic
958478819 3:94620445-94620467 ATGAAGTACTTGCTAAGAGAAGG + Intergenic
958690279 3:97457282-97457304 ATGTGGTTCTTACGGGGAAAGGG + Intronic
961050567 3:123742215-123742237 AAGAAGTTCTAGTGGGGATATGG - Intronic
961406053 3:126680191-126680213 ATGGAGTTCCTGGGAGGAGAAGG - Intergenic
961826827 3:129603542-129603564 ATGAAGCTCTGGGGTGGAGATGG + Intronic
962945287 3:140163638-140163660 ATTGACTTCTTGTGGGGAGAAGG + Intronic
963029811 3:140958280-140958302 ATGAAGTTTTGGCAGTGAGAAGG - Intronic
964764905 3:160170266-160170288 ATGAAGGTCTTCAAGGGAGAAGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968922596 4:3530432-3530454 GTGAAGTTCTTCGGGGGTGAGGG - Intronic
972462356 4:39316390-39316412 ATGATGTTCCTGCAGGGGGAAGG - Intronic
973635747 4:52861097-52861119 ATTAAGTTCTGGCTGGAAGAGGG + Intergenic
973713321 4:53650707-53650729 TTGAGGTTCTTGGGGGGACACGG - Intronic
978593764 4:110354980-110355002 AGGAAGTTTTTGAAGGGAGAGGG - Intergenic
978918981 4:114159037-114159059 ATGAAGTTTTTGTGGGGAGGAGG - Intergenic
980515159 4:133847676-133847698 ATGAAGGTCTTCAGGGGAGAAGG + Intergenic
981601706 4:146496505-146496527 ATGAGGGTCTTCAGGGGAGAAGG - Intronic
984519392 4:180784148-180784170 ATGAAGGTCTTCATGGGAGAAGG + Intergenic
987353664 5:17043550-17043572 ATGATGTGCTATCGGGGAGACGG - Intergenic
990052752 5:51528246-51528268 GTGAAGTTGTTGCGGGGAGAAGG + Intergenic
991778483 5:70109317-70109339 AAGAATTTCTTGCGGGGATGAGG - Intergenic
991857773 5:70984784-70984806 AAGAATTTCTTGCGGGGATGAGG - Exonic
991870930 5:71109670-71109692 AAGAATTTCTTGCGGGGATGAGG - Intergenic
994994233 5:107039191-107039213 ATGAGGGTCTTCAGGGGAGAAGG + Intergenic
998100431 5:139428843-139428865 ATTAAGTTCTGGGTGGGAGAAGG - Intronic
1003349762 6:5305094-5305116 ATGGAGTGCTTGTGTGGAGAAGG + Intronic
1003397287 6:5764184-5764206 ATGGAGTTATTGAGGCGAGAAGG + Intronic
1005020606 6:21414697-21414719 AAGAAATTCTTGCAGGGAAAAGG + Intergenic
1005392842 6:25350671-25350693 TTAAAGTTCTTGAGGAGAGAGGG + Intronic
1006992210 6:38224991-38225013 ATGGAATTCTTGCTGGTAGATGG + Intronic
1007109036 6:39302418-39302440 ATGAAGTTCTTCAGAGGAGCTGG + Intronic
1007242505 6:40437235-40437257 ATGCAGAGCTGGCGGGGAGAGGG - Intronic
1009777542 6:68224098-68224120 ATGAGGTTCTTTAGGAGAGAGGG + Intergenic
1011104272 6:83761764-83761786 ATTAAGTTCTTTCTGGAAGAGGG - Intergenic
1012657096 6:101837991-101838013 ATGACGTGCTTTGGGGGAGAAGG - Intronic
1013868751 6:114729782-114729804 ATGAAAATTTTGGGGGGAGATGG - Intergenic
1014915092 6:127136935-127136957 ATGAGCTTATTGTGGGGAGAAGG + Intronic
1023735516 7:43232614-43232636 ATGATGTTCTTGCGGGAAAAGGG + Intronic
1026172437 7:67965796-67965818 ATGGAGTTTTTGGGGGGTGATGG + Intergenic
1027936306 7:84608002-84608024 ATGAAGTGCTAGGGGAGAGAGGG - Intergenic
1029028847 7:97447733-97447755 ATGAAGTTCTTTAGGGCAGATGG - Intergenic
1030814768 7:114022592-114022614 AGGAAGTTCTTTGGGAGAGAGGG - Intronic
1031040794 7:116836583-116836605 CTGAAGTTCTTGTCTGGAGATGG + Intronic
1032061255 7:128727251-128727273 ATAAACTTCTTGCGGGAACATGG - Intronic
1033584691 7:142765355-142765377 ATGTAGTTCATGTGAGGAGACGG + Intergenic
1033711600 7:143951675-143951697 GTGGAGTTTTTGAGGGGAGAGGG + Intergenic
1033866364 7:145695070-145695092 ATGTAGTTATTTCTGGGAGATGG - Intergenic
1036931896 8:12964383-12964405 ATGAAGTTCCTGCGGCAGGATGG - Intronic
1037570371 8:20152815-20152837 ATGAAGTAGGTGAGGGGAGATGG + Intronic
1042217316 8:66439238-66439260 TTGAATTTTTGGCGGGGAGAAGG + Intronic
1043297555 8:78683942-78683964 ATGAAGAACTTGCTGGGAAATGG - Intronic
1045003135 8:97895489-97895511 ATGGAGGTCTTGCCTGGAGAGGG - Intronic
1049702350 8:144020977-144020999 AAGAGGTTCCTGAGGGGAGAGGG - Intronic
1053067431 9:35078534-35078556 TTTAAGTTATTGCAGGGAGATGG - Intronic
1053421549 9:37983094-37983116 ATGAAGCTCTTGGTAGGAGAAGG + Intronic
1057548942 9:96038118-96038140 GTGAAGTTCTTGTGTGGAGGAGG + Intergenic
1185856707 X:3542826-3542848 ATGAGGGTCTTGGGGAGAGAGGG + Intergenic
1185956531 X:4497125-4497147 ATGAAGTTCTTCAGGGAAGAAGG - Intergenic
1186748159 X:12592072-12592094 ATGAAGGTCTTCAAGGGAGAAGG - Intronic
1186806106 X:13141222-13141244 TTAAAGTTTTTGGGGGGAGAAGG - Intergenic
1188486909 X:30692193-30692215 CTGAAGTTATTGTGGGGGGACGG - Intronic
1191199719 X:57766747-57766769 CTGAAGTTCTTGGGGATAGATGG - Intergenic
1196909460 X:120470730-120470752 ATGCAGTTCATGCTGTGAGATGG + Intergenic
1197266867 X:124383755-124383777 ATGATGTTGTTGCTGGCAGATGG - Exonic
1197716940 X:129716211-129716233 AGGAATTCCTTGCAGGGAGAAGG - Intergenic
1200807468 Y:7447296-7447318 ATGAGGGTCTTGGGGAGAGAGGG - Intergenic