ID: 1128282629

View in Genome Browser
Species Human (GRCh38)
Location 15:66409046-66409068
Sequence CAGGAGGGTCACAGTGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128282623_1128282629 30 Left 1128282623 15:66408993-66409015 CCTGGCTTTGAGTTTATGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1128282629 15:66409046-66409068 CAGGAGGGTCACAGTGTTGTTGG 0: 1
1: 0
2: 5
3: 18
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128282629 Original CRISPR CAGGAGGGTCACAGTGTTGT TGG Intronic
900367525 1:2317360-2317382 CAGGAGGGGCACAGGGAGGTAGG + Intergenic
900791705 1:4685007-4685029 CAGGAGGGTGCCTTTGTTGTTGG - Intronic
901453118 1:9348262-9348284 CAGGAGCGAGACAGTGCTGTGGG - Intronic
902607527 1:17576885-17576907 CTGGAGAGTCACCGTGCTGTGGG + Intronic
911831953 1:102561444-102561466 CAGTGGGGTCATAGTATTGTTGG + Intergenic
916195008 1:162214384-162214406 CAGCAGGCTCACAGTCTGGTTGG + Intronic
916983627 1:170166891-170166913 CTGGAGGATCAGAGTTTTGTGGG - Intronic
917483612 1:175434468-175434490 CGGGAAGGTCACAGTGTTACAGG - Intronic
918389133 1:184039583-184039605 CAAGGGGCTCACAGTCTTGTAGG + Intergenic
918756413 1:188344016-188344038 CAGCAGAGTCATAGTGTTGGTGG - Intergenic
919986783 1:202681196-202681218 TAGGAGGGTGAGAGGGTTGTGGG - Intronic
1063050624 10:2443368-2443390 CAGAGGGGTCACAGTGTGGCAGG + Intergenic
1063339962 10:5253677-5253699 CAGCAGGGTCATAGTGTTCTGGG - Intergenic
1063343774 10:5292974-5292996 CAGCAGGGTCATAGTGTTCTGGG + Intergenic
1066228871 10:33412387-33412409 CAGGAGAGTCACAGAGAGGTTGG + Intergenic
1067570797 10:47369448-47369470 CATGAGGGTCGCAGTGTTGGAGG + Intronic
1067782845 10:49221521-49221543 CAGGAGGGGCACAGAGTTGTGGG - Intergenic
1068116744 10:52744358-52744380 CAGGAGAGTCACTGTGGTGTGGG - Intergenic
1069696772 10:70392208-70392230 CAGGAGGATCATTTTGTTGTGGG + Intergenic
1070569839 10:77632511-77632533 CAGGATGGTTACAGTTTTGATGG - Intronic
1073154149 10:101333358-101333380 CAGGAGGATCCCAGTGTTCCTGG + Intergenic
1073422791 10:103438069-103438091 CAGGTGGGTTTCTGTGTTGTTGG + Exonic
1075793692 10:125103839-125103861 CAGGAGGGTCCCAGAGCTGTGGG - Intronic
1076215448 10:128689590-128689612 CAGGGGGTTCACAGTTTTGCGGG + Intergenic
1076525330 10:131109049-131109071 CAGGATGAGCACAGTGTTGTGGG + Intronic
1077233150 11:1467699-1467721 GAGGGGGGTCTCAGTGTTGAGGG - Intergenic
1077259322 11:1607383-1607405 CAGGAGGGGCCCAGGGATGTGGG + Intergenic
1077435528 11:2537031-2537053 GAGGGGGGTCACAGTGGAGTAGG - Intronic
1080395183 11:31883329-31883351 TAGGAGAGTCACAATGTTTTTGG + Intronic
1082236027 11:49821042-49821064 CAGGAGGTGCACAGTGCTGGCGG + Intergenic
1082990064 11:59199731-59199753 CCGGAAGGTAACAGTGTCGTGGG - Exonic
1083913737 11:65726681-65726703 CAGTTGGGTCACAGCATTGTGGG - Intergenic
1084510051 11:69597651-69597673 CATGAGGGCCACAGTCATGTTGG + Intergenic
1084800240 11:71538883-71538905 CAGGAGGGGCCCAGGGATGTGGG - Exonic
1085802707 11:79605320-79605342 CAGGAGGTTCACAGTACTGTTGG - Intergenic
1087490216 11:98816128-98816150 CAGGAGCGAAACAGGGTTGTTGG - Intergenic
1088498692 11:110459689-110459711 CAGAAGTGTCAAAATGTTGTGGG + Intronic
1088652902 11:111974147-111974169 CAGCAGTGGCACAGTGTGGTCGG - Exonic
1089133991 11:116234871-116234893 CTGGATGGTCACAGTGCTATGGG - Intergenic
1089296748 11:117473799-117473821 CGGGAGGGTCACTTTGTGGTTGG + Intronic
1093168510 12:15833146-15833168 CAGGCCAGTCACAGTTTTGTAGG - Intronic
1093269714 12:17044970-17044992 CAGGCGAGTTATAGTGTTGTTGG + Intergenic
1093692339 12:22122343-22122365 TAGGAGGGGCAGAGTGTGGTTGG - Intronic
1093785328 12:23185809-23185831 CAGTAGGGTCAGATTGTGGTGGG - Intergenic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1094798964 12:34008110-34008132 TAGGAGGGTGACAATATTGTTGG + Intergenic
1095111717 12:38302219-38302241 TAGGAGGGTGACAATATTGTTGG + Intergenic
1095551875 12:43451733-43451755 CAAGATGGTCACAGATTTGTGGG - Intronic
1096777247 12:53971880-53971902 CAGGAGGCTGACAGACTTGTAGG + Intergenic
1101394735 12:104336322-104336344 AAGTAGGGTGACAGTGTTTTCGG + Intronic
1102703764 12:114863441-114863463 CAGGTGAGTAATAGTGTTGTGGG + Intergenic
1103593148 12:122006463-122006485 AAGGAGCATCACAGTGTTTTTGG - Intergenic
1105543360 13:21333956-21333978 CAGGGAGCTCACAGTATTGTGGG - Intergenic
1106100760 13:26694021-26694043 CAGGAGGGACACAGGGCTGCTGG - Intergenic
1108432954 13:50372457-50372479 CAGGAGGCTCTAAGAGTTGTAGG + Intronic
1109518193 13:63471679-63471701 CAGGAGGGACAGAGTGGTATGGG - Intergenic
1109617574 13:64855655-64855677 CAGGAGGGTCACAGTCTTTTAGG + Intergenic
1112787954 13:102971992-102972014 CCGGAAGGTCACAGTATTGTTGG + Intergenic
1116354567 14:43912658-43912680 CAGGAGAGACAGAGTGTTGCGGG - Intergenic
1117862379 14:60105977-60105999 AAGGAAGGTCACACTCTTGTGGG - Intronic
1119061137 14:71476007-71476029 CAGGAGGTTTACAGTGAGGTAGG + Intronic
1122964736 14:105117405-105117427 CAGGAGGGGCACAGGCCTGTGGG - Intergenic
1124603568 15:31153746-31153768 CATGTGGCTCACACTGTTGTTGG - Intronic
1124649946 15:31467107-31467129 CAGGAGGGTCTCAGGGGTGGTGG + Intergenic
1124993503 15:34699308-34699330 CAAGAGAATGACAGTGTTGTTGG + Intergenic
1125814191 15:42570315-42570337 CAGGAGGTTCAGAGTGCAGTGGG - Intergenic
1128282629 15:66409046-66409068 CAGGAGGGTCACAGTGTTGTTGG + Intronic
1130631881 15:85577998-85578020 TAGGTGGGACACAGTGGTGTAGG + Intronic
1134410488 16:13999883-13999905 GAGGAGGCCCTCAGTGTTGTTGG - Intergenic
1137249153 16:46730102-46730124 CAGGATGGCCTCAGTGGTGTGGG - Intronic
1138089823 16:54165033-54165055 CATGAGGTTCTCAGTGATGTTGG - Intergenic
1138098365 16:54231476-54231498 CAGAAAGGTCACAGTGCTGCAGG + Intergenic
1138537957 16:57669792-57669814 CAGGAGTGACACAGTGTGGTGGG + Intronic
1138638185 16:58361205-58361227 CAGCACAGTCACAGTGTTGGTGG - Intronic
1140855931 16:78977729-78977751 CAGGACGGTCACAGACTTGCAGG - Intronic
1141305138 16:82855797-82855819 CAGGAGGTTCACCGTGTGGCTGG - Intronic
1143765545 17:9135230-9135252 CAGGAGGGTCACTGTTCTGCTGG + Intronic
1144095815 17:11899925-11899947 CAGGGAGCTCACAGTCTTGTGGG + Intronic
1145097504 17:20043213-20043235 AAGGAGGCACATAGTGTTGTGGG + Intronic
1145251478 17:21299088-21299110 CAGGAGGGTCAAAGAGTGGGTGG - Intronic
1146644413 17:34567577-34567599 CAGGAGGGAAACAGAGCTGTCGG + Intergenic
1146843234 17:36168810-36168832 TGGGAAGGTGACAGTGTTGTGGG - Intronic
1146855544 17:36256751-36256773 TGGGAAGGTGACAGTGTTGTGGG - Intronic
1146865077 17:36331624-36331646 TGGGAAGGTGACAGTGTTGTGGG + Intronic
1146871450 17:36380662-36380684 TGGGAAGGTGACAGTGTTGTGGG - Intronic
1146878809 17:36431744-36431766 TGGGAAGGTGACAGTGTTGTGGG - Intronic
1146882753 17:36452890-36452912 TGGGAAGGTGACAGTGTTGTGGG - Intergenic
1147067936 17:37932218-37932240 TGGGAAGGTGACAGTGTTGTGGG + Intronic
1147074336 17:37981286-37981308 TGGGAAGGTGACAGTGTTGTGGG - Intronic
1147079467 17:38011773-38011795 TGGGAAGGTGACAGTGTTGTGGG + Intronic
1147085858 17:38060824-38060846 TGGGAAGGTGACAGTGTTGTGGG - Intronic
1147095408 17:38135715-38135737 TGGGAAGGTGACAGTGTTGTGGG + Intergenic
1147101805 17:38184790-38184812 TGGGAAGGTGACAGTGTTGTGGG - Intergenic
1147315136 17:39616615-39616637 CAGGCAGGGCACAGTGGTGTGGG - Intergenic
1147583525 17:41639600-41639622 CAGGTGTGTCACACTGTGGTGGG - Intergenic
1149846398 17:60011300-60011322 TGGGAAGGTGACAGTGTTGTGGG - Intergenic
1150084748 17:62267875-62267897 TGGGAAGGTGACAGTGTTGTGGG - Intergenic
1151534141 17:74729262-74729284 CTGGTGGGTGACAGTGGTGTGGG + Intronic
1151660950 17:75517624-75517646 CAGGAAGGTCACAGTGTGGTCGG - Exonic
1153952471 18:10068978-10069000 GAGGAGGGTGACTGTGTTCTGGG - Intergenic
1156328996 18:36101672-36101694 AAGGAGGGTTTCAGTGTTATAGG + Intergenic
1157533943 18:48444769-48444791 CTGGAGGGTCACTGGGTTATGGG + Intergenic
1160116106 18:76081130-76081152 CAAGAGGGTCACAGTGTGTGTGG - Intergenic
1161590387 19:5126768-5126790 CGGGAGGGTGGCAGTGTTGAAGG + Intronic
1162960759 19:14124900-14124922 CAGGAGAGTTATAGTGCTGTTGG + Intronic
1164286144 19:23819491-23819513 CATATGGGTCCCAGTGTTGTTGG + Intronic
1165794780 19:38512400-38512422 CAGCAGTGCCACAGTGGTGTAGG - Exonic
1165905489 19:39192000-39192022 GAGCAGGGTCACTGTGTCGTAGG + Intergenic
1167892286 19:52550166-52550188 CAGGAGGCCCACAGTGTTCATGG - Intronic
1168722027 19:58559454-58559476 GTGGAGGGTTACAGTGGTGTAGG + Intergenic
926045799 2:9708842-9708864 TGGGAGGGTCACAGGTTTGTGGG - Intergenic
926775960 2:16423544-16423566 CATGAGGCTCTCAGTGTGGTGGG + Intergenic
927845545 2:26470537-26470559 CAGGAGGGTCTGAGTGTGGAGGG + Intronic
927964309 2:27259685-27259707 CATGAGGCTCACAGAGTTGGGGG + Intronic
931846921 2:66213658-66213680 CAGGAGTTTCACTGTGTTGGTGG + Intergenic
932276361 2:70454917-70454939 CAGGAGGGTCACAGGGACTTAGG - Intronic
935126311 2:100226579-100226601 CAGGGGGATCCCAGTGTTGAGGG - Intergenic
939672086 2:145025153-145025175 CAGGAGTGTCACATTATTTTAGG - Intergenic
941447410 2:165619083-165619105 CATGAGGGTCCCAGTGTTGTGGG + Intronic
943425525 2:187728279-187728301 TAGGATGGTCACAGTCTTGGAGG + Intergenic
943867908 2:192952917-192952939 CAGGACTTTCACAGTTTTGTAGG - Intergenic
946173689 2:217910064-217910086 CAAGAGGGTCACAGTGAGGCAGG - Intronic
949077291 2:242069009-242069031 GAGGAGGGTAAGAGTGTTGAAGG - Intergenic
1169022326 20:2339570-2339592 CAGGGAAGTAACAGTGTTGTTGG + Intronic
1170047705 20:12103350-12103372 CAAGAGGGTTACATTGTTATAGG + Intergenic
1172610377 20:36246626-36246648 CAGGAGGGCCACGGTGTTGCTGG + Intronic
1172973298 20:38888772-38888794 GAGGAGGGTCACAGTGATAAGGG + Intronic
1176043533 20:63080729-63080751 CAGGAGGGTCTCAGTGCGGTGGG + Intergenic
1176110910 20:63410324-63410346 CAGGAGGGGCACAGGGTCCTTGG - Intronic
1177909824 21:27017440-27017462 CAAGAGGGTCACATTGTTTCCGG - Intergenic
1178007243 21:28235179-28235201 CAGGGTGGTCACAGGGGTGTAGG + Intergenic
1178285090 21:31318954-31318976 CAGGAGGGTCTCAGGAGTGTAGG - Intronic
1178818390 21:35952432-35952454 CCGGAGGCTCACAGGTTTGTTGG - Intronic
1179049261 21:37874843-37874865 CAGGAGGGTGGCAGTGGTGGAGG - Intronic
1179495594 21:41769487-41769509 CAGGAGGAACACAGGGTAGTGGG - Intergenic
1181014225 22:20060027-20060049 CAGGAGGTTGACAGTGCAGTGGG - Intronic
1181022147 22:20109238-20109260 CATGAAGGTCACAGTCTTGGTGG + Intronic
1182262983 22:29089260-29089282 CAGGAAGGTCAGAGTGTTTTGGG - Intronic
1183577958 22:38704211-38704233 AAGGAGGGGCACAGTTTTGTGGG - Intergenic
950621999 3:14213220-14213242 CAGCATGGTCACAGGATTGTTGG - Intergenic
952635888 3:35530268-35530290 CAGGAGGGGCTCAGTGGTGAGGG + Intergenic
955985897 3:64573786-64573808 CATGAGCGTCACACTGTTGGGGG + Intronic
957017820 3:75090432-75090454 CAGCATAGTGACAGTGTTGTGGG - Intergenic
957676966 3:83379528-83379550 AAGGAAGGTCAGAGTGTTCTTGG + Intergenic
958562055 3:95759671-95759693 CAGGAGGCAGACAGGGTTGTGGG - Intergenic
960083319 3:113564505-113564527 AAGGAGGGTCACTGTGATGCAGG + Intronic
960533978 3:118796118-118796140 CACCAGGCTCACAGTCTTGTGGG - Intergenic
962668945 3:137685448-137685470 CAAGTTGGTCACAGTGTAGTGGG - Intergenic
963460476 3:145607364-145607386 CTTGAGGGTCAGATTGTTGTAGG - Intergenic
965435874 3:168650672-168650694 CTGTGGGGTCACAGTGTTGTGGG + Intergenic
968588805 4:1447418-1447440 CAGGAGGGGCACAGGGTCCTTGG + Intergenic
969325417 4:6441298-6441320 TAGAAGGGTCACTGTGGTGTCGG - Intronic
970354810 4:15241094-15241116 AAGGAAGGTCACAGTGTGGAGGG + Intergenic
970908887 4:21251421-21251443 TATGAGGGCCACAGTGTTCTCGG - Intronic
971245451 4:24923115-24923137 CAGGAGGGTCACAGTCTGGTGGG + Intronic
973329506 4:48897741-48897763 CAGGAGGGTCACAGTAAACTGGG + Intronic
981029350 4:140108382-140108404 CAGGGAGCTCACAGTTTTGTTGG - Intronic
984472344 4:180192429-180192451 CAGATAGGTCACAGTGATGTGGG - Intergenic
985429886 4:189869082-189869104 CAGGAGGTTCAGGGTGCTGTAGG - Intergenic
987936914 5:24478884-24478906 CAGGAAGTTCACAGAGTTTTGGG - Intergenic
989445388 5:41522581-41522603 CAGGAGGGAGAGAGTGTGGTGGG + Intergenic
989540162 5:42609162-42609184 CTGAAAGGTCACAGTGTTCTAGG + Intronic
989792577 5:45423468-45423490 CAGGAAAGTCTAAGTGTTGTTGG - Intronic
990126725 5:52527796-52527818 CAGTAGGCTCACAGTGATCTAGG - Intergenic
994974204 5:106780695-106780717 CAGCAGAGTCCCAGTGTTGGTGG + Intergenic
995184622 5:109258995-109259017 GAGGATGGTCACAGAGTTCTTGG + Intergenic
998376605 5:141694971-141694993 CAGTGGGGTCTCAGTGTGGTTGG + Intergenic
1000323976 5:160158084-160158106 CAGGATGTTCACAGTCTAGTGGG + Intergenic
1001235308 5:170024289-170024311 CTGGATGGTGACAGTGTTGGGGG + Intronic
1002278211 5:178116400-178116422 CAGGAGGGGCACAGTGGGGACGG + Intronic
1003309453 6:4956814-4956836 CATGAGGGTAACAGTGATGATGG + Intergenic
1003408619 6:5843833-5843855 CAGGGAGCTCACAGTATTGTGGG + Intergenic
1006409758 6:33866091-33866113 CCTGAGGGTCACAGCTTTGTAGG + Intergenic
1007507791 6:42349678-42349700 AGGGAGGGTCACAGTGATGGAGG + Intronic
1008557988 6:52693986-52694008 CATGAGGTTCTCAGTGTAGTTGG - Intergenic
1010451539 6:76009418-76009440 CAGGAGACTCACAGGGTTTTTGG + Intronic
1010766417 6:79781022-79781044 CAGAAGGGCCACAGTGTTCAGGG + Intergenic
1011746700 6:90413549-90413571 CAGGAGGGTTCCAGTTTTGCTGG - Intergenic
1014437683 6:121438339-121438361 AAGGAGGGTGACAGCATTGTTGG - Intronic
1015154556 6:130077699-130077721 CAGGAAGGTAACAGTGTGGCTGG - Intronic
1017114669 6:150965923-150965945 CATGAGGGGCAGAGTGATGTGGG + Intronic
1019134834 6:169901548-169901570 GATGAGGGTGACAGTGATGTTGG + Intergenic
1019286593 7:226320-226342 CTGGAGGGTCACAGTGCAGGGGG + Intronic
1023980313 7:45065862-45065884 CAGGAGGGTCACCATGGTGTCGG - Intronic
1024944800 7:54797870-54797892 CAGGAGGATCGAAGTATTGTGGG + Intergenic
1028628518 7:92905556-92905578 CAGGAGGGCCTCACTGTTTTAGG + Intergenic
1029061856 7:97806521-97806543 CAGGTGGGTCTCACTGGTGTTGG - Intergenic
1029216052 7:98950594-98950616 CAGGAGTGACCCAGTGTTGAAGG + Intronic
1033382054 7:140831037-140831059 CAAGAGGGGGACAGTCTTGTGGG + Intronic
1034080266 7:148270491-148270513 CAGGGAGGTCACAGGCTTGTAGG - Intronic
1034637187 7:152576718-152576740 CTGGAGGGTCACAGTGGAGGTGG - Intergenic
1035535844 8:390893-390915 GAGGAGGGTAAGAGTGTTGAAGG - Intergenic
1037724272 8:21470304-21470326 CAGGATGGTCACAGTTATGATGG - Intergenic
1040349654 8:46551480-46551502 CAGGTGGGTCTCACTGGTGTTGG - Intergenic
1040912430 8:52532766-52532788 CAGGAGGTTAACAATGTTTTCGG - Intergenic
1040978205 8:53217521-53217543 GAGGAGGGACACAGTGTGATGGG - Intergenic
1042893635 8:73641958-73641980 GAGGAAGTTCATAGTGTTGTGGG - Intronic
1045507745 8:102790653-102790675 TAGGTGGGTCCCAGTGTTTTTGG + Intergenic
1047350914 8:124072719-124072741 CAGGGAAGTCACAGTGTAGTTGG + Intronic
1048832962 8:138494449-138494471 AAGGAGGTCCAGAGTGTTGTGGG + Intronic
1049164609 8:141118190-141118212 CAGTAGGGCCCCAGTGGTGTAGG - Intronic
1053168692 9:35862899-35862921 CTGGAGGGTGACAGTGATGAAGG - Intergenic
1058402390 9:104634042-104634064 AGGGAGGGTTACAGTGTTGCAGG + Intergenic
1058957395 9:109961765-109961787 CTGAAGGATCAGAGTGTTGTAGG + Intronic
1060491084 9:124084816-124084838 CAGGAGGGTCACAGGGGAGGTGG + Intergenic
1060537345 9:124400660-124400682 CAGGTGGCTCACAATGTAGTTGG - Intronic
1060824294 9:126679105-126679127 CAGCAGGGTCACAGTCTTCAGGG - Intronic
1061169751 9:128945756-128945778 CAGGAGGGACACAGTGCTGATGG + Exonic
1061777052 9:132972752-132972774 CAGGAGTGCCACCGTGTGGTGGG + Intronic
1185839435 X:3375007-3375029 AAGGAGGCTCACAATGTGGTTGG + Intergenic
1186754964 X:12660978-12661000 CATGGTGGTCACAGGGTTGTTGG + Intronic
1188273845 X:28177407-28177429 CAGGAGGGACACAGCTGTGTTGG + Intergenic
1189705624 X:43756212-43756234 CAGCAGGGTCCCAGTGTTGCTGG - Intergenic
1190993674 X:55582236-55582258 CAGGAGGGTGGAAGTGTTGAAGG + Intergenic
1191988349 X:67005932-67005954 CTGGAGGGCCACAGTGATGTTGG + Intergenic
1197691178 X:129502680-129502702 CCAGAGGGACACAGTGTTGAGGG + Intronic
1197918680 X:131564349-131564371 CAGTAGGTTCACAGTCTTGAAGG - Intergenic
1199694534 X:150334605-150334627 CAGGAGAGTCCTGGTGTTGTAGG - Intergenic
1199786534 X:151111634-151111656 CAGCAGGGTCCCAATGTTGAGGG - Intergenic