ID: 1128283215

View in Genome Browser
Species Human (GRCh38)
Location 15:66414584-66414606
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 5, 1: 9, 2: 22, 3: 65, 4: 375}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128283215_1128283226 24 Left 1128283215 15:66414584-66414606 CCCCTGAGCTTCAGTGTCCAGAG 0: 5
1: 9
2: 22
3: 65
4: 375
Right 1128283226 15:66414631-66414653 GGCATGATTAATTGAATCATTGG 0: 4
1: 16
2: 126
3: 417
4: 738
1128283215_1128283222 3 Left 1128283215 15:66414584-66414606 CCCCTGAGCTTCAGTGTCCAGAG 0: 5
1: 9
2: 22
3: 65
4: 375
Right 1128283222 15:66414610-66414632 TTACTGGGGCCCCATTACATAGG 0: 1
1: 0
2: 3
3: 26
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128283215 Original CRISPR CTCTGGACACTGAAGCTCAG GGG (reversed) Intronic
900823809 1:4910492-4910514 CTCTGGACACTGAGGCTTCGTGG - Intergenic
900873891 1:5327441-5327463 CTCTGGACACTGATGCTCAGGGG - Intergenic
901871263 1:12140471-12140493 CCCTGGACTCTGGAGCTCTGGGG + Intronic
903844199 1:26267714-26267736 CTCTGGACACAGCAGCTCACTGG - Intronic
904170879 1:28591723-28591745 CTGAGGAGACTGAGGCTCAGAGG - Intronic
904906764 1:33902997-33903019 CACAGGGCACTGCAGCTCAGAGG + Intronic
905348831 1:37330472-37330494 GTGAGGAAACTGAAGCTCAGAGG + Intergenic
905459744 1:38114792-38114814 GGCTGGACACTGGAGCTTAGAGG - Intergenic
906667017 1:47629015-47629037 CTCTGCAAACTGAGGCCCAGAGG + Intergenic
906809066 1:48807919-48807941 CTCTGGACACAGAAAATCAGTGG + Intronic
907426938 1:54385784-54385806 ATAAGGACACTGAGGCTCAGAGG + Intronic
907714760 1:56916445-56916467 CTATGGAGACTGAGGCACAGAGG + Intronic
907847535 1:58222892-58222914 CTGAGGACACTGAGGCTCAGAGG + Intronic
909323758 1:74323340-74323362 ATAAGGACAGTGAAGCTCAGAGG - Intronic
909446176 1:75751413-75751435 ATCAAGAAACTGAAGCTCAGAGG + Intronic
910655927 1:89617997-89618019 CTGTGGACTCTAAGGCTCAGGGG - Intergenic
911144200 1:94536960-94536982 ATGAGGACACTGAAGCTCACAGG + Intronic
912406593 1:109443812-109443834 CTCTGAACACCAAGGCTCAGAGG + Intergenic
913325626 1:117625962-117625984 CTCTTAACACTGAAGCACACTGG - Exonic
913338681 1:117734403-117734425 CTCAGGTGACTGAGGCTCAGAGG - Intergenic
914343181 1:146777099-146777121 CTGTGGACATTGAAGCACCGAGG - Intergenic
915383912 1:155471501-155471523 CTCTGGACACTGAGGTTCACTGG + Intronic
916013315 1:160726227-160726249 CTCTGGAACCTGGAGCTCAGAGG - Intergenic
916513899 1:165497676-165497698 CTCTGCACTCTGATGCTGAGTGG + Intergenic
916597328 1:166257181-166257203 CTCTGGAGGCTCAAGCTCTGGGG + Intergenic
917858534 1:179122558-179122580 CTCTGGATAATCAAGCTCATTGG + Intronic
918984115 1:191601379-191601401 TTCTGGATATGGAAGCTCAGTGG + Intergenic
920504595 1:206507298-206507320 CTCTGTACAGTACAGCTCAGAGG - Intergenic
920742203 1:208591678-208591700 CCCTGGACACTGAAGGTGGGTGG + Intergenic
924031565 1:239890468-239890490 ATGAGGACACTGATGCTCAGAGG - Intronic
924421018 1:243910189-243910211 CTTAGGACATTGAGGCTCAGAGG + Intergenic
1062866165 10:856958-856980 CCCTGGACTGTGAAGCTCACAGG - Intronic
1065544966 10:26809770-26809792 CTCTAGACACTGAAGCCTGGTGG + Intronic
1066059170 10:31707127-31707149 CTCTGGACCCGGAAGCTGGGTGG + Intergenic
1068098776 10:52525593-52525615 CTGAGGAAACTGAGGCTCAGAGG - Intergenic
1068566297 10:58579232-58579254 GGCTTGAAACTGAAGCTCAGTGG + Intronic
1068961984 10:62876288-62876310 CACTGGAAACTGAAACTCTGTGG - Intronic
1069482851 10:68799397-68799419 CTCAGGAAACTGAGGCCCAGAGG + Intergenic
1069735631 10:70652256-70652278 CTAAGGACACTGTTGCTCAGGGG - Intergenic
1070112491 10:73498712-73498734 CTCTGGACACAGGAGAACAGTGG - Exonic
1070542125 10:77423592-77423614 CTCTGTATTCTGAAGCTCTGAGG + Intronic
1070850009 10:79556015-79556037 ATAAGGACACTGAAGCTTAGAGG - Exonic
1071365143 10:84891767-84891789 CTCAGGAAACAGAAGCTCAAAGG + Intergenic
1071373034 10:84972724-84972746 CTCTGGAAACTTCATCTCAGAGG - Intergenic
1073187081 10:101621714-101621736 ATGAGGAAACTGAAGCTCAGAGG + Intronic
1073352555 10:102830418-102830440 CTCAGGACACTCGAGCTCCGTGG - Intergenic
1073815965 10:107207082-107207104 AGCTGGAGACTGGAGCTCAGAGG - Intergenic
1073867280 10:107819398-107819420 ATGTAGACACTGAAGCTTAGAGG - Intergenic
1074419751 10:113298538-113298560 ATAAGGAAACTGAAGCTCAGGGG + Intergenic
1074437078 10:113443416-113443438 CTCTGGGCAGTGTGGCTCAGAGG - Intergenic
1074817333 10:117152303-117152325 ATATGGAAACTGAGGCTCAGCGG + Intergenic
1076517062 10:131052005-131052027 CTCTGAACGTTGAGGCTCAGGGG - Intergenic
1076727031 10:132418774-132418796 CCCTGGGCACCGGAGCTCAGAGG - Intergenic
1077311119 11:1889508-1889530 CTCTGGGCACGGAGGCTCTGGGG + Exonic
1077454112 11:2667668-2667690 CTCTGGAGGCTGAAGCACGGAGG + Intronic
1077888348 11:6402264-6402286 CTCTGACCCCTGCAGCTCAGGGG + Intronic
1077994975 11:7445359-7445381 GGCTGGACAGTGAAGCCCAGGGG - Intronic
1078180616 11:9006873-9006895 ATATGGAAACTGAGGCTCAGAGG - Intergenic
1078465883 11:11549963-11549985 CTCTGGCCACTGGAGCTTACTGG + Intronic
1078705413 11:13739175-13739197 ATGTGGAAACTGAAGCTGAGAGG - Intergenic
1078879211 11:15431598-15431620 ATCTGGCCACTGAACCCCAGGGG + Intergenic
1079244043 11:18740424-18740446 ATGAGGAAACTGAAGCTCAGAGG + Intronic
1079330722 11:19530493-19530515 CTGAGAACACTGAAGCTCAGAGG + Intronic
1080923165 11:36729049-36729071 TTGTGGAAACTGAAGCCCAGAGG - Intergenic
1081613613 11:44578004-44578026 ATCTGGAAATTGAGGCTCAGGGG - Intronic
1081653999 11:44845275-44845297 ATGAGGACACTGAGGCTCAGAGG - Intronic
1081663319 11:44901844-44901866 AAGAGGACACTGAAGCTCAGAGG - Intronic
1081680411 11:44998675-44998697 CTCTGTACCCTAAGGCTCAGAGG + Intergenic
1083029833 11:59582372-59582394 CTCTGGATACCAAAGCTCAGTGG + Intronic
1083148768 11:60776936-60776958 CTAAGGACACTGAAGCTTAAAGG + Intergenic
1084439612 11:69165115-69165137 CTCTGGACACCAAGGCTCCGGGG + Intergenic
1084484037 11:69437821-69437843 CTCGGGACACTGCAAGTCAGAGG + Intergenic
1084486674 11:69452198-69452220 ATCTGGACAATGATCCTCAGAGG - Intergenic
1084646234 11:70460237-70460259 CCCTGGACAGTGGAGCTCAGTGG + Intergenic
1085510277 11:77084636-77084658 CTCTCGTTTCTGAAGCTCAGAGG - Intronic
1086158420 11:83694088-83694110 CTATTGAAACTGAGGCTCAGAGG + Intronic
1086190104 11:84069093-84069115 CTCTGGAGGGGGAAGCTCAGTGG - Intronic
1086476243 11:87178039-87178061 CTCTGAACACTGAGGCTTGGTGG - Intronic
1087239392 11:95757903-95757925 ATGAGGAAACTGAAGCTCAGAGG + Intergenic
1087695218 11:101369171-101369193 CTCTGGAAACTTCATCTCAGAGG + Intergenic
1087953574 11:104255907-104255929 ATAAGGAAACTGAAGCTCAGAGG + Intergenic
1088419993 11:109635518-109635540 CTCTGGAGCCTGAAGCTATGGGG + Intergenic
1088608672 11:111556326-111556348 CTCTGGACACGAAAGCTCTGTGG - Intronic
1088686103 11:112285711-112285733 GTCTGAACACTGAAGGTCATGGG - Intergenic
1089165418 11:116472243-116472265 CTCTGGACACCAAAGCTCAGTGG + Intergenic
1089169330 11:116501146-116501168 CCTTGGAAACAGAAGCTCAGCGG + Intergenic
1089892070 11:121891555-121891577 ATGAGGAAACTGAAGCTCAGAGG + Intergenic
1089956758 11:122578427-122578449 CTCTGGACACTGAGGCTTAGTGG - Intergenic
1090763743 11:129858955-129858977 CTCTTGACACTGAGGCACAAAGG - Exonic
1091348374 11:134871816-134871838 CTCTGGACACCAAGGCTTAGTGG - Intergenic
1091897012 12:4113648-4113670 ATGAGGACCCTGAAGCTCAGAGG + Intergenic
1093031140 12:14289631-14289653 CTCTGAATACTGGAGCTCAGTGG - Intergenic
1093093535 12:14947110-14947132 CCCTGGAGACTGAGGCTAAGTGG + Intronic
1093441457 12:19202246-19202268 ATCTGGACACAGAGACTCAGAGG - Intronic
1093520811 12:20047794-20047816 CTCTGGACACTAGGGCTCACTGG - Intergenic
1094066763 12:26369919-26369941 CTTTGGACATTGAAGCTCAGTGG + Intronic
1094161104 12:27392031-27392053 ATATGGAAACTGAAGCTCAGAGG - Intronic
1094161733 12:27397958-27397980 CTTTGGACACTGGAGGCCAGTGG - Intronic
1094556644 12:31506893-31506915 CTCTGGACACTGAGATTTAGTGG - Intronic
1096411673 12:51381426-51381448 TTCTGGACACATAAGCTCACTGG + Intronic
1097160734 12:57044858-57044880 CTCTGGACGGTGAAGGTAAGGGG + Intronic
1097290651 12:57911725-57911747 TTCTAGACACTGAAGCTGAAAGG + Intergenic
1098881352 12:75920517-75920539 CTCTGGAAATGTAAGCTCAGTGG + Intergenic
1099238929 12:80115901-80115923 CTTGGGACACTGAAGCTTGGTGG - Intergenic
1100380160 12:94054395-94054417 CACTGGACACCAAGGCTCAGTGG + Intergenic
1101134409 12:101726077-101726099 TTATAGACACTGAGGCTCAGAGG - Intronic
1102899168 12:116622886-116622908 CTCTGCACACTGAAGCTAACTGG - Intergenic
1103017869 12:117509537-117509559 CTCATAGCACTGAAGCTCAGTGG - Intronic
1103027934 12:117588792-117588814 CTGAGAACACTGAAGCTCATGGG - Intronic
1104050928 12:125193237-125193259 ATGGGGACACTGAGGCTCAGAGG + Intronic
1104070271 12:125338627-125338649 CTCTGCCCACTGGAGCCCAGAGG - Intronic
1104186573 12:126438355-126438377 GTGTGGAAACTAAAGCTCAGAGG + Intergenic
1104768511 12:131345865-131345887 CTCTGGGCACTGAGGTACAGAGG + Intergenic
1104811535 12:131622723-131622745 CTCTGGGCACTGAGGTACAGAGG - Intergenic
1105974600 13:25462553-25462575 TTGTGGACACTGAAACTCAGGGG - Intronic
1107339019 13:39386433-39386455 TTCTGGAAACTGAGGCACAGAGG + Intronic
1107596760 13:41971317-41971339 CTCTGGATGCCAAAGCTCAGTGG + Intergenic
1107658189 13:42613372-42613394 CTCTGCACTCTGGAGCTCCGGGG - Intergenic
1109304895 13:60627380-60627402 CTCAGGAAACTGAGGTTCAGTGG - Intergenic
1113284212 13:108828786-108828808 CTGTGGACATTGAAGCTCCGTGG + Intronic
1113571229 13:111359646-111359668 CTCTGGACACAGAGACTCAGGGG + Intergenic
1113758811 13:112833368-112833390 CTCAGAAAACTGAAGCCCAGAGG + Intronic
1115132344 14:30068508-30068530 CTCTGGAGAGTGAAGGTGAGAGG - Intronic
1116666436 14:47781602-47781624 CTCTGGAAACTAAAGTTCTGAGG - Intergenic
1117026402 14:51624695-51624717 TTCTGGCCCCTGAAGCTCAGAGG + Intronic
1117773389 14:59157301-59157323 CTCTAGACACTGAAGTTCAGTGG + Intergenic
1118329309 14:64803413-64803435 CCCAAGTCACTGAAGCTCAGGGG - Intronic
1119112662 14:71989554-71989576 ATGAGGAAACTGAAGCTCAGGGG + Intronic
1120090562 14:80327966-80327988 CTCAGGACAGTTAAGCTCTGGGG - Intronic
1122546470 14:102525472-102525494 CTCTGGACACAGAATGTAAGTGG - Intergenic
1122857106 14:104565276-104565298 CTCTGGGCTCTGAAGATGAGGGG - Intronic
1122932519 14:104940946-104940968 CTCTGGAGGCTGCAGGTCAGTGG + Exonic
1123788408 15:23695187-23695209 CTCTGAACAATGTAGCTCAGTGG - Intergenic
1126316438 15:47374825-47374847 ATCTGGGCACTGAGGCTGAGTGG + Intronic
1127149685 15:56060583-56060605 CTCTGGACTGTGAACCTCACAGG - Intergenic
1128283215 15:66414584-66414606 CTCTGGACACTGAAGCTCAGGGG - Intronic
1128378417 15:67093643-67093665 CTCTGGACTCTGAGGCAAAGTGG - Intronic
1128466678 15:67918475-67918497 CCCTGGACCCTGAAGCCCAGAGG + Intergenic
1128658321 15:69478886-69478908 CTCTAGACACTGAAGGGCAGGGG - Intergenic
1129637879 15:77341520-77341542 CTGTGAACACCAAAGCTCAGTGG - Intronic
1130444053 15:83982314-83982336 CTCTGGACACTGAGGATCTGCGG - Exonic
1131915254 15:97258087-97258109 CTCTGGACACAAAATCTCTGTGG - Intergenic
1132023848 15:98387919-98387941 CTGAGGAAACTGAAGCTCAGGGG - Intergenic
1132111029 15:99102601-99102623 CTCACAACACTGAAGCTCGGAGG - Intronic
1132247787 15:100310740-100310762 AGCTGGACAATGAAGCTTAGGGG - Intronic
1133100860 16:3478775-3478797 TTCTGGACACTGAAGACTAGGGG - Intronic
1133140424 16:3739805-3739827 CTCTGGCCACTGCAGATGAGCGG + Intronic
1133192973 16:4147820-4147842 CACTGGCCACTGTTGCTCAGGGG + Intergenic
1133660812 16:7915487-7915509 CTCGGGAGACTGTAGCTCACAGG - Intergenic
1133679618 16:8108750-8108772 CTCAGAAAACTGAGGCTCAGAGG + Intergenic
1133929192 16:10218385-10218407 ATGTGGAAACTGAGGCTCAGAGG + Intergenic
1134374169 16:13654666-13654688 CTCTGAACACTGTGGCTCAAAGG + Intergenic
1134874641 16:17686791-17686813 GTCTTGACTCTTAAGCTCAGGGG + Intergenic
1135055069 16:19225100-19225122 ATGAGGAAACTGAAGCTCAGAGG - Intronic
1136225501 16:28857716-28857738 CTCCGGACACTGAAACTCAGTGG - Intronic
1138207233 16:55133902-55133924 CACTGGACTCAGAAGCCCAGTGG + Intergenic
1138492352 16:57383887-57383909 CTTTGGACCCTGAGGCCCAGAGG + Exonic
1138549843 16:57741581-57741603 CTTTGGAACCTGAAGCCCAGTGG - Intronic
1138652340 16:58467914-58467936 ATCTGGAAACTGGAGCACAGTGG - Intronic
1139310607 16:66024984-66025006 CTGTAGACACTGAAGCTCAGTGG - Intergenic
1139327208 16:66161726-66161748 ATAAGGACACTGAAGCTCTGAGG - Intergenic
1139990811 16:70938228-70938250 CTGTGGACATTGAAGCACCGAGG + Intronic
1140142689 16:72273587-72273609 ATGTGGAAACTGAGGCTCAGTGG - Intergenic
1140696300 16:77537613-77537635 ACCAGGAAACTGAAGCTCAGAGG + Intergenic
1141300533 16:82811603-82811625 TTCTGGACACTGTAGTTCAGAGG - Intronic
1141713463 16:85713757-85713779 CCCTGGACACTGAAGCCAAGGGG + Intronic
1141750923 16:85957365-85957387 CTGGGGAAACTGAGGCTCAGAGG + Intergenic
1143013231 17:3877731-3877753 TTCAGGGCACAGAAGCTCAGGGG + Intronic
1143019156 17:3907725-3907747 CTCAGGACACTGAGGATCAGAGG - Intronic
1143037537 17:4007924-4007946 CTAGGGACACTGAGGCTCACAGG - Intronic
1143076020 17:4343958-4343980 CTCTGGAGACTAAAGCTCTGGGG + Intronic
1143267929 17:5654337-5654359 CTCTGGACACTGACGTGGAGGGG - Intergenic
1143298603 17:5891171-5891193 CCATGGGCACTGAAGCTGAGGGG - Intronic
1145772047 17:27500259-27500281 CTCTGGACCCTAATGCTCAAGGG - Intronic
1146263443 17:31436182-31436204 TTGAGGACACTGACGCTCAGCGG - Intronic
1146761695 17:35484415-35484437 CCTTAGACACTGAACCTCAGGGG + Intronic
1146986045 17:37219200-37219222 CTCTGGACACTGAAGGTCAATGG + Intronic
1147319622 17:39637861-39637883 CTCTGTACACTGAATCTCAGTGG + Intronic
1147664119 17:42134932-42134954 CTCTGGACACTACAGGTCAGTGG + Intronic
1147728497 17:42581882-42581904 ACCTGGACACTGATGCTGAGGGG - Exonic
1147844167 17:43393264-43393286 CTCAGGAGCCTGGAGCTCAGGGG - Intergenic
1147890987 17:43716684-43716706 CTCGGGACACTGAACCTGGGAGG + Intergenic
1147979612 17:44266447-44266469 CTCTGGATTCTGCAGCTCTGAGG - Intronic
1148247849 17:46046988-46047010 CTCTGGAATCTGAAGCACAGAGG + Intronic
1148544307 17:48505174-48505196 ATAAGGAAACTGAAGCTCAGAGG - Intergenic
1150478796 17:65493695-65493717 AGCGGGAAACTGAAGCTCAGAGG - Intergenic
1150715672 17:67570670-67570692 ATGAGGAAACTGAAGCTCAGAGG + Intronic
1151498869 17:74476060-74476082 CTCTGGACACCAAAGCTTGGAGG - Intronic
1151672664 17:75580235-75580257 GTTAGGAAACTGAAGCTCAGAGG + Intergenic
1152262718 17:79275585-79275607 CAATGGACACAGAAGCACAGGGG + Intronic
1152400641 17:80064545-80064567 CTGGGGACACTGAGGCACAGCGG + Intronic
1152996671 18:413857-413879 CTCTAGACAATTATGCTCAGTGG + Intronic
1153181630 18:2441676-2441698 CTCTGGAAACCGAAGCTCAGTGG - Intergenic
1155151815 18:23128999-23129021 CTATTGACACTGAACCCCAGAGG - Intergenic
1155209065 18:23585728-23585750 CTCAGGACACTGAGACTCACAGG - Intronic
1155394902 18:25376918-25376940 CTCTGGACAGTTAAGCTCCAGGG + Intergenic
1155708666 18:28847906-28847928 CACTGCACACTGTAGCTCTGAGG - Intergenic
1157110463 18:44815910-44815932 CTCTGGACATTGAAGCTGGGAGG - Intronic
1157159711 18:45302414-45302436 ATGTGGTCACTGAAGCCCAGAGG + Intronic
1157194596 18:45610551-45610573 CACTGAACACTGAAGCTGAAAGG + Intronic
1159275940 18:66221711-66221733 CTCTGGACTCCAAAGCTTAGGGG - Intergenic
1160789812 19:918221-918243 TTGTGGAAACTGAGGCTCAGAGG + Intronic
1161027934 19:2045267-2045289 ATAGGGACACTGAGGCTCAGGGG - Intronic
1161052045 19:2169250-2169272 CTCAGGACACTCAAGCTCAGAGG - Intronic
1161329887 19:3681674-3681696 CTATGTAAACTGAGGCTCAGAGG + Intronic
1162114255 19:8418951-8418973 CTCTGGACATTGTAGCTCTTGGG + Intronic
1162931259 19:13959108-13959130 CTCTGGGCTCTGGGGCTCAGGGG - Exonic
1163171243 19:15532717-15532739 CTCAGGAAACTGATGCTCTGAGG - Intronic
1163423797 19:17229779-17229801 CTTGGGAGACTGAAACTCAGAGG - Intergenic
1163571655 19:18085575-18085597 CTCTGTACACTGGGGATCAGCGG - Intronic
1163827753 19:19533104-19533126 GTGGGGAAACTGAAGCTCAGAGG + Intronic
1164206114 19:23060239-23060261 CCCTGGACGCTGAACCTAAGAGG - Intergenic
1164618045 19:29678325-29678347 CCCTGGCCACTGAGGCACAGAGG + Intergenic
1164768491 19:30789821-30789843 CTTCGGACATTGAAGCTCAGTGG + Intergenic
1164866124 19:31605852-31605874 CTGTGGGCACAGAAGCTGAGAGG + Intergenic
1165117937 19:33540288-33540310 CTCTGGAGGCTGAAGTGCAGTGG + Intergenic
1165146293 19:33732935-33732957 CTCTAGACACTGAGGCTCAGAGG - Intronic
1165348984 19:35266578-35266600 ATCTGGACACTGAGGGGCAGGGG + Intronic
1167300380 19:48674279-48674301 CTCTGGACACTGAGCCTGATGGG - Intergenic
1167751240 19:51381481-51381503 CTCTGGACACTGAAGCTCAGTGG + Intronic
1168065355 19:53916437-53916459 CTCTGGACACTGAAGTCCTCTGG - Intronic
1168252643 19:55149205-55149227 CTGAGGGCACTGAAGCTCCGGGG + Exonic
925054458 2:846453-846475 TACTGCACACAGAAGCTCAGGGG + Intergenic
925188628 2:1866009-1866031 CCTTGGACACTGTAGCTCGGAGG - Intronic
925307011 2:2855246-2855268 ATGAGGAAACTGAAGCTCAGAGG - Intergenic
925452199 2:3979202-3979224 CTGTGCACACTGAAGCTAAACGG - Intergenic
925709068 2:6720265-6720287 TTCTGGACATTGTAGCTCATTGG - Intergenic
925799268 2:7581579-7581601 CTCTGATCCCTGAAGATCAGAGG - Intergenic
925814319 2:7732787-7732809 CGCTGGACACCAAAGCTCAGGGG - Intergenic
925973091 2:9121400-9121422 CTCTGTACACTGGAGTGCAGTGG + Intergenic
925973386 2:9123636-9123658 ATCTGGACACTGCTGCTAAGAGG - Intergenic
926259065 2:11240072-11240094 CTCTGGATACTGACACTCAGTGG - Intronic
926784004 2:16502314-16502336 TTATGGAGACTGGAGCTCAGAGG + Intergenic
927101895 2:19794138-19794160 TTCAGGAAACTGAAGCTAAGGGG + Intergenic
928600894 2:32902366-32902388 ATGAGGAAACTGAAGCTCAGAGG + Intergenic
931444928 2:62318820-62318842 CTGAGGAAACTGAGGCTCAGAGG + Intergenic
933425098 2:82100646-82100668 CCCAGGAGACTGAAACTCAGTGG - Intergenic
934979023 2:98825160-98825182 CTATGGACACTGAAGGACAGAGG + Intronic
935609554 2:105006821-105006843 CTCCGGACACTGAAGCTTGGGGG + Intergenic
935667098 2:105522268-105522290 CTCTGGAGACTGGAGAGCAGTGG - Intergenic
935749251 2:106215873-106215895 CTCTAGACACTGAGGCTCAGGGG + Intergenic
935843959 2:107144635-107144657 CTCTGGAAACTTCATCTCAGAGG + Intergenic
936122052 2:109755486-109755508 CTCTAGACACTGAGGTTCAGGGG - Intergenic
936222642 2:110615988-110616010 CTCTAGACACTGAGGTTCAGGGG + Intergenic
936229481 2:110687512-110687534 CTCTGAACACCAAAGCTCAGTGG - Intergenic
936269451 2:111037678-111037700 CTGAGGAAACTGAGGCTCAGAGG + Intronic
936478693 2:112865032-112865054 CTCTGGACATTGGAGCTCAGAGG + Intergenic
937156226 2:119721292-119721314 CTCTGGATGTTGAAGCTCAGTGG + Intergenic
937840032 2:126515543-126515565 TTCTGGACACAGAGGCTCAGTGG - Intergenic
937880103 2:126858429-126858451 CTCTGGCTGCTGAAGCACAGAGG + Intergenic
937888787 2:126919220-126919242 CTCTGGATACCGAGGCTCAGTGG - Intergenic
937920627 2:127127030-127127052 GTCTGGACACTGAAGCTCAGTGG + Intergenic
938099058 2:128485877-128485899 CCAAGGTCACTGAAGCTCAGCGG - Intergenic
938564656 2:132507921-132507943 CTGTGAACACTGAAGCTCACTGG - Intronic
939721145 2:145653380-145653402 CTCTGGATACTGAGTCACAGGGG + Intergenic
939732935 2:145807922-145807944 CTTTGGACATGGAAGCTCAGTGG + Intergenic
940357580 2:152762313-152762335 CCCTGGTCCCTGAAGCCCAGTGG + Intergenic
944481434 2:200161428-200161450 CTCTGGACACTGAAGCTCAGCGG - Intergenic
945273206 2:207962300-207962322 CTCAGGACACTGAAGCTCAGAGG + Intronic
945539015 2:211059913-211059935 CCCAGGACACTGAAAGTCAGGGG - Intergenic
946418782 2:219553371-219553393 ATCAGGAAACTGATGCTCAGTGG - Intronic
948371344 2:237491384-237491406 CTCTGGGCACTGACGCTTTGGGG - Intronic
949068014 2:242005203-242005225 CCCTGGACTCTGAGACTCAGGGG - Intergenic
1168882339 20:1217522-1217544 CTCTGGAAGCTTCAGCTCAGAGG - Intergenic
1169408556 20:5347385-5347407 CTGAGGACACCGAGGCTCAGAGG + Intergenic
1169883854 20:10376164-10376186 CTCTGGACACCGAGGTTCCGTGG - Intergenic
1170805298 20:19624616-19624638 CTTTGGACACTGAAGGAGAGTGG - Intronic
1171276214 20:23858279-23858301 CTCTGAACACTGAAGATCCCAGG - Intergenic
1171496375 20:25559043-25559065 CTCTTGAGACTGAAGCTCACAGG - Intronic
1172055757 20:32153147-32153169 ATGGGGAAACTGAAGCTCAGAGG - Intronic
1172886077 20:38231669-38231691 ATGAGGAAACTGAAGCTCAGAGG - Intronic
1173480568 20:43395648-43395670 ATGTGGAAACTGAGGCTCAGGGG - Intergenic
1173565838 20:44037997-44038019 ATATGGACAATGAAGTTCAGTGG + Intronic
1174093222 20:48066725-48066747 CTCTGGAAGCAGAGGCTCAGGGG + Intergenic
1175623591 20:60471995-60472017 ATATGGAAACTGGAGCTCAGAGG + Intergenic
1175942819 20:62545839-62545861 CTTTGGACACTGGAGCTCAGAGG - Intergenic
1176289177 21:5035189-5035211 CAGAGGACACTGAAGCCCAGTGG - Intronic
1177443780 21:21165290-21165312 TTCTGGACACCCAAGCTCAGAGG - Intronic
1178552834 21:33556010-33556032 CTCTGCACACTAAAAATCAGGGG - Intronic
1178862808 21:36303629-36303651 CTCTGGAGACTGGAGAGCAGTGG + Intergenic
1179078843 21:38151200-38151222 CTCAGGAGACTGAGGCTTAGAGG - Intronic
1179730473 21:43364662-43364684 CTCTGGTCCCTGATGCTCAGAGG + Intergenic
1179868058 21:44228415-44228437 CAGAGGACACTGAAGCCCAGTGG + Intronic
1181465321 22:23107704-23107726 CTCTGCACACAGAACCCCAGGGG + Intronic
1181486996 22:23237790-23237812 CTCAGGCCACTGCAGGTCAGCGG - Intronic
1182049581 22:27302535-27302557 CTGTGGCCTCTGAAGCCCAGAGG + Intergenic
1182130177 22:27844893-27844915 AGCAGGACACTGAGGCTCAGGGG + Intergenic
1182547840 22:31085860-31085882 ATGGGGACACTGAAGCTCCGGGG + Intronic
1183478469 22:38050154-38050176 CTGAGGTCACTGAGGCTCAGAGG + Intergenic
1184143706 22:42595743-42595765 TAGTGGACACTGAAGTTCAGGGG - Intronic
1184196167 22:42930200-42930222 CTCTGGACTCTGCAGATGAGAGG + Intronic
1184641693 22:45876398-45876420 CTCTGGACATTGAGGCTCCTTGG + Intergenic
1184670572 22:46010432-46010454 CTGTGGACCCAGAAGCTCTGGGG + Intergenic
1184813628 22:46854125-46854147 CACTGGGCAATGAGGCTCAGAGG - Intronic
1184867951 22:47213576-47213598 CTCTAGACCCTGAGGCACAGTGG - Intergenic
1184893947 22:47396373-47396395 CTGTGGAAACTGAAGGTCAAGGG - Intergenic
1185279360 22:49963381-49963403 CTCCGGACACAGCAGCACAGAGG - Exonic
949792782 3:7811605-7811627 CTCTGGACACTAAAGCTCAAGGG + Intergenic
950140693 3:10613125-10613147 CTCTGGACACCAAAGCTCAGTGG + Intronic
950236119 3:11321698-11321720 CTGAGGAAACTGAGGCTCAGAGG - Intronic
950333086 3:12172619-12172641 CTGTGAACACTGAAGCTCAGAGG - Intronic
950533038 3:13564038-13564060 CACTTGACACTGAAGCTGTGGGG - Intronic
951474863 3:23093974-23093996 ATAAGAACACTGAAGCTCAGAGG - Intergenic
951740817 3:25921334-25921356 CATTGGATACTGTAGCTCAGTGG - Intergenic
952583527 3:34864010-34864032 ATGGAGACACTGAAGCTCAGAGG + Intergenic
953741712 3:45544355-45544377 CTCAGGAAACTGAGGCTTAGAGG - Intronic
954433877 3:50485746-50485768 CCCTGGTAACTGAGGCTCAGGGG + Intronic
954464303 3:50645710-50645732 CTCTGGACCCAGGACCTCAGGGG - Exonic
954985492 3:54787472-54787494 CTTTGGTCACTGAATCTAAGAGG - Intronic
955405260 3:58621900-58621922 GTCAAGACACTGAGGCTCAGAGG - Intronic
955405555 3:58623558-58623580 CTGAGGAAACTGAGGCTCAGAGG + Intronic
955952809 3:64259366-64259388 CTGAGGACACTGAAGTTCTGAGG + Intronic
956408556 3:68954269-68954291 CTCTGTTCACTGCACCTCAGGGG + Intergenic
957939701 3:86990375-86990397 CTGTGGTCACCGGAGCTCAGAGG - Intronic
960510612 3:118544729-118544751 CTGTGGATACTCAAGGTCAGAGG + Intergenic
960591020 3:119365475-119365497 CTCTGGACACCGATGGACAGAGG - Intronic
961488637 3:127235274-127235296 CACTGGACACTGGGGATCAGGGG + Intergenic
961822992 3:129584727-129584749 CTGGGGAAACTGAGGCTCAGAGG - Intronic
962446720 3:135472507-135472529 ATCTGGGCTCTGCAGCTCAGAGG + Intergenic
962927690 3:140010637-140010659 CTCTGGACACTGCATCCCACAGG + Intronic
963070971 3:141304987-141305009 CTCTGAGCTCTGAGGCTCAGAGG + Intergenic
963135548 3:141900335-141900357 CTCTGGACACTGAAGTTCAGTGG + Intronic
964092665 3:152894671-152894693 CTCTGGCAACTGAAGGTAAGGGG - Intergenic
964915177 3:161832206-161832228 CTCTGGACACTGAAGCTCAGTGG - Intergenic
965252455 3:166359805-166359827 TTCTGGAGAGTGAAGCTAAGAGG + Intergenic
965346762 3:167560467-167560489 CTCTAGACACTAAAGCTGAATGG - Intronic
965408825 3:168304167-168304189 CTCTGGACACTGAGGCTCAGCGG - Intergenic
965442155 3:168727965-168727987 ATGTGAAAACTGAAGCTCAGAGG + Intergenic
965518442 3:169647825-169647847 TTGAGGACACTGAGGCTCAGAGG + Intronic
965700603 3:171456973-171456995 CTTGGGAAACTGAAGCCCAGAGG - Intronic
966264118 3:178017066-178017088 CTGTGGTCCCTGAAGTTCAGGGG + Intergenic
968208640 3:196827224-196827246 CTCTGGATTCTGAAGTTCTGGGG - Exonic
968228523 3:196990785-196990807 CCCTGGGCACTGGAGCTCACGGG + Intronic
968560361 4:1277778-1277800 CTCTGGGCATTGCACCTCAGGGG - Intergenic
969129017 4:4977333-4977355 CCCTGGACAATGAGTCTCAGTGG + Intergenic
970909996 4:21263776-21263798 CTCTAGTCCCAGAAGCTCAGGGG - Intronic
971208173 4:24590228-24590250 CTGCAGACACTGAAGCTCAGTGG - Intergenic
971767438 4:30851111-30851133 CTGTAGACCCTGAAGCTGAGAGG + Intronic
972528216 4:39937067-39937089 CTGTGAACACTAAAGCTCAGGGG - Intronic
972704223 4:41525864-41525886 CTCTGGACCCTGGAGCTCTGGGG + Intronic
973671078 4:53218991-53219013 CTCTGGAAGCTTCAGCTCAGAGG + Intronic
975350196 4:73337717-73337739 CTTTGCACACAGAAGCACAGGGG - Intergenic
975643716 4:76525917-76525939 CTCTGGAGATTCTAGCTCAGGGG - Intronic
975849812 4:78560551-78560573 TTCTGGACACTGAGGCTCAGAGG - Intronic
976735154 4:88301675-88301697 CTTTTGACATTGAAGCTAAGAGG + Intergenic
977772440 4:100875711-100875733 CTCTGGACACTGAAGTTCAGTGG - Intronic
980107359 4:128600550-128600572 CTCTGCAAACTGCAGCACAGAGG - Intergenic
981295489 4:143126340-143126362 CTCTAGACACTGAAGCTCAGTGG - Intergenic
981520095 4:145652232-145652254 CTTGGGACACTAAAGCTCAGGGG - Intronic
981533233 4:145773373-145773395 CTCTGGCCACTTTGGCTCAGTGG - Intronic
983694361 4:170510447-170510469 CTCTGGAAACTTCATCTCAGGGG + Intergenic
983954924 4:173686347-173686369 GACTGGACACTGAGGCTCAGAGG - Intergenic
984446746 4:179847344-179847366 CTCTTGTCACTGAAGTGCAGTGG + Intergenic
985823816 5:2178606-2178628 CTCTGCACACTGATGGACAGGGG + Intergenic
986424145 5:7613584-7613606 CTTTGCACACCAAAGCTCAGTGG - Intronic
988207426 5:28157984-28158006 CTTTGGATACAGAACCTCAGGGG + Intergenic
989185839 5:38625155-38625177 ATCAGGAAACTGAGGCTCAGAGG - Intergenic
990567210 5:57041764-57041786 CCCTGGACTCTGATGCTCAGAGG - Intergenic
992717525 5:79525814-79525836 CTCTGGATGCTGAGGCTCAGGGG + Intergenic
996144373 5:119955627-119955649 CTCTGGATGCTGAAGCTCAGTGG + Intergenic
998033147 5:138890644-138890666 CTCTGAACACTGAAACTCAGTGG - Intronic
999231125 5:150062482-150062504 CTCTAGGCACTGCACCTCAGTGG + Intronic
1000483926 5:161815119-161815141 ATCAGGAAACTGAAGTTCAGAGG + Intergenic
1000523472 5:162326914-162326936 CTCCAGACATTGAAGTTCAGTGG + Intergenic
1000982177 5:167827788-167827810 CTCTGGACAATGAACTTCAGAGG + Intronic
1001122351 5:168991292-168991314 CTAAGAACACTGAGGCTCAGAGG + Intronic
1001522400 5:172403922-172403944 ATGTGGAAACTGAGGCTCAGAGG + Intronic
1001689633 5:173623536-173623558 CTCTGGACCGTGAGGCCCAGGGG + Intergenic
1001866413 5:175109594-175109616 CTTGGGACAATGAAGCTCAGTGG - Intergenic
1002051473 5:176573993-176574015 CTGAGGACACTGAAGCTCAGGGG + Intronic
1002464993 5:179403813-179403835 CTCTTGTCACAGAAGCTGAGAGG - Intergenic
1002553959 5:180019840-180019862 CACTGGACACTCAAGCACTGGGG + Intronic
1003048607 6:2760402-2760424 CTCTGGACATAGAAACTCAGTGG - Intergenic
1003168097 6:3698997-3699019 CTCTAGACACCAAAGCTCATTGG + Intergenic
1003312131 6:4978583-4978605 CTCTGGACACTGTAGCCCCCTGG - Intergenic
1003344733 6:5256693-5256715 CACAGGGCTCTGAAGCTCAGAGG - Intronic
1003640776 6:7873486-7873508 CTCCAGACACTGAGGCTCAGTGG - Intronic
1006521679 6:34574649-34574671 CTCTGGACACAGTACCTCTGAGG - Intergenic
1006731163 6:36237041-36237063 CTCTGGACTGTGAAGCTGAAGGG - Intergenic
1007214740 6:40228284-40228306 CTTTGGACACTGAAGAGCACGGG + Intergenic
1008254244 6:49276550-49276572 CTCTGGAAACTTTATCTCAGAGG - Intergenic
1009892680 6:69706928-69706950 CTGTGCACAGTGCAGCTCAGTGG + Intronic
1010517027 6:76785771-76785793 CTCTGGAAACTTTATCTCAGAGG + Intergenic
1010682995 6:78818295-78818317 CTCTGGAAACTTCATCTCAGAGG - Intergenic
1010721304 6:79285446-79285468 CTCTGGAAACTTCATCTCAGAGG - Intergenic
1013290314 6:108713629-108713651 ATGTGGAAACTGAGGCTCAGAGG + Intergenic
1016539328 6:145145846-145145868 CTCTGTACCCTGATTCTCAGGGG - Intergenic
1016574019 6:145547374-145547396 CTCTGGTCACTACAGTTCAGTGG + Intronic
1017719189 6:157233165-157233187 CTGGGGAAACTGAGGCTCAGAGG + Intergenic
1017999889 6:159569746-159569768 CTCTGGACACTGAAGCTCAGTGG - Intergenic
1019368984 7:650985-651007 CTCTGGACCAGGAAGCTCAGAGG + Intronic
1019518058 7:1448249-1448271 CAGTGGGCACAGAAGCTCAGGGG + Intronic
1020172662 7:5857164-5857186 CTCTTGACTCTGAAGCTGAGTGG + Intergenic
1021875807 7:25047926-25047948 CCCTGGAAACTGAAACTCAGAGG + Intergenic
1022031352 7:26494041-26494063 CTCTGGTCATTAAATCTCAGGGG - Intergenic
1022628927 7:32067034-32067056 TTCTGCACACTAACGCTCAGAGG - Intronic
1024163701 7:46708014-46708036 ATCTGGACACTGAGGCTTGGAGG - Intronic
1024331635 7:48160847-48160869 CTCTTGCCACTGAAGGTGAGGGG - Intergenic
1024858203 7:53806258-53806280 CCCTGGACACTAATGCTCAGTGG - Intergenic
1026061420 7:67030091-67030113 CCCTGGACACTGAAGCTCAGTGG - Intronic
1026345233 7:69467843-69467865 AGCTGGACACTGGGGCTCAGTGG - Intergenic
1026716930 7:72797343-72797365 CCCTGGACACTGAAGCTCAGTGG + Intronic
1029086119 7:98013083-98013105 CTCTTGACTCGGAAGCTGAGGGG - Intergenic
1029146849 7:98452484-98452506 CTGTGGACACTGAGGCTTGGGGG + Intergenic
1029159849 7:98543825-98543847 CTGGGGACCCTGAGGCTCAGTGG + Intergenic
1029582804 7:101448456-101448478 GTCTGGAGGCTGAGGCTCAGCGG + Intronic
1031666763 7:124494268-124494290 CTCAGGTCACTGAAGTTCATTGG + Intergenic
1032109426 7:129062887-129062909 CTCTGAACACCAAAGTTCAGTGG + Intergenic
1032486040 7:132288173-132288195 GTGTGGAAACTGAAGCACAGAGG - Intronic
1032705502 7:134418141-134418163 CTCAAGAAACTGAAGCTCTGAGG - Intergenic
1032787216 7:135210648-135210670 ATCAGGCCACTGAAGCCCAGAGG + Intronic
1032992817 7:137412530-137412552 ATGTGGAAACTGAGGCTCAGAGG - Intronic
1033244428 7:139706307-139706329 CTCTGAACCCTGAATCACAGGGG - Intronic
1033485413 7:141784358-141784380 GAGGGGACACTGAAGCTCAGAGG + Intronic
1035549585 8:510128-510150 CTCTGGATGCTGAAGCTTAGTGG - Intronic
1039488741 8:37931777-37931799 CTCTGGACACCAAGGCTTAGGGG - Intergenic
1040383422 8:46894720-46894742 CTCTGGAAACTTCATCTCAGAGG - Intergenic
1040385570 8:46912897-46912919 CACTGGGGACTGATGCTCAGGGG - Intergenic
1040430855 8:47340796-47340818 TTCTGGATACTAAAGCTCAGTGG + Intronic
1041024800 8:53672940-53672962 CAGTGGATACTGAAGGTCAGGGG + Intergenic
1043694373 8:83201535-83201557 CCATAGACTCTGAAGCTCAGTGG - Intergenic
1045009158 8:97942967-97942989 CTCTGGACTCTGAATCGCAGGGG + Intronic
1045303737 8:100938330-100938352 ATCAAGACACTGCAGCTCAGGGG - Intronic
1045709576 8:104967254-104967276 ATTTGGTGACTGAAGCTCAGAGG + Intronic
1046126425 8:109914515-109914537 GTTTGGAAACTGAAGATCAGAGG + Intergenic
1046587688 8:116167838-116167860 GTCTGGATATTGAGGCTCAGAGG + Intergenic
1047595649 8:126375158-126375180 CTGTGTACCCTGAAGCTCCGGGG - Intergenic
1049713426 8:144078029-144078051 CTCTTGCCACTTAACCTCAGCGG - Intergenic
1049929696 9:444535-444557 CTCTGGACACTGAGACTTGGCGG - Intronic
1050032475 9:1400969-1400991 CTATGGAATGTGAAGCTCAGGGG + Intergenic
1050433554 9:5586118-5586140 CTCAGGAAACTGAGGCTCATAGG - Intergenic
1050584107 9:7092248-7092270 CTGTGGAACCTGAGGCTCAGAGG + Intergenic
1052566765 9:30163961-30163983 ATCAGGACACTGAAACTCTGTGG - Intergenic
1052999540 9:34570039-34570061 CTCTTCAGACTGAAGGTCAGGGG - Intronic
1053024403 9:34718292-34718314 TTCTGGAAACTGAATCTCACTGG + Intergenic
1053189389 9:36049198-36049220 CTCTGGACATAGAAGCTCAGTGG - Intronic
1053510413 9:38683083-38683105 ACCTGGACATTGAAGCTCAGTGG + Intergenic
1055451019 9:76431563-76431585 CTCTGGTCATGGAGGCTCAGTGG - Intronic
1055666081 9:78554512-78554534 CTGAGGACATTGAAGCACAGAGG + Intergenic
1056727050 9:89128536-89128558 CTCTGGAAACTTCATCTCAGAGG - Intronic
1056855921 9:90129631-90129653 CTCTGGAAACAGAAGAGCAGAGG + Intergenic
1057485662 9:95481271-95481293 AACTGTACACTGAAGGTCAGGGG + Intronic
1057897712 9:98923037-98923059 CCCTGTTCACTGGAGCTCAGGGG + Intergenic
1058217637 9:102254740-102254762 CTCAGGATCCTGCAGCTCAGGGG + Intergenic
1059913269 9:119070162-119070184 CTCTGGCCTCTGAAGTTCAGAGG + Intergenic
1059947027 9:119419685-119419707 AAGTAGACACTGAAGCTCAGAGG - Intergenic
1060069415 9:120533352-120533374 CTCTACTCACTGAAGCTCACAGG + Intronic
1061260438 9:129477602-129477624 ATGAGGACACTGAGGCTCAGAGG - Intergenic
1061400849 9:130367559-130367581 CTCAGGCCACTGTAGCTAAGTGG + Intronic
1061957471 9:133971166-133971188 CTTTGGAGACTGAGGGTCAGAGG - Intronic
1062397934 9:136359995-136360017 GTCTGGACACTGAGCCACAGTGG + Intronic
1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG + Intergenic
1186569486 X:10699174-10699196 CCCTGGTCACTGAATCTAAGAGG + Intronic
1186822409 X:13304012-13304034 ATGTGTACACTGAAACTCAGTGG - Intergenic
1187595537 X:20767830-20767852 CACATGTCACTGAAGCTCAGTGG - Intergenic
1187935773 X:24334516-24334538 TTCTGGACACCAAGGCTCAGGGG - Intergenic
1188029016 X:25243544-25243566 ATATGGACACAGAAACTCAGCGG - Intergenic
1188835405 X:34948408-34948430 CTCTGGTGGCTGAGGCTCAGGGG - Intergenic
1189730851 X:44019179-44019201 CTCTGAACACAGAATTTCAGTGG - Intergenic
1190258723 X:48784989-48785011 ATGAGGACACTGAGGCTCAGAGG + Intergenic
1190972806 X:55368351-55368373 CCCTAGCCACTGAACCTCAGGGG + Intergenic
1191683860 X:63869097-63869119 ATGAGGAAACTGAAGCTCAGAGG - Intergenic
1191998911 X:67127109-67127131 CTCAGGACCCTGATGCTCTGTGG + Intergenic
1192328206 X:70151294-70151316 ATAAGGAAACTGAAGCTCAGAGG - Intronic
1192397861 X:70801435-70801457 CTCTGGATGCTGAGGCTAAGGGG + Intronic
1193070993 X:77305225-77305247 CTCTGGAAAGTTCAGCTCAGAGG - Intergenic
1193477305 X:81982232-81982254 CTCTGGACACTTCACCCCAGAGG - Intergenic
1193606984 X:83581102-83581124 CTCTGGACAATGAAACTGGGAGG + Intergenic
1193702709 X:84782334-84782356 CTAAGGGCATTGAAGCTCAGAGG + Intergenic
1193827203 X:86241239-86241261 ATATGGACAATGAAGTTCAGTGG + Intronic
1194508996 X:94768869-94768891 CTCTGGAAACTTCATCTCAGAGG + Intergenic
1196020713 X:110987934-110987956 ATGAGGAAACTGAAGCTCAGAGG - Intronic
1197614617 X:128677375-128677397 ATCTGAAAACTGAGGCTCAGAGG - Intergenic
1199145411 X:144360327-144360349 CTCTGGATACTGAAGAGCACAGG + Intergenic
1201909587 Y:19120614-19120636 CTCTGGACCCTGCAGCTGAATGG + Intergenic
1201956485 Y:19629520-19629542 CTCTGGAAACTTCATCTCAGAGG + Intergenic