ID: 1128283434

View in Genome Browser
Species Human (GRCh38)
Location 15:66416343-66416365
Sequence GTGTGTTTGGGGGGGATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 614
Summary {0: 1, 1: 1, 2: 4, 3: 58, 4: 550}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128283434_1128283450 24 Left 1128283434 15:66416343-66416365 CCTACAATCCCCCCCAAACACAC 0: 1
1: 1
2: 4
3: 58
4: 550
Right 1128283450 15:66416390-66416412 CAGACTGCCTTGTGAGGACAGGG 0: 1
1: 0
2: 0
3: 19
4: 270
1128283434_1128283449 23 Left 1128283434 15:66416343-66416365 CCTACAATCCCCCCCAAACACAC 0: 1
1: 1
2: 4
3: 58
4: 550
Right 1128283449 15:66416389-66416411 TCAGACTGCCTTGTGAGGACAGG 0: 1
1: 0
2: 1
3: 15
4: 138
1128283434_1128283447 18 Left 1128283434 15:66416343-66416365 CCTACAATCCCCCCCAAACACAC 0: 1
1: 1
2: 4
3: 58
4: 550
Right 1128283447 15:66416384-66416406 ACCTTTCAGACTGCCTTGTGAGG 0: 1
1: 0
2: 0
3: 17
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128283434 Original CRISPR GTGTGTTTGGGGGGGATTGT AGG (reversed) Intronic
900481112 1:2899776-2899798 GTGTGTGTGAAGGGGGTTGTGGG + Intergenic
900575148 1:3379269-3379291 GTGTGTTGGGAGGGGTGTGTTGG - Intronic
900575211 1:3379451-3379473 GTGTGTTGGGAGGGGTGTGTTGG - Intronic
900575304 1:3379759-3379781 GTGTGTTGGGAGGGGTGTGTTGG - Intronic
900575368 1:3379941-3379963 GTGTGTTGGGAGGGGTGTGTTGG - Intronic
900575373 1:3379955-3379977 GTGTGTTGGGAGGGGTGTGTTGG - Intronic
900710072 1:4108017-4108039 GTGTGTTTTGGGGGGGTGGGTGG - Intergenic
900938890 1:5784928-5784950 GTGTGTGTGGGGGGGGGGGTGGG + Intergenic
901678511 1:10900327-10900349 GTGTGTGTGGCGGGGATGGCAGG + Intergenic
901881746 1:12198158-12198180 GTGTCCATGGGGGTGATTGTGGG - Intronic
902742319 1:18447328-18447350 GTGTGTATGGTGGGGGTTGGGGG + Intergenic
903771820 1:25769092-25769114 GTGTGTGTGGGAGGGAGTGTGGG - Intronic
904236317 1:29119621-29119643 GTGTGTGTTGGGGGGATGCTTGG + Exonic
904332066 1:29766791-29766813 GTGTTTTTGGGGGGCATTGGGGG + Intergenic
905174473 1:36127129-36127151 GTGTGTCTGTGGGGGGGTGTGGG + Intergenic
905390123 1:37630826-37630848 GGGTGTGTGTGGGGGAGTGTGGG - Intronic
905517055 1:38569745-38569767 GTGTGTTTTGGGGGGTGTCTTGG - Intergenic
905597873 1:39224177-39224199 GTGTGTATGGGGGGGAGTAGGGG - Intronic
906023979 1:42657563-42657585 GTGGGTTGGCGGGGGATTGTGGG - Intergenic
907950896 1:59182640-59182662 CTGTGTTTGGAGGGGATTTGTGG + Intergenic
908494188 1:64678250-64678272 GAATGCTTCGGGGGGATTGTGGG + Exonic
908696315 1:66845848-66845870 GTGTGTGTGGTGGGGGTTGGGGG + Intronic
908855067 1:68417581-68417603 GTGTGTTTGGGGAGGGTTAATGG + Intergenic
909562292 1:77020396-77020418 GTTTGTTTGTTGGGGAGTGTGGG + Intronic
909807171 1:79885663-79885685 GTGTGTTTGTGGGTGAGTATTGG - Intergenic
910201242 1:84701861-84701883 GTGTGTGTGGGGGGGGGTGGGGG + Intergenic
912771196 1:112465431-112465453 GTGTGTGTTGGGTGGGTTGTTGG - Intergenic
913968929 1:143399270-143399292 GTGTTTTTTGGGGGGGTTGGGGG - Intergenic
914063307 1:144224869-144224891 GTGTTTTTTGGGGGGGTTGGGGG - Intergenic
914115843 1:144741485-144741507 GTGTTTTTTGGGGGGGTTGGGGG + Intergenic
915007806 1:152656182-152656204 GTGTGTGTGTGGGGGAGGGTGGG + Intergenic
915530381 1:156499627-156499649 GGGAGTTTGGGGGGGCTTTTGGG - Intronic
915733557 1:158070698-158070720 GTGTGTGTGGTGAGGGTTGTGGG + Intronic
916465533 1:165071046-165071068 GTGTGTGTGGTGGTGATTTTGGG - Intergenic
916483084 1:165233044-165233066 GTGTTTATGGTGGGGGTTGTAGG - Intronic
917002602 1:170375944-170375966 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
917414803 1:174797627-174797649 GGGTGTGTGGGGGGGTGTGTGGG + Intronic
918248202 1:182679280-182679302 CTGTGTTTCGGGGGAATGGTGGG - Intronic
918381700 1:183962515-183962537 GAGTGTCTGGGGGTGATTTTAGG - Intronic
919230328 1:194764989-194765011 GTGTGTTTGGGGTGGCTCCTGGG + Intergenic
919583639 1:199408672-199408694 GTGTGTATGTGGGGGTGTGTTGG - Intergenic
920181458 1:204134492-204134514 GTGAGTGTGGGGGTGATGGTGGG - Intronic
920432920 1:205930111-205930133 GTGTGTGTGGGGCGGGTCGTTGG - Intronic
920650689 1:207835208-207835230 GTGTGTTTGTTGGGGATTTAGGG - Intergenic
920679981 1:208064874-208064896 GTGTGTTGGGCGGGGCTGGTGGG - Intronic
921892001 1:220363023-220363045 GTTTCTTTGGGGGCTATTGTAGG + Intergenic
922127062 1:222738038-222738060 GTGTGTGTTGGGGGGATGGAGGG + Intronic
922850343 1:228727949-228727971 GTGTGTTTGGGGAGGGAAGTTGG + Intergenic
923908577 1:238413833-238413855 GTTTGTTTGGAGAGGAATGTAGG - Intergenic
924567065 1:245207756-245207778 GTGTGTTTGGGGGGAGCTGTGGG - Intronic
1062831352 10:608159-608181 GTGTGTGTGGGGGGGGCTGTGGG - Intronic
1062831375 10:608228-608250 GTGTGTGTGGGGGGGGCTGTGGG - Intronic
1062831412 10:608358-608380 CTGTGTGTGGGGGGGGCTGTGGG - Intronic
1062831435 10:608418-608440 GTGTGTGTGGGGGGGGCTGGGGG - Intronic
1062831465 10:608486-608508 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1062831481 10:608514-608536 GTGTGTGTGGGGGGGTGTGTGGG - Intronic
1062849608 10:733515-733537 GTGTGTTTGTGAGAGTTTGTGGG + Intergenic
1063155934 10:3379266-3379288 TTGTGTTTTGGGTGGATTGCTGG - Intergenic
1063174668 10:3540590-3540612 GTGTGTGTGGGGGAGAGTGGGGG - Intergenic
1064604594 10:17025878-17025900 GTGTGTGTGGAAGGGATTGCGGG + Intronic
1065164999 10:22966986-22967008 GTGTGTTTGGGGGCGGGGGTGGG + Intronic
1066444930 10:35473558-35473580 GTGATTTTGGGGTGGATTGAGGG + Intronic
1067905425 10:50286079-50286101 GTGTGTGTGGAGGGGAGGGTGGG - Intergenic
1068576939 10:58694710-58694732 ATGTGTTTGGGGGTGGTGGTGGG + Intronic
1068764869 10:60752026-60752048 GTGTGTGTCGGGGGGATGGGGGG - Intergenic
1069461853 10:68603025-68603047 CTGTGTTTGGGAGGGAGAGTGGG + Intronic
1069562676 10:69441818-69441840 GTGTGTTTGGGGGTGGAAGTGGG - Intergenic
1069828713 10:71269934-71269956 GTGTGTGTGGGAGGGGTTGGGGG + Intronic
1070775720 10:79108644-79108666 GTGTATTAGGGGGTGATGGTTGG - Intronic
1070927696 10:80236502-80236524 GTCTGTTGGGGGAGGATTCTGGG - Intergenic
1071145494 10:82565490-82565512 GTGTGTTTGGTGGGGATTGAAGG - Intronic
1071447435 10:85761806-85761828 GTGTGTTTTGGGGGGTGTGGGGG - Intronic
1072278339 10:93844297-93844319 GTGTGCATGGGGGAAATTGTGGG + Intergenic
1072881843 10:99235913-99235935 GTGTGTGTTGGGGGGGTGGTGGG - Intergenic
1074528236 10:114279323-114279345 GAGTGTTTGGGAGGGATGGGTGG - Intronic
1075906476 10:126086004-126086026 GTGTGTGGGAGGGGGATTGCAGG + Intronic
1076065344 10:127443858-127443880 GTGTGTTTTGGGGGGTCTCTGGG + Intronic
1076097006 10:127739920-127739942 GTGTGTGTGGGTGTGAGTGTGGG - Exonic
1076120516 10:127933244-127933266 GTGTGTATGGAGGGGGTGGTAGG - Intronic
1076239930 10:128897178-128897200 GTGTGTGTGGGGGGGAGTTTGGG - Intergenic
1076292535 10:129358152-129358174 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
1076405209 10:130207497-130207519 GTGTGTGTGTGTGAGATTGTGGG - Intergenic
1076729298 10:132430239-132430261 GTGTGTTTGTAGGTCATTGTGGG + Intergenic
1077232816 11:1465740-1465762 CTGTGTTTGGTGGAGACTGTTGG - Intergenic
1077344444 11:2039785-2039807 CTGTGTTTGGGGGGGTTTTGGGG + Intergenic
1077519802 11:3025880-3025902 GTGAGGTTTAGGGGGATTGTGGG - Intronic
1078468404 11:11567873-11567895 GGGTGTTTTGGGGTGATTGGTGG - Intronic
1079333637 11:19552887-19552909 GTGTGTGTGGGGGGGAAGGGGGG + Intronic
1080262011 11:30359615-30359637 GTGTGTTTGGTGGGGTGGGTAGG + Intergenic
1080800192 11:35603184-35603206 GTGTGTGTGGAGGGGATATTAGG - Intergenic
1081296183 11:41392536-41392558 GTTTGTTTGGGGGAGGTGGTGGG - Intronic
1082041599 11:47690171-47690193 GTGTGATTGTGGGGAATTATCGG - Exonic
1082575720 11:54800929-54800951 TTGTGTTTCTGTGGGATTGTTGG - Intergenic
1083510893 11:63208740-63208762 GTGTGCTTGGAGGTGAGTGTGGG + Intronic
1083653601 11:64218656-64218678 GTGAGTTTCAGCGGGATTGTTGG + Intronic
1084035124 11:66504959-66504981 GTGTGTGTCGGGGGGGTGGTGGG - Intronic
1084141670 11:67235224-67235246 TTCTGTTTGGGAGGGGTTGTGGG + Intronic
1084373007 11:68756921-68756943 GAGTCTTTGGGTGGAATTGTGGG - Exonic
1084815264 11:71642116-71642138 ATGTGTCTGGCGGGCATTGTGGG - Intergenic
1085400485 11:76232890-76232912 GTGTGTGTTGGGGGGCGTGTGGG - Intergenic
1085990043 11:81830740-81830762 GTGTGTTTGGGTGGGGATGTTGG - Intergenic
1086833228 11:91592220-91592242 GTGGGGTTGGGGGGGATGGGAGG + Intergenic
1087308219 11:96508322-96508344 GTGTGTTTGGGGGTGGGGGTGGG + Intergenic
1087429916 11:98040567-98040589 GTGTGTATGTGGGTGGTTGTGGG - Intergenic
1088016198 11:105063288-105063310 GTGTGTGTGGTTGGGAGTGTGGG - Intronic
1089318929 11:117611973-117611995 TTGTGTGTTGGGGGGATGGTAGG - Intronic
1089410774 11:118240716-118240738 GTGTGTCTGCGGGGGATGGAAGG - Intronic
1089841902 11:121425892-121425914 GTGTGTGTGGCGGGGCTTGGTGG - Intergenic
1090619528 11:128548978-128549000 GTGTATTTTGGGAGGATTGCAGG + Intronic
1091091474 11:132775452-132775474 GTGTGTTTGGTGGTTATTGAAGG - Intronic
1091150770 11:133326496-133326518 GTGTGTATGTGTGGGAGTGTGGG + Intronic
1091150939 11:133327193-133327215 GTGTGTATGAGGGGGTATGTGGG + Intronic
1091196881 11:133738959-133738981 GTGTGTATGGGGGTGTGTGTGGG + Intergenic
1091196935 11:133739164-133739186 GTGTGTATGGGGGGGTGTGGGGG + Intergenic
1202827430 11_KI270721v1_random:94974-94996 CTGTGTTTGGGGGGGTTTTGGGG + Intergenic
1091396345 12:156157-156179 GTGTGTGTGGGTGGGGGTGTGGG - Intronic
1092239357 12:6827883-6827905 GTGTGTGTGTGGGGGAGTGCAGG + Intronic
1092259497 12:6945358-6945380 TTTTGTTTGGGGGGGGTTGGTGG + Intronic
1096107051 12:49002410-49002432 ATGTGAGTGGGGAGGATTGTGGG - Exonic
1097140218 12:56896455-56896477 GTGCGTGTGGGGGGGTGTGTGGG - Intergenic
1098434784 12:70457123-70457145 GTGTGTTTGGGGGTGGGAGTAGG + Intergenic
1098904137 12:76144391-76144413 GTGTGTGTGGGTGGGTGTGTGGG + Intergenic
1099271785 12:80520018-80520040 GTGTTTTGGGTGGGGATTGGGGG + Intronic
1099448940 12:82785360-82785382 TTGTGTTTGGGGGGGACGGGGGG - Intronic
1100874571 12:98948762-98948784 GTGTGTGTGGGGGGGGGTGTGGG - Intronic
1100993989 12:100282289-100282311 GTGGGTTTTGTGGGGTTTGTGGG - Intronic
1101583460 12:106064788-106064810 GTGTGTGTGGGGGGGGGTGGGGG - Exonic
1101821012 12:108184307-108184329 GTGTGTTTGGGGGGTGGTGGTGG - Intronic
1102029505 12:109731763-109731785 GGGTGTGTGGAGGGGTTTGTCGG + Intronic
1103269989 12:119665242-119665264 GTTTGTTTGGGGGAGAATCTAGG + Intergenic
1103815728 12:123654196-123654218 GTGTGTTTTGGGTGTATTTTGGG + Intronic
1105062584 12:133166938-133166960 GTGTGTTTGGGGGTGTTTTCAGG + Intronic
1105321842 13:19331976-19331998 GTGTGTTTCTGGGGGAGTGGAGG - Intergenic
1105876905 13:24563868-24563890 GTGTGTTTCTGGGGGAGTGGAGG + Intergenic
1106136192 13:26975578-26975600 GTGTGTGTGGGGGTGGGTGTCGG - Intergenic
1106896631 13:34309868-34309890 GTGTGTTTGGTGGGGGTGGGGGG + Intergenic
1109266485 13:60206543-60206565 GTGTGTGTGAGGGTGAATGTGGG - Intergenic
1110035321 13:70675012-70675034 GTTTATTTTGGGGGTATTGTAGG + Intergenic
1111052615 13:82905073-82905095 ATGTGTTTGGGAGGGACTGGTGG + Intergenic
1111981886 13:95025272-95025294 GTGTGTGTGGGGGTGTGTGTGGG - Intronic
1112186591 13:97133723-97133745 GTGTGTTTGGTTGTGATTATAGG - Intergenic
1112337217 13:98525447-98525469 GTGACTTTGGAGGGGAATGTTGG - Intronic
1112503159 13:99957373-99957395 GTGTGTGTGGGGGGGGTGGTAGG + Intergenic
1113223299 13:108129928-108129950 CTGTGTTTGGAGGGGAAAGTGGG + Intergenic
1113323131 13:109256756-109256778 GTGTGTTTGGGGGTGAGGCTGGG + Intergenic
1113641029 13:111956668-111956690 GTGCGTTTGGGGCGGTTTGGGGG + Intergenic
1115358278 14:32473022-32473044 GTGTGTTTGGGTGAGCTTCTGGG - Intronic
1115389646 14:32840740-32840762 GTGTGTGTGGGGGGGGGTGGGGG - Intergenic
1115764069 14:36604710-36604732 GTATGTTTGGTGGGGGTTGGAGG + Intergenic
1116636973 14:47409020-47409042 GTGTGTCTGGAGTGGATTGGTGG + Intronic
1118143019 14:63105921-63105943 GTGAATTTGGGGGTGTTTGTGGG - Intergenic
1118396132 14:65338278-65338300 GCGTATTTGGGGAGGATTGGTGG + Intergenic
1118782092 14:69015221-69015243 GTGGGTATGGGGGTGAGTGTGGG - Intergenic
1118782098 14:69015239-69015261 GTCTGTGTGGGGGTGAGTGTGGG - Intergenic
1119666569 14:76489248-76489270 GAGTGTGTTGGGGGGAGTGTTGG - Intronic
1119670056 14:76511473-76511495 GTGTGTTTGGCAGGGATGGGTGG - Intergenic
1119717142 14:76867228-76867250 GTGTGTGTGGGGGTGTGTGTTGG + Intronic
1120121321 14:80682980-80683002 GTGTGTTTGGTGGGGGTGGTGGG - Intronic
1121843682 14:97155250-97155272 GTGTGTGTTGGGGGGATGGCAGG + Intergenic
1122179159 14:99943182-99943204 GTTTGTTTGGGGGATTTTGTAGG + Intergenic
1123040851 14:105489662-105489684 GGGTGTGTGGGGGTGATTGGGGG + Intronic
1123057884 14:105580445-105580467 GTGTGTTTGGGTGTGAGTGTGGG + Intergenic
1123082168 14:105700378-105700400 GTGTGTTTGGGTGTGAGTGTGGG + Intergenic
1123208754 14:106738666-106738688 GTGTGTGTGGGGGGGGTAGGTGG - Intergenic
1123466272 15:20518335-20518357 CTGTGTTTGGTGCAGATTGTTGG + Intergenic
1123651843 15:22482704-22482726 CTGTGTTTGGTGCAGATTGTTGG - Intergenic
1123742262 15:23291563-23291585 CTGTGTTTGGTGCAGATTGTTGG - Intergenic
1123761062 15:23432922-23432944 CTGTGTTTGGTGCAGATTGTTGG + Intergenic
1124003084 15:25775688-25775710 GTGGGTGTGGCTGGGATTGTGGG + Intronic
1124011806 15:25845042-25845064 TGGTGTTTGGGGGGGATTTGTGG - Intronic
1124268231 15:28256593-28256615 CTGTGTTTGGTGCAGATTGTTGG - Intronic
1124276998 15:28334312-28334334 CTGTGTTTGGTGCAGATTGTTGG + Intergenic
1124305702 15:28577294-28577316 CTGTGTTTGGTGCAGATTGTTGG - Intergenic
1124403426 15:29371333-29371355 GTGTGTTTGCGGGGGTGTGGTGG - Intronic
1124912281 15:33933484-33933506 GTGTGTGTGTGTGTGATTGTTGG - Intronic
1125439361 15:39685427-39685449 GTGTGTTTGTTGGGGATGGCGGG - Intronic
1125787954 15:42339289-42339311 GTGTGTTGGAGGGGGGTGGTTGG - Intronic
1126531286 15:49713598-49713620 GTGGGTGTGAGGAGGATTGTTGG + Intergenic
1126685556 15:51246252-51246274 GTGTGTTTGGGGGTGAGGGGAGG - Intronic
1126944367 15:53802582-53802604 GTGTGTGTGGGGGTTGTTGTTGG + Intergenic
1127313166 15:57770257-57770279 CTGGGGTTGGGGGGTATTGTTGG - Intronic
1127314203 15:57779266-57779288 GTGTGCTTGGGCGGGGTTGGGGG - Intronic
1127390838 15:58503906-58503928 GTGTGTTTGGGTGGGGGTGTGGG - Intronic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1128016901 15:64355912-64355934 GTGTGTCTGAGGGGGTTGGTGGG - Intronic
1128283434 15:66416343-66416365 GTGTGTTTGGGGGGGATTGTAGG - Intronic
1128946328 15:71824568-71824590 GTGTGTTAGAGTGGGATTGCTGG - Exonic
1129465199 15:75720901-75720923 GTTTTTTTGTGGGGGATTTTTGG - Intergenic
1129894352 15:79092389-79092411 GTGTGTGTGGCGGGGGGTGTGGG - Intergenic
1129908439 15:79206368-79206390 GTGAGTTTTGGAGGGAATGTTGG + Intergenic
1130022129 15:80240502-80240524 GGGTGGTGGGGGGGGAGTGTTGG - Intergenic
1130294266 15:82632893-82632915 GTGAGTATGGGGTGGATAGTAGG - Intronic
1130573110 15:85066567-85066589 GTGTGTTTTGGGGGGATGGTGGG - Intronic
1131794952 15:96006891-96006913 GTGGGTTAGGTGGGGATTGTTGG - Intergenic
1131871014 15:96764750-96764772 GTGTCTTTGGGAAGGATTCTTGG - Intergenic
1131971460 15:97897545-97897567 GTGTGTTTGTGTGTGAGTGTTGG - Intergenic
1132668546 16:1093413-1093435 GTGTGTGTGGGGGTGGGTGTGGG - Intronic
1132764698 16:1528284-1528306 GTGGCTTTGGTGGGGCTTGTAGG - Intronic
1133823791 16:9259694-9259716 GTGTGTTGGGGTGGGAGGGTGGG + Intergenic
1133953083 16:10414657-10414679 GTGTGTTTGGGCGGGGGGGTGGG + Intronic
1134115406 16:11544118-11544140 GTGTGTCTGTGGGTGTTTGTTGG - Intergenic
1135845391 16:25913857-25913879 GTGTGTGTGGGGGTGTGTGTGGG + Intronic
1136085772 16:27883935-27883957 GTGTGTTGGGCAGGGATTGTGGG - Intronic
1136115004 16:28088994-28089016 GTGTGTGTGGGGGTGTGTGTGGG - Intergenic
1136115037 16:28089102-28089124 GTGTGTGTGGGGGTGTGTGTGGG - Intergenic
1136692787 16:32047788-32047810 GTGTGTGTGGGGGGGGTGGTTGG + Intergenic
1136793283 16:32991013-32991035 GTGTGTGTGGGGGGGGTGGTTGG + Intergenic
1137497174 16:48979487-48979509 GTGTGTTTGGGTGAGGGTGTGGG + Intergenic
1137620819 16:49875761-49875783 GGGTGTTTGGAGGGCACTGTAGG - Intergenic
1137990722 16:53151980-53152002 GTGTGTGTGTGTGTGATTGTGGG + Intronic
1140775640 16:78246783-78246805 GTGTGTTTGGTGGGGAGTGATGG + Intronic
1141104803 16:81224645-81224667 GTCTATTTGGGGGGGAATCTAGG + Intergenic
1141570411 16:84930492-84930514 GTGTGTGTGGGTGTGAGTGTGGG + Intergenic
1142172603 16:88630751-88630773 GTGTGTGTGGGGGGGGGTGGGGG - Intronic
1203095542 16_KI270728v1_random:1252704-1252726 GTGTGTGGGGGGGGGGTGGTTGG + Intergenic
1142735550 17:1896528-1896550 GTGGGGCTGGGGGGGATTTTTGG + Intronic
1143555326 17:7656253-7656275 GTGTGTGTGGCGGGGGGTGTAGG - Exonic
1146000393 17:29127165-29127187 TTTTGTTTGGGGGGGCTTTTGGG - Intronic
1147014464 17:37480133-37480155 GTGTTTTTTGGAGGGATTCTAGG - Intergenic
1147678255 17:42222210-42222232 GTGTGTTTGGAGGGGCTGGGTGG + Intronic
1147811954 17:43177556-43177578 GTGTGTTTTGGGTGGGGTGTGGG - Intronic
1149014398 17:51891218-51891240 GTGTGATTGGGAGGGGTTGTTGG + Intronic
1150620589 17:66804904-66804926 GTGTGTGTGGGGGTGGGTGTTGG - Exonic
1150732538 17:67708511-67708533 GTGAGTTTGAGGGTAATTGTTGG - Intergenic
1150743056 17:67795126-67795148 GAGTCTTTTGAGGGGATTGTTGG - Intergenic
1150950412 17:69797742-69797764 GTGTGTTTGGGGGAGGTTTGGGG + Intergenic
1152035951 17:77872969-77872991 GTGTGTTTGTGGGCGTGTGTGGG - Intergenic
1152634499 17:81425137-81425159 ATGTGGTTGGGGGTGATGGTGGG + Intronic
1152634693 17:81425998-81426020 ATGTGGTTGGGGGTGATGGTGGG + Intronic
1152695686 17:81793040-81793062 GTGTGTTTGTGGGTGTGTGTGGG - Intergenic
1152811125 17:82383319-82383341 GAGGGTCTGGGGGGCATTGTGGG - Intergenic
1152872979 17:82768221-82768243 GTGTGTGTGGTGGGGATTCCGGG + Intronic
1153046231 18:857755-857777 GTGTTTTTGGGGGGTTTTGGGGG - Intergenic
1153132818 18:1876952-1876974 GTGTGTGTGGAGGGGGGTGTAGG - Intergenic
1153750604 18:8226263-8226285 ATGTGTGTGGGGGGGATATTGGG - Intronic
1154427638 18:14284294-14284316 GGGAGTGTTGGGGGGATTGTGGG + Intergenic
1155270627 18:24138496-24138518 GTGTGCTTTGTGGGGATAGTTGG + Intergenic
1157105937 18:44774383-44774405 GTGTGTGTGGGTGTGAGTGTGGG + Intronic
1157700990 18:49761557-49761579 ATGTGTTTGGGGGTGCATGTGGG - Intergenic
1157701027 18:49761688-49761710 GGGTGTGTGGGGGGGAGTGGGGG - Intergenic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1159039000 18:63305464-63305486 GTGTGTGTGGGGAGGAAAGTAGG + Intronic
1159368353 18:67499780-67499802 GTGAGTTTGGGTGGGTGTGTGGG + Intergenic
1160851588 19:1195406-1195428 GTGTGTTTGGGGGGAGTCATGGG + Intronic
1160852012 19:1197220-1197242 GTGTGTTTGGGGGGAGTCATGGG + Intronic
1161272340 19:3397034-3397056 GCGTGTCTGGGGTGCATTGTGGG + Intronic
1161550952 19:4911756-4911778 GTGTTTTTGTGGGGGACTGTGGG + Intronic
1161627132 19:5333954-5333976 GGGAGTTTGGGGGGGATTTGGGG - Intronic
1161895050 19:7073970-7073992 GTGTGTGTGGGAGGGGTTGGTGG - Intronic
1162412630 19:10515619-10515641 GTGTGTTTGGTGGGGAGGGGGGG - Intronic
1162879870 19:13650314-13650336 TTGTGTTTGAGGGGGATTTGAGG - Intergenic
1162927265 19:13936822-13936844 GTGCATTTGGGGGTGATTGTGGG - Intronic
1162966040 19:14156559-14156581 GTGTGTGTGGGGGGGGTGGGGGG + Intronic
1163705953 19:18813498-18813520 GTGTCTTTGAAGGGGATGGTGGG - Intergenic
1164754325 19:30678726-30678748 GTGTGTGTGGGGGGGCTTGGGGG - Intronic
1164798160 19:31053255-31053277 GTGTGTTAGGGAGGTATTTTTGG + Intergenic
1165018055 19:32898393-32898415 GTGTGTTTGTGGGGGGCTGGGGG + Intronic
1165354839 19:35297486-35297508 GTGTGTTTGGTGTGGTGTGTGGG - Intronic
1165482396 19:36072360-36072382 GTGTGTCCGGGGAGGATGGTGGG + Intronic
1165693706 19:37884375-37884397 GAGTGCTTGGGGAGGATGGTGGG + Intergenic
1165739681 19:38197867-38197889 GTGTGTTTGGGGGGGGATTTGGG - Intronic
1166066845 19:40365114-40365136 GTGTGTTTGGGGGAGCTTGAGGG + Intronic
1166542888 19:43617256-43617278 GTGTGTGTGGTGGGGTTGGTGGG - Intronic
1166674436 19:44731335-44731357 GTGTGTTTGGCGGGGCATGGTGG - Intergenic
1166766251 19:45253176-45253198 GTGTGTGTGGGGGGGTCTGTCGG - Intronic
1167033414 19:46978574-46978596 GTGTGTGTGGTGGGGCGTGTGGG + Intronic
1167033478 19:46978853-46978875 GTGTGTATGGTGGGGTTTGGTGG + Intronic
1167033501 19:46978945-46978967 GTGTGTGTGGTGGGGTTTGGTGG + Intronic
1167087641 19:47321052-47321074 GTGTGTGTGGGGGGGGTGGGGGG - Exonic
1167168140 19:47813361-47813383 GTGTGTTTTGGGGGGGTCGTGGG - Intronic
1167960043 19:53098135-53098157 GTGGGTTTTGGGGTGGTTGTGGG - Intronic
1168599500 19:57706656-57706678 GGGTGTTTGGAGAGGATAGTTGG - Intronic
925402851 2:3588080-3588102 ATGTTTTTGGGGGGGTTTTTTGG - Intergenic
925462038 2:4072016-4072038 GTGTGTGTGGTGGGGGGTGTTGG + Intergenic
926209134 2:10856132-10856154 GTGTGTTGGGGGGGGGTGGTGGG + Intergenic
926271179 2:11367398-11367420 GTGTGTGTGGGTGTGAGTGTGGG - Intergenic
926708000 2:15850199-15850221 GTGTATGTGGGGGGGCTTGGGGG + Intergenic
926950294 2:18235713-18235735 GTGTATTTGTGGGGGAAAGTGGG - Intronic
927245458 2:20953951-20953973 GTGTGTGTGTGGGGGGGTGTTGG + Intergenic
927260390 2:21082466-21082488 GTGTGTGGGGAGGGGATTGTTGG - Intergenic
929126109 2:38524002-38524024 GTGTGTTTGGTGGGGTTGGGGGG - Intergenic
929172424 2:38945283-38945305 GTGTGTTTTGAGTGTATTGTTGG - Intronic
929295926 2:40246623-40246645 GTCTGTTTGGAGGGCAATGTTGG - Intronic
930058460 2:47269903-47269925 GTGTGTGTGGTGGGGGTGGTGGG - Intergenic
931937493 2:67214858-67214880 GGGTGTGTGTGGGGGAATGTGGG - Intergenic
932158456 2:69438899-69438921 GTGTGTGTGGGGGGGTGGGTGGG - Intergenic
932495569 2:72144310-72144332 GTGTGTTTGGTGGGGAGAGGGGG - Intronic
933648738 2:84832191-84832213 GTGTGTTTGGGGAGTATGTTTGG - Intronic
933940513 2:87241077-87241099 GTGTGTTTGGAGGTGTTTGGAGG + Intergenic
934120464 2:88832885-88832907 GTGTGTTGGGGGGATATTATTGG + Intergenic
934550625 2:95259313-95259335 GTGTATTTGGGGGAGATTGGAGG + Intronic
934761635 2:96859984-96860006 GTGTGTTTGGGGGGAAGGGTGGG - Exonic
936339326 2:111617474-111617496 GTGTGTATGGGGGGGAGGGGAGG - Intergenic
936352623 2:111724699-111724721 GTGTGTTTGGAGGTGTTTGGAGG - Intergenic
936599664 2:113883430-113883452 GTGTGTTTGGGGGGGCGGGGTGG + Intergenic
937045354 2:118848316-118848338 GTGTGTTTGTGGGTGGGTGTGGG + Intergenic
937865557 2:126748819-126748841 GTGTGTGTGTGGTGGGTTGTGGG - Intergenic
938106264 2:128532410-128532432 GTGTGTATGGGGGGGTGTGTAGG - Intergenic
938735034 2:134178127-134178149 GTGAGTTTGGGAGAGATTCTAGG + Intronic
939046864 2:137259941-137259963 GTGTGTGTGGTGGAGGTTGTAGG + Intronic
940285372 2:152028148-152028170 TTGAGTTTAGAGGGGATTGTAGG - Intronic
940390813 2:153130573-153130595 GTGTGTCTGGGGTGTATTGAAGG - Intergenic
940528609 2:154849497-154849519 ATGTGTTTGCGGGAGATTGGGGG - Intronic
941088559 2:161147118-161147140 GTGTGTTGGGGTGGGGGTGTGGG + Intronic
941200161 2:162498484-162498506 GTGTGTGTGGGGGGGAGGGTGGG + Intronic
941271965 2:163441511-163441533 GTGTGTGTTGGGGAGATTATTGG - Intergenic
941700207 2:168596324-168596346 GTGTGTGGGCGGGGGATTGGGGG + Intronic
942264845 2:174213082-174213104 GTGTGTTTGACGGTGATGGTGGG - Intronic
944046023 2:195413211-195413233 GTTTGTGTGGGGAGGATGGTTGG - Intergenic
944187390 2:196964165-196964187 GTGTGTGTGATGGGGGTTGTTGG + Intergenic
945067193 2:205957251-205957273 GTGTGTGTGGGGAGGAGTGGGGG + Intergenic
946017613 2:216616594-216616616 GTGTGTGTGGGTGGGTGTGTAGG + Intergenic
946805547 2:223467864-223467886 GTGTGGTTGAGGGTAATTGTTGG + Intergenic
947024362 2:225720231-225720253 GTGTGTTTTGGGGGGGTGGTAGG - Intergenic
947148610 2:227091083-227091105 GTTTTTTTGGCGGGGATAGTAGG - Intronic
947994386 2:234515025-234515047 GTGTGTGTGGTGTGGAGTGTGGG + Intergenic
948371538 2:237492757-237492779 GTGTGTTTGGGGGTGGTTCCAGG - Intronic
948893576 2:240918235-240918257 GTGTGTTTGTGTGTGTTTGTTGG - Intergenic
1169343632 20:4813793-4813815 GTGTGTGTGGAGGGTATGGTTGG + Intronic
1169689795 20:8317516-8317538 GTGTGTGTCGGGGGGATGGGGGG - Intronic
1170772077 20:19341448-19341470 GTGTGTTCTGGAGGGATTCTAGG + Intronic
1171321840 20:24252582-24252604 GTGTTTTTGGGGGGGATGCAGGG - Intergenic
1171946484 20:31382844-31382866 GTGTGTGTTTGGGGGATTGATGG + Intronic
1172195319 20:33087703-33087725 GTGTGTGTTGAGGGGATAGTTGG - Intronic
1172283744 20:33726309-33726331 GTGTGTGTGGGGGTGGTGGTGGG + Intergenic
1173148293 20:40544284-40544306 ATGTGTTGGGTGGTGATTGTAGG - Intergenic
1173409524 20:42797536-42797558 CTGTGTTTGCGGGGGAGGGTGGG - Intronic
1173881084 20:46412710-46412732 GTGTGTGGGGGGGGGGTTGTTGG + Intronic
1174367429 20:50065018-50065040 GTGTGTGTGTGGGGGTGTGTAGG - Intergenic
1174696024 20:52560066-52560088 GTCAGTTTGGTGGGGTTTGTTGG + Intergenic
1175050030 20:56146689-56146711 GTGTGTGTGGGGGGGGATGGGGG - Intergenic
1175875908 20:62229443-62229465 GTGTGTTTGTGTGGAATTGAGGG - Intergenic
1176372868 21:6073139-6073161 GTGTGTTGGGGGGGGGTGGGGGG - Intergenic
1176612021 21:8992021-8992043 GTGAGTTTGGTGGTGATTTTGGG - Intergenic
1176722328 21:10402639-10402661 CTGGATTTGGGGGGGAATGTTGG - Intergenic
1177408599 21:20701612-20701634 GTGTGTTCGGGGGGGGTGGGGGG - Intergenic
1179392143 21:41003668-41003690 GTGTGTTGGGGGGGGAGAGAGGG + Intergenic
1179750609 21:43465104-43465126 GTGTGTTGGGGGGGGGTGGGGGG + Intergenic
1179998318 21:44984146-44984168 GTGTGTGTGGGGGGGTGTATGGG - Intergenic
1180037104 21:45255718-45255740 GTGTGTGTGGGGGGCACTGCTGG - Intergenic
1180037114 21:45255753-45255775 GTGTGTGTGGGGGGCACTGCTGG - Intergenic
1180037125 21:45255788-45255810 GTGTGTGTGGGGGGCACTGCTGG - Intergenic
1180084323 21:45500998-45501020 GTGTGTTGGGTGTGGAGTGTGGG + Intronic
1180084340 21:45501074-45501096 GTGTGTTGGGTGTGGAGTGTGGG + Intronic
1180086738 21:45510956-45510978 GGGTGTTTGGGGGTGTATGTGGG - Intronic
1180256600 21:46634217-46634239 GTGTGTTGGGCGGGGGTTGGGGG - Intergenic
1181296796 22:21846959-21846981 GTGTGTTTGGCGGGGGTGGGGGG - Intronic
1181458487 22:23072578-23072600 GTGTGTTGGGTGGGGAGGGTAGG - Intronic
1182674820 22:32030661-32030683 GTGTGTGTGGGTGGGTGTGTGGG + Intergenic
1182960668 22:34471623-34471645 GTGTGTGTTGGGGGGAGTGGGGG + Intergenic
1182966905 22:34530574-34530596 GTGTGTTTGGGGCGGGGAGTGGG + Intergenic
1183062234 22:35343321-35343343 GTGTGTGTGTGGGGGTGTGTAGG - Intronic
1183184611 22:36284941-36284963 GGGTGGTTGGGGGAGCTTGTGGG - Intronic
1183285292 22:36958901-36958923 GTGTGTTTGTGGGGGGTTGGGGG - Intergenic
1183454074 22:37912059-37912081 GTGTGTTTGGTGGGGAGGGCAGG + Intronic
1183668016 22:39256308-39256330 CTGTGGCTGGGGAGGATTGTGGG - Intergenic
1184113481 22:42408962-42408984 GGGTGTTTGGGAGGGTGTGTGGG + Intronic
1184399625 22:44266377-44266399 GTGTGTTTGTGTGTGTTTGTCGG + Intronic
1184540334 22:45119062-45119084 GTGTGTGTTGTGGGAATTGTGGG - Intergenic
1184917471 22:47580150-47580172 GTGTGTGTGGGTGGGTGTGTGGG + Intergenic
1185204403 22:49529299-49529321 GTGAGTCTGGAGGGGAGTGTAGG + Intronic
1185288682 22:50013603-50013625 GTGTGTGGGGGGGGGATGGCGGG + Intergenic
949926099 3:9043065-9043087 GTGTGTTTGGGAGAGATGGGGGG - Intronic
949934747 3:9108051-9108073 GTGTGTTAGTGGAGGACTGTAGG + Intronic
951005174 3:17607655-17607677 GTGTTTTTGGGGGGTATTGGCGG - Intronic
951252427 3:20409593-20409615 GTGTGTTTGGGGGGCATTGGTGG + Intergenic
951614210 3:24523166-24523188 GTGTGTGGGGGGGGGAGGGTGGG + Intergenic
951789057 3:26459592-26459614 GGGTGTTTGGTGGGGACTCTAGG + Intergenic
954117509 3:48475399-48475421 GGGAGTTTGGGCAGGATTGTAGG + Intronic
954945167 3:54417788-54417810 GTGTGTGTGGGGGGGGGGGTGGG + Intronic
955569451 3:60288597-60288619 GTGTGTGTGGAGGGGGGTGTGGG + Intronic
955628566 3:60947636-60947658 GTGTGGTTGGGTGGGCATGTGGG - Intronic
955646577 3:61144647-61144669 ATATGTTTTGGTGGGATTGTAGG - Intronic
955823870 3:62924535-62924557 GTGTGTATTGGGGGGCTTGTAGG - Intergenic
956020844 3:64931743-64931765 GAGTGTGTCGGGGGGATGGTTGG - Intergenic
956322374 3:68011119-68011141 GTGTGTGTGTGGGGGGTGGTGGG + Intronic
956900584 3:73711797-73711819 GTGTGTGTGTGGGGGGGTGTTGG - Intergenic
957072446 3:75577621-75577643 ATGTGTCTGGCGGGCATTGTGGG + Intergenic
957128405 3:76192513-76192535 GTGTGTGTGTGGTGGAGTGTTGG - Intronic
957251841 3:77781618-77781640 GTGTGTGTTGGGGGCGTTGTTGG + Intergenic
957645890 3:82925785-82925807 GTGTGTTTGGGGGAAACTGGGGG + Intergenic
958888190 3:99752685-99752707 GTGTGTGTGGGGGGGCATGTGGG - Intronic
959500667 3:107102773-107102795 GTGTGTTTGAGGGTGAGTGAAGG - Intergenic
959689165 3:109179959-109179981 GTGTGTTGGGAGGGAGTTGTAGG - Intergenic
959823243 3:110762105-110762127 GTTTTTTTGGGGGGGGTTGCTGG + Intergenic
960169488 3:114442011-114442033 TCGTGTTTGGTGGGGGTTGTTGG + Intronic
962170242 3:133094227-133094249 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
963794783 3:149620557-149620579 GTGTGTGTGGGGGGGAGCGGTGG - Intronic
964386128 3:156149835-156149857 GTGTTTTTGGTGGGGTTTGGAGG - Intronic
965519822 3:169661300-169661322 GTGTGTGTGGGGGGGGGAGTTGG - Intronic
965690890 3:171355883-171355905 GTGTGTTTGGGGTTGAGGGTGGG - Intronic
965750391 3:171969619-171969641 ATTTTTTTGGGGGGGGTTGTCGG - Intergenic
966323657 3:178730400-178730422 GTGTGTGTGTGGGGGGGTGTTGG - Intronic
966633503 3:182106127-182106149 GTGTGTATGGCGAGGATTCTGGG - Intergenic
967273069 3:187746594-187746616 GTGTGTGTGGGGGGGAGGGTGGG + Intergenic
967602965 3:191411266-191411288 GTGTGTGTGGTTGGGATTGGTGG + Intergenic
967836066 3:193963931-193963953 GTGTGTGTGGGAGTGAGTGTGGG - Intergenic
967881336 3:194303949-194303971 GTGTGATTGGGGTGGATTCAAGG + Intergenic
968263666 3:197345296-197345318 GTGTGTGTGGGGGGGTGTGTGGG - Intergenic
968453174 4:684544-684566 GTGTGCTTGGGGGGAATGATCGG - Exonic
968780121 4:2574045-2574067 TTGTGTTATGAGGGGATTGTGGG + Intronic
969016033 4:4104930-4104952 ATGTGTCTGGCGGGCATTGTGGG + Intergenic
969168220 4:5336159-5336181 GTGTGTGTGGGTGGGTGTGTGGG - Intronic
969281713 4:6175100-6175122 GGGAGTTTGGGGGGACTTGTGGG - Intronic
969797112 4:9534968-9534990 ATGTGTCTGGCGGGCATTGTGGG - Intergenic
970867827 4:20779570-20779592 GTGTGGGGGGGGGGGGTTGTGGG - Intronic
972197167 4:36667723-36667745 GCGTGTTGGTGGGGGATTGGTGG - Intergenic
972406800 4:38754020-38754042 GTATGTTTGGGGGTGTGTGTAGG - Intergenic
972516281 4:39813355-39813377 GTGTGTGTGGTTGTGATTGTGGG + Intergenic
972516482 4:39814603-39814625 GTGTGGTTGGTTGTGATTGTGGG + Intergenic
973255407 4:48107380-48107402 GTGTGTTTTGGGGGGAGGGTGGG - Intronic
973557693 4:52101637-52101659 GTGTGTTTTGGGGGGATTGTGGG + Intergenic
973773774 4:54228078-54228100 GTGTGTTGGGGTGGGGTTGAGGG + Intronic
974598544 4:64045277-64045299 GTGTGTGTTGGGGGGATGTTTGG - Intergenic
975586564 4:75955849-75955871 GTGTGTCTTGGGAGCATTGTTGG - Intronic
976377924 4:84365979-84366001 GTGTGTTTGGGGGTTAGTTTAGG - Intergenic
976562822 4:86521640-86521662 GTGTGGTTGGGGGGCATAGTGGG - Intronic
976639561 4:87323677-87323699 TTGAGTTTGGGGGAGATTTTAGG + Intergenic
977822519 4:101490820-101490842 GTGTGTGTGGTGGGGGTTGGGGG + Intronic
981247661 4:142558649-142558671 GGGTGTTGGGGGGGCAGTGTGGG + Intronic
982236972 4:153260687-153260709 GTGTGTGTGGGGGGGGGGGTGGG - Intronic
983449582 4:167894233-167894255 GTGTGTGTGATGGGGAGTGTGGG - Intergenic
984432206 4:179664035-179664057 GTGTGTGTGGGTGTGAGTGTGGG - Intergenic
984670908 4:182486308-182486330 TTGTGTGTGGGGGGGAGGGTGGG + Intronic
984713049 4:182902203-182902225 GTGTACTTGGTGGGGGTTGTGGG - Intronic
984784331 4:183553985-183554007 GTGAGTGTGGGGGTGAGTGTGGG + Intergenic
984784433 4:183554445-183554467 GTGTGTGGGGGGGTGAGTGTGGG + Intergenic
985515989 5:344813-344835 GGGTGTGTGTGGGGGACTGTAGG + Intronic
985524834 5:396501-396523 GTGTGTTCTGTGGGGCTTGTGGG - Intronic
986246152 5:6008732-6008754 GTGTGTTTTGGGGGGGTCATGGG + Intergenic
986841250 5:11700015-11700037 ATGTGTGTGGGGGGCACTGTGGG + Intronic
987758441 5:22127044-22127066 ATATGTGTGGGGTGGATTGTGGG + Intronic
988528041 5:32003437-32003459 GTGTGTTGGGGGGAGTGTGTAGG - Intronic
989628823 5:43460415-43460437 TTGTGTTTGGGGATGATTGGTGG - Intronic
989781615 5:45272255-45272277 GTGTCTTTGGCGGGGATGGGGGG + Intronic
990350233 5:54908757-54908779 GTGTGTTTGGTGGGGGGTTTGGG - Intergenic
990819144 5:59817737-59817759 GTGTGTGTGGGGGGGGGTGTGGG - Intronic
990957687 5:61359963-61359985 GTGTGTTGGGAGGGTAATGTTGG + Intronic
990988035 5:61659199-61659221 GAGTCTTTGGGTGGGGTTGTGGG + Intronic
992246225 5:74826367-74826389 GTGTGTATGGTGGGGCTTGCTGG + Intronic
992272669 5:75081654-75081676 GTGTGTTTGGGGTGGGTGGTGGG + Intronic
993364365 5:87018727-87018749 GTGTGTGTGGTGGGGGGTGTGGG + Intergenic
993845141 5:92932318-92932340 GGGTGTTGGGGGAGTATTGTAGG + Intergenic
995782913 5:115796956-115796978 GTGTGTTTGTGGAGGATTGAGGG + Intergenic
996198887 5:120645376-120645398 GTGTGTGGGGGGGGGATGGGTGG - Intronic
996374418 5:122789416-122789438 GTGTGTGTGGTGGGGAAGGTGGG - Intronic
998149154 5:139747253-139747275 GTGTGTGTGCGGGGGGTTGGGGG - Intergenic
998207472 5:140168524-140168546 GTGTGGTTGCGGGGGATGGTGGG - Intergenic
999319682 5:150605731-150605753 GTGTGTGTGGTGGGGGTGGTTGG - Intronic
999616708 5:153432741-153432763 GTGTGTGTGAGGGGGTGTGTGGG - Intergenic
1000252842 5:159511545-159511567 ATGGGTTTGGTGGGGATGGTAGG - Intergenic
1000936592 5:167309040-167309062 GTGTGTTTGGTGGGGTGGGTGGG + Intronic
1002026265 5:176397871-176397893 CTGTGTGTGGGGTGGAGTGTGGG - Intronic
1002345936 5:178547588-178547610 GTGTGTGTGTGGGTGGTTGTGGG - Intronic
1002345948 5:178547627-178547649 GTGTGTGTGTGGGGGGGTGTGGG - Intronic
1002394902 5:178945063-178945085 GTGTGTGTGGGGGTATTTGTGGG + Intronic
1002566628 5:180115860-180115882 CAGTGGTGGGGGGGGATTGTGGG + Intronic
1002633289 5:180594810-180594832 GTGTGTGTGTGAGGGTTTGTCGG + Intergenic
1002633301 5:180594858-180594880 GTGTGTGTGGGGGTGTGTGTGGG + Intergenic
1002670617 5:180863224-180863246 GTGTGTGTGGAAGGGATTATGGG + Intergenic
1003979040 6:11372126-11372148 TTGTGGGTGGGGGGGATTATGGG - Intronic
1004080389 6:12386756-12386778 GTGTGTGTGGGGGGGGTGGTGGG + Intergenic
1004436364 6:15598688-15598710 GTGGGGTTGAGGGGGATTGGGGG + Intronic
1005423763 6:25679488-25679510 GTGTGTGTGCAGGGGATTGAAGG + Intronic
1006731768 6:36241532-36241554 GTGTGTGTTGGGGGGAATGGCGG + Intergenic
1007063872 6:38969701-38969723 GTGTGTGTGGGGGGGAGTGGGGG + Intronic
1007513643 6:42394236-42394258 GTGTGTTGTGGGGGGAGAGTTGG - Intronic
1007592036 6:43027709-43027731 GTGTGTTGGGGGGGGGGGGTTGG - Intronic
1007624070 6:43232968-43232990 TTGTCTTTGGGGGGGAATGGAGG - Intergenic
1007696039 6:43734731-43734753 GGGTGTTTGGGGTGGAGTGAGGG + Intergenic
1008370312 6:50723824-50723846 GTGTGTATGGCGGGGGTTGGGGG - Intronic
1010364942 6:75040240-75040262 GTGTGTTTGTGGGGGGATGAAGG - Intergenic
1010647201 6:78403955-78403977 TTGTGTGTGGGGGGGGTTGGGGG + Intergenic
1013181706 6:107721853-107721875 AAGGGTTTGGGGAGGATTGTGGG - Intronic
1017362759 6:153595288-153595310 GTGTGTTTGGGTTGGATGGGGGG + Intergenic
1017808634 6:157967675-157967697 GTGTGTGGGGTGGGGATTGTGGG + Intergenic
1019282837 7:209072-209094 GGGTGTTTTGGGGAGACTGTGGG + Intronic
1019372741 7:671428-671450 GGGTGTTTGGGTGGGGTTTTGGG + Intronic
1019401886 7:859487-859509 GTGTGTGTGGGGAGGAGTGAGGG + Intronic
1019642356 7:2110862-2110884 CTGTGTTTGAGGGAGATGGTGGG - Intronic
1020035298 7:4959995-4960017 GGGTGTTGGGGGGGGAGTGAGGG + Intergenic
1021674546 7:23067077-23067099 GTGTATTTGGGGGGGTTGTTGGG - Intergenic
1023177336 7:37447630-37447652 GTGTGTGGGGGGGGTGTTGTGGG - Intronic
1023352295 7:39332856-39332878 GTGTTTTGGGGTGAGATTGTAGG + Intronic
1024248189 7:47486018-47486040 GTGTGTGTGGGGGTGAGTGCAGG + Intronic
1024363429 7:48493548-48493570 GTGTTATTGGGGGTGGTTGTGGG + Intronic
1024593057 7:50906713-50906735 GTTTTTTTGGGGGGGCATGTGGG - Intergenic
1025615320 7:63112822-63112844 GTGTGTTTGGGGGGGTTGGGGGG + Intergenic
1028049578 7:86165489-86165511 TTGTGTTTTGGGGTGTTTGTGGG + Intergenic
1028239761 7:88405238-88405260 GTGTGTTTGGGGAGAGTTGGGGG - Intergenic
1028773492 7:94655240-94655262 GTGTGTTTGGCGGGCTTTGAAGG - Intronic
1029178377 7:98681830-98681852 GTTTATTTGGGGGGCATTGATGG - Intergenic
1029297556 7:99553419-99553441 GTGTGTGTGGCAGGAATTGTAGG + Intronic
1029509725 7:100986451-100986473 TGGTGTTTGGGGGAGATTTTGGG - Intronic
1029696471 7:102216795-102216817 GTGTGTGTGGGGGTGTGTGTGGG - Intronic
1029863820 7:103603774-103603796 GTGTGTTTGTGGGGGGCTGAGGG + Intronic
1030123425 7:106133034-106133056 GTGTGTGTGGGGGGGGGGGTTGG + Intergenic
1030167655 7:106571189-106571211 GTGTGTGTGGGGGGGAGTGTGGG - Intergenic
1030987043 7:116253842-116253864 GTGTGTGTGGGTGGGTGTGTGGG + Intronic
1031028805 7:116712689-116712711 GTGTGTGTGGGGGGGACGGGAGG - Intronic
1031132730 7:117851376-117851398 GTGTGTGTGAGGGGGTTGGTGGG - Intronic
1031371840 7:120977625-120977647 GTGTGTGTGGGGGGAGTTGGTGG + Intergenic
1031804318 7:126290347-126290369 GTGTGTGTGTGTGTGATTGTTGG - Intergenic
1031898274 7:127379846-127379868 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1032175082 7:129616838-129616860 GTGTGTGTTGGAGGGAGTGTTGG + Intronic
1033453610 7:141482906-141482928 GTGTGTTTGCGGGGGGCGGTGGG + Intergenic
1034384442 7:150727576-150727598 GTGTGTGTGTGGGAGGTTGTTGG - Intronic
1034915991 7:155039417-155039439 GTGTGTGTGGGGGGGAGGGGAGG + Intergenic
1034968994 7:155407875-155407897 TTGTGTTTGTGGGGGGGTGTGGG + Intergenic
1035298300 7:157879340-157879362 GTGTGTTTGGGTGTGCGTGTTGG - Intronic
1035375029 7:158402111-158402133 GTGTGTTTGGAGGGGGTGGCTGG - Intronic
1036243006 8:7094695-7094717 ATGTGTCTGGCGGGCATTGTGGG - Intergenic
1036257793 8:7219352-7219374 ATGTGTCTGGCGGGCATTGTGGG + Intergenic
1036259042 8:7226349-7226371 ATGTGTCTGGCGGGCATTGTGGG + Intergenic
1036307579 8:7613162-7613184 ATGTGTCTGGCGGGCATTGTGGG - Intergenic
1036309841 8:7677948-7677970 ATGTGTCTGGCGGGCATTGTGGG + Intergenic
1036311095 8:7684945-7684967 ATGTGTCTGGCGGGCATTGTGGG + Intergenic
1036358431 8:8061163-8061185 ATGTGTCTGGCGGGCATTGTGGG - Intergenic
1036359693 8:8068171-8068193 ATGTGTCTGGCGGGCATTGTGGG - Intergenic
1036753241 8:11456319-11456341 GTGTGTATGGGTGTGAGTGTGGG + Intronic
1036812497 8:11877174-11877196 GTGTGTATGGGGGGAAGTGGTGG + Intergenic
1036829725 8:12012469-12012491 ATGTGTCTGGAGGGCATTGTGGG + Intergenic
1036891264 8:12598799-12598821 ATGTGTCTGGCGGGCATTGTGGG + Intergenic
1036892524 8:12605789-12605811 ATGTGTCTGGCGGGCATTGTGGG + Intergenic
1036898814 8:12656736-12656758 ATGTGTCTGGCGGGCATTGTGGG + Intergenic
1036900072 8:12663768-12663790 ATGTGTCTGGCGGGCATTGTGGG + Intergenic
1038103521 8:24407693-24407715 GGGGGCTTGGGGGGAATTGTTGG - Intergenic
1038869875 8:31482152-31482174 GTGTGTATGGGGGGGTTGGGAGG + Intergenic
1040131825 8:43805936-43805958 GTTTTTTTGGAGGGGATTTTTGG - Intergenic
1040668895 8:49663040-49663062 TTATGGTTGGGGGGCATTGTGGG - Intergenic
1040791665 8:51237681-51237703 GTGTGTTTGGGTGGGGTTGGGGG - Intergenic
1041446277 8:57954249-57954271 GTGGGATTGGTGGTGATTGTAGG - Intergenic
1041723548 8:60997968-60997990 GTGTGTTTGTGGAGGACGGTGGG + Intergenic
1042334581 8:67616545-67616567 GTGTGTGTTGTGGGGGTTGTGGG + Intronic
1043042652 8:75281555-75281577 TTGTGTTTCTGTGGGATTGTTGG - Intergenic
1044469714 8:92552517-92552539 GTGTGTGTGGGGGGGGTGTTGGG - Intergenic
1044720222 8:95138100-95138122 GTGACTTTGGGGGAGAGTGTAGG - Intronic
1045797445 8:106062457-106062479 GTGTGGCTGGGGAGGATTGAGGG + Intergenic
1046098706 8:109590053-109590075 GTGTATTTTGGGGGGATGGGTGG - Intronic
1046185214 8:110705072-110705094 GTGTGTATGGGTGGGTGTGTTGG + Intergenic
1046752126 8:117937082-117937104 GTGTGTTTTGAGGGGATATTGGG - Intronic
1047023729 8:120805224-120805246 GTGTGTTTGGAGGAGAGGGTGGG - Intronic
1047235549 8:123039231-123039253 GTGTGTATGGAGGGGGTTGAAGG - Intronic
1047508311 8:125497096-125497118 GAATGTATGTGGGGGATTGTGGG + Intergenic
1047597757 8:126395742-126395764 GTGTGTTGGGGGTGGGGTGTGGG - Intergenic
1048114174 8:131502342-131502364 GTTTTTTTGGGGGGGATGGGGGG - Intergenic
1048677567 8:136800615-136800637 GTGTGTGTGGCGGGGGTTGGGGG + Intergenic
1049291953 8:141808123-141808145 GTGTGTTGGGGAGGAAGTGTGGG + Intergenic
1049812777 8:144582926-144582948 ATTTGTTTGGGGGGAGTTGTTGG - Intronic
1051191659 9:14519082-14519104 GTGTGTATGGTGGTGATGGTGGG + Intergenic
1051432208 9:16991245-16991267 GTGTGTGTGGGAGGAATGGTGGG - Intergenic
1052689339 9:31797102-31797124 GTGTGATTGCCAGGGATTGTGGG + Intergenic
1052774460 9:32719570-32719592 GTGTGTTGGGCGGGGGTGGTGGG + Intergenic
1054148622 9:61582828-61582850 GTGTGTGTGGGGGGGGGGGTGGG - Intergenic
1054337865 9:63823799-63823821 GTGTGTGTGGAGTGTATTGTGGG - Intergenic
1055245798 9:74241008-74241030 GTGGGTTTGGGGGGTATTTTTGG + Intergenic
1055493192 9:76827013-76827035 GTGTGTTTGTGTGGGGTTGGGGG - Intronic
1055562158 9:77531778-77531800 GTGTGTTTGGGGCTGGTGGTGGG - Intronic
1055564707 9:77556725-77556747 GTGTGTCTGGGGGTGGTGGTAGG - Intronic
1055619584 9:78110381-78110403 GTGTGTTTTGGGGGTATGTTTGG - Intergenic
1055689651 9:78815939-78815961 GTGTGTGTGGGGGGGGGGGTGGG - Intergenic
1056193349 9:84206138-84206160 GTGTGTGTGGGGTGGTGTGTGGG + Intergenic
1056193401 9:84206411-84206433 GGGTGGTTGGGGGGGTGTGTGGG + Intergenic
1056677435 9:88687251-88687273 GTGGGTTTGTGTGGGCTTGTGGG + Intergenic
1056753818 9:89370076-89370098 GTGTGTATGGGGGTGGTTTTAGG + Intronic
1057255242 9:93541083-93541105 GTGTGTGTGGTGGGGTTTGTTGG + Intronic
1057647515 9:96890472-96890494 GTGTGTTTGGGCGGCTTAGTGGG + Intergenic
1057662434 9:97014872-97014894 GTGTGTTTGGGGGTGGTGGGTGG - Intergenic
1059031221 9:110698850-110698872 GTGTGTCTGGGTGGGTTTGTAGG - Intronic
1059705457 9:116819211-116819233 GTGTGTTTGGGGTGGGGTGGGGG - Intronic
1059813907 9:117889805-117889827 GCTTTTTTGGGGGGCATTGTAGG + Intergenic
1059950135 9:119453900-119453922 GTGTGTGTGGGGGGGGATGGGGG - Intergenic
1060220292 9:121760902-121760924 GTGTGTCTGGGTGAGAGTGTGGG - Intronic
1060912445 9:127361871-127361893 GTGTGTTTGGGGTGGGGTGAGGG - Intronic
1061324866 9:129857666-129857688 GTGTTTTTGGTGGGGATCCTAGG - Intronic
1061481155 9:130898322-130898344 GTGTGGTGGGGTGGGGTTGTCGG + Intergenic
1061854309 9:133433238-133433260 GTGTGTTTGGGGGTCGCTGTGGG + Intronic
1062185666 9:135217029-135217051 GTGTGTTTGGGGAGATTTTTAGG - Intergenic
1062616099 9:137396621-137396643 GTGTGTTTAGGGGTGCGTGTTGG - Intronic
1203568266 Un_KI270744v1:109567-109589 GTGAGTTTGGAGGTGATTCTGGG + Intergenic
1203568338 Un_KI270744v1:110002-110024 GTGAGTTTGGTGGTGATTCTGGG + Intergenic
1185642338 X:1595329-1595351 GTGTGTCTGGGGGGTTTTGGGGG + Intronic
1185760156 X:2684445-2684467 GGGTGGATGGGGTGGATTGTGGG - Intergenic
1186441501 X:9590981-9591003 GTATGTGTGGGGGGGATAGTTGG + Intronic
1187225039 X:17367583-17367605 GTGTGTGTGTGGGGGATGGGGGG + Intergenic
1187929921 X:24284631-24284653 GTGTGTTTTGGGGGGGGTGGTGG + Intergenic
1187940506 X:24376180-24376202 GTGTGTGTGGTGGGGAGTGGGGG + Intergenic
1188949640 X:36354639-36354661 GTGTGTTTGTGGGTGTTTGGAGG - Intronic
1190439444 X:50462980-50463002 GTGCGTGTGGGGGGGGTGGTGGG - Intronic
1192141914 X:68653350-68653372 GTGCGTTTGGGGGTGTGTGTGGG - Intronic
1192560281 X:72123802-72123824 GTGTGTTTGTGTGGGAAAGTAGG - Intergenic
1193502780 X:82300152-82300174 GTGTGGTTGGTGTGAATTGTGGG - Intergenic
1195058995 X:101175927-101175949 GTGGGTTTGGTGGGGGTTGGCGG - Intergenic
1195086084 X:101415954-101415976 CAGTGTTTGGGGGGTGTTGTGGG - Intergenic
1195129314 X:101838586-101838608 GTGTGTGTGGGGGGGGGTGGCGG + Intronic
1195529129 X:105931686-105931708 GTGTGTCTGAGGGAGAGTGTTGG - Intronic
1195560677 X:106279178-106279200 GTGTGTTTATGTTGGATTGTTGG - Intergenic
1195594600 X:106673673-106673695 GTGTGTGTGGGGGGGGATGGGGG - Intronic
1196339101 X:114575574-114575596 GTGTGTGTGGGGGGGAGTGGGGG - Intergenic
1196627922 X:117899085-117899107 ATGTGGTTGGGGGGTATTCTTGG - Exonic
1196734758 X:118974120-118974142 GTGTGTGTGGGGGGGCTTCACGG + Intergenic
1196984786 X:121256364-121256386 GTGTGTTTTGGGGAGAGTGGAGG + Intergenic
1197163508 X:123350156-123350178 GTGTGGGTGTGGGGGATTGCTGG - Intronic
1197853386 X:130888992-130889014 GTGTGTTGGGGGAGGATTCAAGG + Intronic
1197882992 X:131188926-131188948 GTGTGTTTGTGGTGGGGTGTGGG + Intergenic
1197968099 X:132086200-132086222 GTGTGTTTGGGGGGGGCAATTGG + Intronic
1198126614 X:133650444-133650466 GTGTGTGTGGGTGGGTGTGTGGG - Intronic
1198384605 X:136116715-136116737 ATGTGGTTGGAGGGGATAGTAGG - Intergenic
1198986378 X:142458867-142458889 GTGTGTGTGGTGGGGGATGTGGG - Intergenic
1199096597 X:143749190-143749212 GTGTGTGTGGGGGAGGTTGAAGG - Intergenic
1199972699 X:152872564-152872586 GTGTGTGTGTGGGGGTGTGTGGG + Intergenic
1199972737 X:152872758-152872780 GTGTGTTTGTGGGTGTGTGTGGG + Intergenic
1202177492 Y:22111335-22111357 GTGTGTTTCTGTGGGAATGTTGG - Intergenic
1202213869 Y:22475049-22475071 GTGTGTTTCTGTGGGAATGTTGG + Intergenic