ID: 1128283728

View in Genome Browser
Species Human (GRCh38)
Location 15:66418606-66418628
Sequence TGGTGGTGACCACTAAACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128283728 Original CRISPR TGGTGGTGACCACTAAACAG TGG (reversed) Intronic