ID: 1128285004

View in Genome Browser
Species Human (GRCh38)
Location 15:66429567-66429589
Sequence TAGAGTAACCTGAAGGATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128284998_1128285004 18 Left 1128284998 15:66429526-66429548 CCTAGAATTTGATTTCCTATAGG 0: 1
1: 0
2: 2
3: 16
4: 202
Right 1128285004 15:66429567-66429589 TAGAGTAACCTGAAGGATTGAGG 0: 1
1: 0
2: 0
3: 13
4: 103
1128285000_1128285004 3 Left 1128285000 15:66429541-66429563 CCTATAGGTAGTTGAACAGCCTC 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1128285004 15:66429567-66429589 TAGAGTAACCTGAAGGATTGAGG 0: 1
1: 0
2: 0
3: 13
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128285004 Original CRISPR TAGAGTAACCTGAAGGATTG AGG Intronic
901226763 1:7617658-7617680 TAGGGTCACCTGAAGGACTTTGG + Intronic
901697438 1:11019466-11019488 TACAGTAACTTGAAAGTTTGTGG + Intronic
901881287 1:12195291-12195313 TAAAGTCACCTGTAGGTTTGGGG - Intronic
914826472 1:151141106-151141128 TAGAGTAATTTTAAGGATAGAGG - Intronic
915880652 1:159667637-159667659 TAGGTTAAGCTAAAGGATTGTGG + Intergenic
916865473 1:168851966-168851988 TAGGGTAACCTGGAGGTTGGAGG - Intergenic
917215304 1:172671854-172671876 TAAAGTTAACTGAAGGTTTGAGG + Intergenic
918786029 1:188764772-188764794 TAAATTAACCTGAATAATTGTGG + Intergenic
920867277 1:209763438-209763460 AAGATTAACCTGGAGGATCGGGG - Intronic
1072977748 10:100074042-100074064 TAAAATAACCTGGAGTATTGTGG - Intronic
1072999356 10:100275301-100275323 TCGAGTAAACTGGAGGACTGTGG - Exonic
1074168505 10:110908543-110908565 TTGAGGATCCTGAAGGATGGGGG + Intronic
1077931526 11:6737952-6737974 CAGAGAAACCTGCAGGACTGGGG + Intergenic
1081182171 11:39997338-39997360 TAGACCAATCTGAAGGAGTGAGG + Intergenic
1081497346 11:43628450-43628472 CAAAGTAACCTGAAAAATTGGGG - Intronic
1085430008 11:76439718-76439740 GAGCGTAACCTGGAGGCTTGAGG + Intergenic
1087302259 11:96449402-96449424 TAGGGGAAACTGAAGGCTTGAGG - Intronic
1088889547 11:114033736-114033758 CAGAGTAACCTGAAGGACTCAGG - Intergenic
1093027108 12:14255199-14255221 AAGAACAACCTGAAGGACTGGGG + Intergenic
1093082736 12:14831883-14831905 TAGAGTAACTGAAAGGATGGAGG - Intronic
1093146252 12:15570233-15570255 TATAGAAACCTGAAGGATGGGGG - Intronic
1095135430 12:38595526-38595548 AAGAGTAAACAAAAGGATTGAGG - Intergenic
1095552956 12:43466076-43466098 CAGAGAAACCTGAAGGAAGGTGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1101585748 12:106084063-106084085 GAGAGCAGCCTGAAGGATGGAGG - Intronic
1102529515 12:113536037-113536059 TAAAGTAACAAGAGGGATTGAGG + Intergenic
1103238531 12:119395183-119395205 TAGAACACCCTGAAGAATTGAGG + Intronic
1104516140 12:129428982-129429004 GTGAGTAACTTGAAGGATTGTGG - Intronic
1104516146 12:129429069-129429091 GTGAGTAACTTGAAGGATTTTGG - Intronic
1104516150 12:129429127-129429149 GTGAGTAACTTGAAGGATTTTGG - Intronic
1108195592 13:47991415-47991437 AAGAGAAACTTGAAGGATCGGGG - Intronic
1111681538 13:91447781-91447803 TAGAATAACAAGAAGAATTGTGG - Intronic
1114553724 14:23549633-23549655 TAGAATGAACTGAAGGATGGGGG + Intronic
1116565107 14:46434933-46434955 TACAGTAAGCTGAAAGATAGAGG + Intergenic
1117416420 14:55500668-55500690 CAGGGTAAAGTGAAGGATTGTGG - Intergenic
1119912506 14:78362812-78362834 TATATTCACATGAAGGATTGTGG + Intronic
1121372627 14:93374314-93374336 TAGAGTTACCTGAGGCATTGGGG + Intronic
1125967726 15:43887702-43887724 TCCAGTAACCTGAAGGATCCTGG - Intronic
1128285004 15:66429567-66429589 TAGAGTAACCTGAAGGATTGAGG + Intronic
1128530878 15:68446716-68446738 TAAAGGACCCTGGAGGATTGTGG - Intergenic
1131163077 15:90121838-90121860 TTGAGTAACCTGAGAGATGGAGG - Intergenic
1133882521 16:9796426-9796448 GAGAGTATGCTGAAGAATTGGGG - Intronic
1140105009 16:71951864-71951886 TAGAGGAACATGAAAAATTGAGG - Intronic
1144367198 17:14555964-14555986 CAGAGTAACCTCCAGGATCGGGG - Intergenic
1146917577 17:36687919-36687941 TTGAGTAACCTGGAGAACTGGGG - Intergenic
1149186320 17:54001857-54001879 TAGATTAACCTGGAGTATTTAGG - Intergenic
1149213506 17:54329310-54329332 TAGAGTAACCTGCTGGCATGAGG - Intergenic
1151985336 17:77539816-77539838 TAGAGTTTCCTGAATGATAGGGG + Intergenic
1157081157 18:44526790-44526812 AAAAGTAACCTGTAGCATTGGGG + Intergenic
1157937385 18:51888089-51888111 TAGACTATCATGAAGTATTGTGG + Intergenic
1160208538 18:76857502-76857524 TAATGTAACCTGAAGGAGGGTGG - Intronic
1165275047 19:34742572-34742594 TAGAACAACCTGAAGGATTTAGG + Exonic
929449427 2:42026971-42026993 TAGAGAAACCATAAGGTTTGGGG - Intergenic
929525443 2:42698014-42698036 TAGACTAACCTGAAGACTAGAGG + Intronic
934928798 2:98403486-98403508 CAGAGTAACCTAAACAATTGAGG + Intergenic
935205029 2:100889980-100890002 TAGAGCAACTAGAAGGATTGAGG + Intronic
935458474 2:103299197-103299219 TAGAGTAACCAGAATGATTAAGG + Intergenic
936287021 2:111188839-111188861 TGGAGTCACCTGAAGGCTTCTGG + Intergenic
941011399 2:160303885-160303907 TAGAGATACATGAAGGATTCTGG + Intronic
941374329 2:164708228-164708250 TAGAGAAATCTGAAGAATTTTGG - Intronic
944904003 2:204244453-204244475 TAGACTATTCTGAAAGATTGAGG - Intergenic
947027665 2:225756344-225756366 TAGTGAAACCTGCATGATTGAGG + Intergenic
1178429061 21:32503062-32503084 TGGGGTAACCTGATGGCTTGGGG - Intronic
1183811163 22:40258875-40258897 CAGAGTGACCTGCAGGACTGAGG - Intronic
954388612 3:50257658-50257680 AAGAACAACCTGAAGGACTGCGG + Exonic
955286833 3:57649830-57649852 TAGAGTAACCTGAATGAGACAGG - Intronic
960320342 3:116227048-116227070 TAGAGGAACCTGAAGCACAGTGG - Intronic
961234939 3:125357871-125357893 TAGAGTAAGAGGAAGGATTAAGG - Intronic
966946960 3:184783545-184783567 TAGAATAAACTGGAGGATGGGGG + Intergenic
967527393 3:190510589-190510611 TAGAGGAAGCAGAAGGTTTGTGG + Intergenic
976151516 4:82097178-82097200 TAGAGTAACCTGAAAAATTTGGG + Intergenic
977259748 4:94784271-94784293 TATAGTAACCTAATGGAATGAGG + Intronic
977409049 4:96637966-96637988 TAGAGTCAACTGCAGGAGTGGGG + Intergenic
978871804 4:113587567-113587589 TAAAGAGAACTGAAGGATTGAGG + Intronic
979406699 4:120320646-120320668 TACAGTTACCTAAAGGGTTGAGG + Intergenic
981305608 4:143244043-143244065 TGGAGTAACCTGCAGGAGTCTGG + Intergenic
983629326 4:169833735-169833757 TTGAGTAACAGGAAGGATTGTGG - Intergenic
983760541 4:171400880-171400902 TAGACTGATCTGAAGCATTGAGG - Intergenic
984819160 4:183864881-183864903 TAGAGAAACCTGAAGTTTTTTGG - Intronic
990564376 5:57014777-57014799 GAGAGTATCCTGAATTATTGGGG + Intergenic
991073025 5:62507591-62507613 TATAGTACCCTGAAGCATTTTGG - Intronic
992764186 5:79980341-79980363 TATATTAACATGAAGGAATGGGG - Exonic
996939035 5:128981605-128981627 TAGAGTGAGCAGAAGGATGGAGG + Intronic
998066710 5:139165192-139165214 TAGGTTAACATAAAGGATTGTGG - Intronic
999299448 5:150482083-150482105 AAGAGTAACCTGTGGGAATGTGG - Intergenic
1003848557 6:10198881-10198903 TAGAGTAGCCTGAGGGATTTGGG - Intronic
1006154344 6:32006227-32006249 TCCAGTGACCTGGAGGATTGGGG - Intergenic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007493800 6:42245057-42245079 TAGAATCACCTGAGGGAGTGAGG + Intronic
1021066070 7:16174239-16174261 TAGAAAAACCTCAAGGATGGGGG + Intronic
1021091182 7:16484875-16484897 TAGAGTAACCTGACGCACAGAGG + Intronic
1028228148 7:88273901-88273923 TAGATAAACCTGGAGTATTGAGG + Intergenic
1028365994 7:90033013-90033035 TGAAGGAACCTGAAGGATTTGGG - Intergenic
1030367716 7:108664549-108664571 TTGAGGAGACTGAAGGATTGAGG - Intergenic
1032746765 7:134793918-134793940 TAGAGTAAAGTGAAGGAATGAGG - Intronic
1033280089 7:140000169-140000191 TAGATTAACCTGATGGTTTAGGG - Intronic
1033477311 7:141702928-141702950 TAGATTTACCTCAAGGATTGAGG - Intergenic
1033484942 7:141779411-141779433 TAGATTTACCTGATGGTTTGGGG + Exonic
1034574385 7:151984786-151984808 TGGGATAACCTGATGGATTGTGG + Intronic
1036495144 8:9263533-9263555 TGGAGTGATTTGAAGGATTGAGG + Intergenic
1038696868 8:29813952-29813974 TAGGATTACCTGAAGGATGGTGG + Intergenic
1039736167 8:40335245-40335267 TGGGGTAAGATGAAGGATTGTGG + Intergenic
1047145478 8:122194024-122194046 TGGAGTAATATGAAGGAATGGGG - Intergenic
1048053675 8:130843910-130843932 GAGAGTGACCTGAAGGAGTTGGG + Intronic
1055934824 9:81595041-81595063 AAGAGTAACATTAAGGATTTGGG - Intronic
1057235729 9:93357689-93357711 GAGATTTACCTGCAGGATTGTGG - Intergenic
1060714560 9:125911446-125911468 TAAAGTAACATGCAGGATAGTGG - Intronic
1188981160 X:36728445-36728467 TAGAGGAACCAGAAGCAGTGTGG - Intergenic
1190887062 X:54539607-54539629 TAGAATCACCTGGAGGATGGGGG + Intronic
1193614227 X:83668073-83668095 TAGAGCATCCTAAAGGATTATGG - Intergenic
1194292466 X:92091741-92091763 TAGGTTAACATAAAGGATTGTGG + Intronic
1195455979 X:105070280-105070302 TAGAGAAGCCTGAAGGGTTGGGG - Intronic
1197260234 X:124309397-124309419 TAGAGAAACCTGAAGAAATTTGG + Intronic
1197330067 X:125142718-125142740 TAGAATGACCTGAAGCTTTGTGG - Intergenic
1201236252 Y:11914725-11914747 TAGAGCCACCAGAAGGAATGGGG + Intergenic