ID: 1128286022

View in Genome Browser
Species Human (GRCh38)
Location 15:66437863-66437885
Sequence CTGCTCTCATTGAGGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 318}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128286022_1128286027 17 Left 1128286022 15:66437863-66437885 CCTTCTTTCCTCAATGAGAGCAG 0: 1
1: 0
2: 2
3: 16
4: 318
Right 1128286027 15:66437903-66437925 GCATATGAACATTTCTGGCTTGG 0: 1
1: 0
2: 0
3: 18
4: 206
1128286022_1128286024 -9 Left 1128286022 15:66437863-66437885 CCTTCTTTCCTCAATGAGAGCAG 0: 1
1: 0
2: 2
3: 16
4: 318
Right 1128286024 15:66437877-66437899 TGAGAGCAGAGCATTCTCTGTGG 0: 1
1: 0
2: 2
3: 28
4: 245
1128286022_1128286028 30 Left 1128286022 15:66437863-66437885 CCTTCTTTCCTCAATGAGAGCAG 0: 1
1: 0
2: 2
3: 16
4: 318
Right 1128286028 15:66437916-66437938 TCTGGCTTGGTCCTAGTGCTTGG 0: 1
1: 0
2: 1
3: 9
4: 135
1128286022_1128286026 12 Left 1128286022 15:66437863-66437885 CCTTCTTTCCTCAATGAGAGCAG 0: 1
1: 0
2: 2
3: 16
4: 318
Right 1128286026 15:66437898-66437920 GGGAAGCATATGAACATTTCTGG 0: 1
1: 0
2: 0
3: 14
4: 159
1128286022_1128286025 -8 Left 1128286022 15:66437863-66437885 CCTTCTTTCCTCAATGAGAGCAG 0: 1
1: 0
2: 2
3: 16
4: 318
Right 1128286025 15:66437878-66437900 GAGAGCAGAGCATTCTCTGTGGG 0: 1
1: 0
2: 2
3: 16
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128286022 Original CRISPR CTGCTCTCATTGAGGAAAGA AGG (reversed) Intronic
900173373 1:1281334-1281356 CTGCTCTCTCCCAGGAAAGACGG - Intronic
900271208 1:1789903-1789925 CTAATCTCATGGAGGAAGGAGGG + Intronic
900547782 1:3238065-3238087 CTTCTCTCATTGGCCAAAGAGGG + Intronic
900866289 1:5270978-5271000 ATGCCCTCATTCAGGAGAGATGG + Intergenic
902752551 1:18527338-18527360 CTGCTATCAAAGAGAAAAGATGG + Intergenic
904187613 1:28717853-28717875 TAGCTCTGATGGAGGAAAGAAGG - Intronic
905935195 1:41817867-41817889 CTGCCCTCTTTGAAGAAAGCAGG + Intronic
906094628 1:43213743-43213765 CTACTCTAATTGGGGTAAGATGG + Intronic
907207442 1:52785867-52785889 CTGCCCTCAATGAGGGAAGCTGG - Intronic
909584193 1:77270762-77270784 CCTCTTTCATGGAGGAAAGAAGG - Intergenic
911151516 1:94600797-94600819 CTCCTCTCCTGGAGGAAAGGAGG + Intergenic
912457518 1:109807741-109807763 CTGCTCCCATTTATGAAAGGAGG - Intergenic
913213772 1:116603164-116603186 CTGCTCTCTTTCAGGAAGGCTGG + Intronic
914217436 1:145644948-145644970 CTTCTCTAATTGAGGCAAAAGGG - Intronic
914470005 1:147967633-147967655 CTTCTCTAATTGAGGCAAAAGGG - Intronic
914812211 1:151037230-151037252 CAGCTATCATTGAGCAAAGTCGG - Intronic
916633040 1:166637761-166637783 CTGCTCTTACTGAGAGAAGAAGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917563690 1:176188004-176188026 CTGATCTCATGGAGGGAAGAGGG - Intronic
918400086 1:184154291-184154313 CGGCTCTCCTTGTGAAAAGATGG + Intergenic
918455073 1:184702885-184702907 CTGTTCTTATTCAGCAAAGAAGG - Exonic
918821265 1:189257791-189257813 CTGCTCTCAGTGAGGATCTATGG - Intergenic
921796718 1:219353202-219353224 TTGGTCTCATTGAGCTAAGAAGG + Intergenic
922061239 1:222094406-222094428 CTGCTCTAATGGAGGAAAATTGG - Intergenic
923042205 1:230327430-230327452 CTGCTGTTTCTGAGGAAAGAAGG - Intronic
923113547 1:230913325-230913347 CTGCCTTGATTGAGGAAGGAAGG + Intronic
1063309913 10:4942580-4942602 TTTCTCTCATTGAGAGAAGAGGG - Intronic
1063481673 10:6381839-6381861 CTGCCTTCATTGTGGAAACAGGG + Intergenic
1063580901 10:7305848-7305870 GTGTTCTGAATGAGGAAAGAGGG - Intronic
1063847573 10:10148160-10148182 GTGCTCTCTTTGGGGATAGAGGG - Intergenic
1064611638 10:17109428-17109450 CTGCTCTGATTTAGGAAATAAGG - Intronic
1065187483 10:23183091-23183113 GTGCTTTCATTGAAGAAATATGG + Intergenic
1067342554 10:45417516-45417538 CTGCCCTCACTCAGGAGAGATGG - Intronic
1067355342 10:45519360-45519382 CTGTTCTCATTGTGGATGGATGG - Intronic
1067851385 10:49756858-49756880 CTGCTCTCATGGACAACAGAAGG + Exonic
1069959459 10:72071078-72071100 CTTCTATGATTCAGGAAAGAAGG + Intronic
1070097983 10:73357044-73357066 GTGCTCTGACAGAGGAAAGAAGG + Intronic
1070708681 10:78660813-78660835 CTGCTCGCAGAGAGGATAGAAGG - Intergenic
1070791572 10:79192579-79192601 CTGCCCTGGTTGAGGAAGGAGGG + Intronic
1072256339 10:93624873-93624895 CTCCTCTTATGGTGGAAAGATGG + Intronic
1073953464 10:108838974-108838996 CTGCTCTCAGTGAAAAAAGAAGG + Intergenic
1074766965 10:116706652-116706674 CTGCCCTGTATGAGGAAAGATGG - Intronic
1076002978 10:126927090-126927112 CTCCAGTCATTGAGGAAATAAGG + Intronic
1077390522 11:2298855-2298877 CTGCCCTCAGTGAGGGCAGAGGG - Intronic
1078409828 11:11105281-11105303 CCTCTTTCATTGAGGAGAGAAGG + Intergenic
1079711508 11:23688905-23688927 CTGCTTGCCTTGAAGAAAGAAGG - Intergenic
1080123705 11:28706186-28706208 CTGCTATGGTTGAGGGAAGAAGG + Intergenic
1080181783 11:29434211-29434233 CTGCTTCCATTCATGAAAGAAGG - Intergenic
1082222275 11:49653883-49653905 ATCCTCACATGGAGGAAAGAGGG - Intergenic
1082672475 11:56052490-56052512 CTGCTGTCTTTGAAGATAGAAGG + Intergenic
1083594314 11:63911779-63911801 CTGGTGTCACTGAGGACAGAAGG - Exonic
1085980573 11:81718940-81718962 CACCTCTGATTGAGGAATGAGGG + Intergenic
1086418540 11:86614460-86614482 CTGCTCAGATGGAGCAAAGAGGG - Intronic
1086626766 11:88965316-88965338 ATCCTCACATGGAGGAAAGAGGG + Intronic
1087166217 11:95006218-95006240 CTGCTTTCATTCAGAAAATATGG - Intergenic
1087381181 11:97407172-97407194 CTGCTCACATTGCAGAAGGAAGG - Intergenic
1087677743 11:101182015-101182037 TTGCTTTCATTGGGGAAGGATGG - Intergenic
1088120596 11:106364458-106364480 CAGCTCTAATAGGGGAAAGAGGG + Intergenic
1088319333 11:108539063-108539085 CTGTTCTCATTCAGGAAATCTGG - Exonic
1088666994 11:112103095-112103117 CTGCCCTCATTGGGGGTAGAAGG - Intronic
1088785225 11:113175497-113175519 CACCTCTTATTGAGGAATGAGGG - Intronic
1088814470 11:113411756-113411778 GTGCTCTCATTCATAAAAGAAGG + Intronic
1088855067 11:113742203-113742225 CTCCTTGCATTGAGGTAAGAAGG - Intronic
1090032848 11:123222219-123222241 CTCCTCACATGGTGGAAAGAAGG - Intergenic
1092205337 12:6611393-6611415 CTGCACTCATTGTGGCAAGCGGG + Intergenic
1092698212 12:11198055-11198077 CTTCTCTTATTGAGAGAAGACGG - Intergenic
1092791112 12:12071725-12071747 AGGCTCTGATTGTGGAAAGAAGG - Intronic
1095249783 12:39964866-39964888 CTGCTTTCAGTTAGTAAAGAAGG + Intronic
1095353715 12:41245411-41245433 CTGCTTTCAAGCAGGAAAGATGG + Intronic
1096052062 12:48619003-48619025 ATGTTCTCATGGAAGAAAGAGGG + Intergenic
1096099173 12:48958503-48958525 CTGCTGTAAATGAGGAGAGAGGG - Intergenic
1098177790 12:67810963-67810985 CTGCTTTCATGGAGGAAAACAGG + Intergenic
1098188196 12:67920977-67920999 CTGCCCTCAGTGAGGAAGGCAGG - Intergenic
1099323596 12:81182291-81182313 ATGCTGTCCTTCAGGAAAGAAGG + Intronic
1099419857 12:82443684-82443706 CTGCTTTCATTCATGACAGAAGG + Intronic
1101023573 12:100578227-100578249 CTGTTCTGGCTGAGGAAAGATGG + Intronic
1105217004 13:18293715-18293737 CTGCTCTCTTTCAGGAAGGCTGG + Intergenic
1105906741 13:24818951-24818973 GGGCTCTAATGGAGGAAAGAAGG - Intronic
1105972816 13:25446330-25446352 CTGCGCTCATTTGGGGAAGAGGG - Intronic
1105991759 13:25628920-25628942 TCCCTCTCATGGAGGAAAGAAGG - Intronic
1106357865 13:29001312-29001334 GGGATCTCACTGAGGAAAGATGG + Intronic
1106822490 13:33480955-33480977 AGGCTCTCATTGACCAAAGATGG + Intergenic
1109720096 13:66264994-66265016 CAGATCTCATTAAAGAAAGAAGG - Intergenic
1110486283 13:76048263-76048285 ATCCTCACATGGAGGAAAGAGGG + Intergenic
1111384981 13:87513480-87513502 CTTCTCTCCTTTAGAAAAGAAGG + Intergenic
1112063357 13:95765005-95765027 CTTTTCTAATTGAGGAAAGCAGG - Intronic
1112140181 13:96632617-96632639 ATGCTCTCAGTGAAGGAAGATGG + Intronic
1113878860 13:113611416-113611438 CTGTGCTGTTTGAGGAAAGATGG + Intronic
1116759965 14:48999790-48999812 CAGCTGTCATTGAAGATAGATGG + Intergenic
1117045829 14:51812283-51812305 ATCCTCTCTTTGAGGAAAAATGG + Intergenic
1118835496 14:69475073-69475095 GTCTTCTCATTGAGTAAAGATGG + Intergenic
1119002707 14:70897385-70897407 CTTCTCTCATGGAGGCAAAATGG - Intergenic
1119859970 14:77929164-77929186 CTGCTCTCATTGAGGATTAGGGG + Intronic
1124970297 15:34483175-34483197 CTGTTCTCTCTGAGGAATGAGGG - Intergenic
1126069231 15:44851253-44851275 CTGTTGACAATGAGGAAAGAAGG - Intergenic
1126431880 15:48594474-48594496 CTGCTCCCCTTCAGGAAAAAGGG - Intronic
1127460523 15:59194567-59194589 CTTCTCTCTTGGAGAAAAGAAGG - Intronic
1128084858 15:64878779-64878801 CTCTTCCCATTCAGGAAAGAAGG + Intronic
1128286022 15:66437863-66437885 CTGCTCTCATTGAGGAAAGAAGG - Intronic
1130100132 15:80887110-80887132 GTGCTTTCATGGAGGAATGATGG + Intronic
1131211413 15:90500173-90500195 TTGCTTCCAATGAGGAAAGAAGG - Exonic
1131283512 15:91039627-91039649 CTGGTCCATTTGAGGAAAGATGG - Intergenic
1132295943 15:100734545-100734567 CTCCCCTGCTTGAGGAAAGAAGG - Intergenic
1137865594 16:51892799-51892821 CTGGTCCCAGTGAGCAAAGAAGG - Intergenic
1138113056 16:54339856-54339878 CAGCTCTGATGGAGAAAAGAGGG - Intergenic
1138971658 16:62151494-62151516 CTGGTCTAATAGAGGAAGGAAGG - Intergenic
1139734165 16:68973034-68973056 CTGCTCATATTCAGGGAAGAAGG + Intronic
1139791882 16:69444290-69444312 CAGCTCTCAGTGAAGACAGAGGG - Intronic
1141611629 16:85184510-85184532 GAGCTCTCATGGGGGAAAGAGGG - Intronic
1143578373 17:7808612-7808634 CTGCTTTCAGAGAGGAAAGCTGG - Intronic
1148000892 17:44386240-44386262 GAGGTGTCATTGAGGAAAGATGG - Intronic
1148383978 17:47221445-47221467 CTGCTTTCACTGAGAAAAGAGGG + Intronic
1148505802 17:48126224-48126246 CTCCTCTCCTTGAGTAATGAGGG + Intergenic
1148972790 17:51498967-51498989 CTGTTCTCAGAGTGGAAAGATGG - Intergenic
1150011240 17:61506121-61506143 CTGGTATCCTTGAGGAAAGGGGG - Intergenic
1152065526 17:78110701-78110723 CTGCTCTCATCGAGCAAACATGG + Exonic
1153451302 18:5232589-5232611 CTGCTCTGGTGGAGGTAAGAGGG + Intergenic
1153555513 18:6309236-6309258 CTGCATTCACTGTGGAAAGAAGG - Intronic
1154421906 18:14238711-14238733 CTTTTCTCAATGAGGAAATAAGG - Intergenic
1155132580 18:22953206-22953228 CTGCTATAAATGAGGAAAGCAGG - Intronic
1159279181 18:66262469-66262491 CTTCTCCAATTGAGGAATGATGG + Intergenic
1159554211 18:69928389-69928411 CTGCCCTCATTCAGGACAGGAGG + Intronic
1160545757 18:79652465-79652487 TTGCTCTCATTGTGGAAAGACGG - Intergenic
1162072324 19:8161445-8161467 GTGCTCCCACTGAGGAGAGAGGG - Intronic
1163615049 19:18322235-18322257 TTTCTCTCATTGAAAAAAGAAGG + Intronic
1164864279 19:31590952-31590974 CAGCTGTCCTTCAGGAAAGAGGG + Intergenic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
925565335 2:5247508-5247530 CTCCGTTCATTGAGGAGAGAGGG + Intergenic
925835339 2:7939865-7939887 ATGGTCTGATTGAGGAAGGAGGG + Intergenic
925933795 2:8733613-8733635 CTGCTCTCACTGAGGAAACGTGG + Exonic
926219001 2:10922777-10922799 CTGCACTTTCTGAGGAAAGAGGG + Intergenic
927757013 2:25716844-25716866 CTCCTGACATGGAGGAAAGAAGG - Intergenic
929867398 2:45729827-45729849 CTGCTCCCCTTGAGGCAAGGTGG - Intronic
930053468 2:47234719-47234741 CTGACCTCATTGAGAAAAAAAGG - Intergenic
930420393 2:51145455-51145477 ATGCTCATATTGTGGAAAGAGGG + Intergenic
930679456 2:54240940-54240962 CTGTTCTCATTGAGGTAATGAGG + Intronic
933113463 2:78434681-78434703 CTGTTTTTATTGAAGAAAGAAGG - Intergenic
934146610 2:89100957-89100979 CTGCATGCATTGAGGAAACACGG - Intergenic
934164314 2:89280527-89280549 CTGCCCTCACTGAGGAGAGAGGG + Intergenic
934202960 2:89901997-89902019 CTGCCCTCACTGAGGAGAGAGGG - Intergenic
934220937 2:90082171-90082193 CTGCATGCATTGAGGAAACATGG + Intergenic
934222655 2:90099617-90099639 CTGCATGCATTGAGGAAACACGG + Intergenic
934233574 2:90209410-90209432 CTGCATGCATTGAGGAAACACGG + Intergenic
934297321 2:91752967-91752989 CTGCTCTCTTTCAGGAAGGCTGG - Intergenic
934496227 2:94802421-94802443 CTTTTCTCAATGAGGAAATAAGG + Intergenic
935920037 2:108002610-108002632 CCGATCCCATTGAGGCAAGAGGG + Intronic
936787258 2:116108396-116108418 CTCCTCTGATTGAAGCAAGATGG + Intergenic
937104099 2:119294338-119294360 AAGCCCTCATGGAGGAAAGAGGG + Intergenic
937698677 2:124838841-124838863 CTAATCTCATTAAGGAAATAAGG - Intronic
944121566 2:196246166-196246188 CTGCTCTCCTAGATGAATGAGGG + Intronic
944191396 2:197008257-197008279 CTGCTCTGATGGAAGCAAGAGGG - Intronic
945727845 2:213494814-213494836 CTGGTGTCATTGAGGAGATAGGG - Intronic
946833308 2:223746934-223746956 CTGTTCTAAATGAGGAAGGAAGG + Intergenic
946890083 2:224266137-224266159 ATGCTAACATTGAGGAAAGTTGG + Intergenic
1169135372 20:3194110-3194132 CTGCTCTCTTTCAGGAGAGGTGG + Intronic
1170117139 20:12872633-12872655 CTGTTCTCATTCATGAAAAAAGG + Intergenic
1170157431 20:13281386-13281408 CTGCTTTCCAAGAGGAAAGACGG + Intronic
1171725443 20:28616027-28616049 CAGCTCTCATTTAGAAATGAAGG - Intergenic
1171789646 20:29510517-29510539 CAGCTCTCATTTAGAAATGAAGG - Intergenic
1173018322 20:39246683-39246705 CTGCTCCCATTCAGGAAGGAAGG - Intergenic
1173038465 20:39435692-39435714 ATGCTATCATTGAGGAAACTGGG - Intergenic
1173606151 20:44333205-44333227 CTGCCCCCATTGAAGAAAGCTGG - Intergenic
1173708873 20:45137081-45137103 CTGCTCTGAGGGAGGAGAGAAGG - Intergenic
1175614114 20:60378052-60378074 CTGCATTCATAGAAGAAAGAGGG - Intergenic
1176851576 21:13921249-13921271 CTTTTCTCAATGAGGAAATAAGG + Intergenic
1177239890 21:18443225-18443247 CTGCTCTCGTAGAGAACAGAGGG + Intronic
1177886818 21:26757279-26757301 TAGCTATCATTGAGGAGAGAGGG - Intergenic
1178124356 21:29500749-29500771 CTCCTCTCCATAAGGAAAGATGG - Intronic
1181889100 22:26045972-26045994 CACCTCTCATTGGGGAAAAATGG + Intergenic
1182045157 22:27268465-27268487 CTGCTCTCATTAAGGTCAAAAGG - Intergenic
949783172 3:7712513-7712535 CTACTGTAATTCAGGAAAGAGGG - Intronic
950389193 3:12683226-12683248 CTGCTCTCATTGTATAAAGGTGG - Intergenic
950800096 3:15543675-15543697 CAGACCTCAATGAGGAAAGAGGG - Intergenic
952277355 3:31890320-31890342 CTGCTGTGATTTAGGAAAGCTGG - Intronic
952522708 3:34177971-34177993 ATACTCTCATTGAGAAAAGCTGG + Intergenic
953737381 3:45508022-45508044 CTGATCTCATTCAGTGAAGATGG - Intronic
954147509 3:48641611-48641633 CTGTTCTCATTGAGCAGAGGTGG + Intronic
955182070 3:56682399-56682421 CAGCTCCCAGAGAGGAAAGATGG - Intronic
955726034 3:61933799-61933821 CTGGTATCATTGAGGAGACAAGG - Intronic
959007886 3:101041057-101041079 CTGCTCTGATGGAGGGAAGGAGG - Intergenic
959412776 3:106046159-106046181 CTTCTTACATTCAGGAAAGAAGG - Intergenic
961631858 3:128307092-128307114 CTGCTCTCATTCTGGGAAGGTGG - Intronic
961870122 3:129981369-129981391 TTGGTCTGGTTGAGGAAAGAAGG + Intergenic
961911024 3:130316718-130316740 CTGCTGTCATATAGAAAAGAAGG + Intergenic
962235486 3:133703463-133703485 CTGCTTTCATTTATAAAAGAGGG + Intergenic
962241719 3:133755831-133755853 CTGCTGAGATTGAGGGAAGAGGG - Intronic
962387748 3:134946399-134946421 CTGGTGCCATTGAGGAATGAAGG - Intronic
962891006 3:139673045-139673067 CTGCTGTCTGAGAGGAAAGAAGG - Intronic
964046483 3:152333963-152333985 CTGCTCCCATTTTGGAAACAAGG - Intronic
964225071 3:154389197-154389219 TTGTTTCCATTGAGGAAAGATGG - Intronic
964692394 3:159465003-159465025 CTGCTTTCATGCAGGAAGGAAGG - Intronic
967257980 3:187612709-187612731 CTACTCTCAATCAGAAAAGAAGG + Intergenic
968739478 4:2320051-2320073 CTCCTCTCTGTGAGGAAGGATGG - Intronic
970524382 4:16916773-16916795 CTGTTCTGACTGGGGAAAGAGGG - Intergenic
970988258 4:22183427-22183449 GTGCTCACATGGTGGAAAGAGGG + Intergenic
973015324 4:45130539-45130561 GTGCTCTCTTTAAGGGAAGAGGG - Intergenic
973270266 4:48255316-48255338 CTGCTGGCATTTAGGAAAGGGGG - Intronic
974549383 4:63350672-63350694 CTACTTTCTTCGAGGAAAGAGGG + Intergenic
974891836 4:67892914-67892936 CAGCTCTCGTTGAAGAAAGTGGG - Intergenic
978938791 4:114412969-114412991 CTGGTCTAATAGGGGAAAGAGGG + Intergenic
980392914 4:132169610-132169632 CTCCACCCACTGAGGAAAGATGG + Intergenic
980490051 4:133512899-133512921 CTGCTCTGATTGGTGTAAGATGG - Intergenic
984734062 4:183094474-183094496 CTGATCTCCTTGAAGAAACAAGG + Intergenic
985170825 4:187148101-187148123 CTGCTTGCACTCAGGAAAGATGG - Intergenic
986618573 5:9645754-9645776 CTTCTCTCATGGTGGCAAGATGG - Intronic
986870949 5:12045577-12045599 CTGTTGTCATTGAGAAATGAAGG + Intergenic
987475017 5:18380708-18380730 CAGCTCTCACTGAGGACATAAGG + Intergenic
989603727 5:43224150-43224172 CAGCTCTCAGGGAGGCAAGAGGG - Intronic
992165765 5:74049648-74049670 CTACTCTCATTCTGGAAAGATGG - Intergenic
993834398 5:92798884-92798906 TTGCATTCATTGAGAAAAGAAGG + Intergenic
995788182 5:115854149-115854171 CTGCTCTCATGAATGAATGAAGG - Intronic
996140130 5:119896963-119896985 CTGCTGTCTTTGAAGACAGAAGG - Intergenic
996326243 5:122277738-122277760 CTGCTATCATTGATGGAAGCTGG - Intergenic
996413539 5:123184863-123184885 GAGTTCTCCTTGAGGAAAGAAGG - Intronic
999936957 5:156497216-156497238 CTTCTGTTATTGAGGAAAGATGG + Intronic
1000588922 5:163134684-163134706 ATGCCCACATTTAGGAAAGAAGG - Intergenic
1000873996 5:166612988-166613010 CTGCTGGCATTGAGGAAGCAAGG - Intergenic
1001180086 5:169512402-169512424 CTTCTCTCTTTCAGAAAAGAGGG + Intergenic
1003104846 6:3207590-3207612 CTTCTCTCATAAAAGAAAGAAGG + Intergenic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1006514391 6:34538033-34538055 CTGCTCCCCTGGAGGACAGAGGG - Exonic
1007635210 6:43295785-43295807 CTGATGTCATTGAAGAATGATGG - Intronic
1008261943 6:49377458-49377480 CTTCTTTCATTGAGGAGAGAAGG + Intergenic
1008308162 6:49931424-49931446 CTACTTTTATTGAGAAAAGATGG + Intergenic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1010323379 6:74539070-74539092 GAGGTCTCCTTGAGGAAAGATGG - Intergenic
1010507418 6:76677336-76677358 CTGCCCTCCTTTATGAAAGACGG + Intergenic
1011354417 6:86459224-86459246 ATGGTCACATTGAGGAGAGAGGG + Intergenic
1011410410 6:87060359-87060381 TTGCTTTCAGTGAAGAAAGAAGG + Intergenic
1012126990 6:95442362-95442384 ATTATCTCTTTGAGGAAAGAGGG - Intergenic
1014179876 6:118373139-118373161 CTGCTTTCATTATTGAAAGAGGG - Intergenic
1017066533 6:150534359-150534381 CTGCTCTCATTAAAGAATGCCGG + Intergenic
1017696281 6:157019597-157019619 TTGCTTTCATTAAGGAAGGAGGG + Intronic
1019165986 6:170097856-170097878 CTGCTCTGATAGAGGCAAGGAGG - Intergenic
1019317631 7:396971-396993 CTGCACTCTTTGAGGAGTGATGG - Intergenic
1019479671 7:1260644-1260666 CTGCTCCCAGCGAGGACAGAAGG - Intergenic
1019993169 7:4706564-4706586 CTGCCCACATTGAGGAAGGGTGG - Intronic
1021359784 7:19697454-19697476 CTGCTTTCATTGAGAAAATGTGG - Exonic
1023119972 7:36899321-36899343 CTGCTCTAGTTGAGGCAAGGAGG + Intronic
1024050789 7:45622091-45622113 CTGCTCTCATTGCAGACTGAGGG + Intronic
1024447979 7:49503870-49503892 CTGCTCACAGAGAGGAAGGAAGG - Intergenic
1027585987 7:80059108-80059130 CTGCTCTCATAGGTGAAAGGTGG - Intergenic
1027965132 7:84994598-84994620 ATGCTTAAATTGAGGAAAGAGGG - Intergenic
1028646128 7:93098679-93098701 CTGCTGGCATTGAGGAAATAAGG + Intergenic
1028856329 7:95597514-95597536 CTGATCTCTTTCAGGAAAGGGGG - Intergenic
1029316104 7:99715951-99715973 CTGCACGCATAGAGGAAGGATGG - Intronic
1031814856 7:126421183-126421205 CTGATCTCATTGGGTAGAGAGGG - Intergenic
1032502527 7:132410591-132410613 CTGGTGTCATAGAGGAAGGAGGG + Intronic
1034326939 7:150245076-150245098 CTTCACTCATTGTTGAAAGAGGG - Intronic
1034535327 7:151722525-151722547 CATCTCTCACTGAGGAAAGAAGG + Intronic
1034766268 7:153724375-153724397 CTTCACTCATTGTTGAAAGAGGG + Intergenic
1035585060 8:766387-766409 CAGCTCACATAGAGGAAGGATGG - Intergenic
1035706677 8:1680933-1680955 CTGCTCTCATCCTGGAAGGAAGG - Intronic
1037935322 8:22911586-22911608 CTGCTCTCACTGGTGAAAGAAGG - Intronic
1038380387 8:27087320-27087342 CTGCTCTCTTTTAGGGAAGGAGG + Intergenic
1042533445 8:69836319-69836341 GTGCTCTAATGGAGGAAAGGAGG + Intergenic
1042991026 8:74640143-74640165 CTTCTCTCAATGCGGAAATAAGG + Intronic
1044055351 8:87562942-87562964 ATGCTATCATTGAGGAAAACGGG - Intronic
1044064130 8:87678501-87678523 CTGCTCTCAGTAAGAAAAAAAGG + Intergenic
1044483027 8:92714987-92715009 CTGCTCACTTTTAGGAAAGTAGG - Intergenic
1045906366 8:107350169-107350191 TTGCTGTCATTTAGGAAACATGG - Intronic
1046859763 8:119077151-119077173 GTGCTCCAATTGAGGAAAGCAGG - Intronic
1047294736 8:123560676-123560698 CTCCTCTCACAGAGGCAAGATGG - Intergenic
1048269762 8:133019263-133019285 CTGCACTCTTGGAGCAAAGAAGG + Intronic
1049026317 8:139991813-139991835 CTGCTCTCTTTGCTGAAAAAGGG - Intronic
1050689301 9:8207438-8207460 GTGCTCTAATTGAGCAAAAAGGG - Intergenic
1051851308 9:21512102-21512124 CTGCTGTCAGACAGGAAAGATGG + Intergenic
1052338166 9:27340029-27340051 CTGCTCTCTTTTAGGAATGTGGG + Intronic
1052399691 9:27985126-27985148 CTTTTCTGAATGAGGAAAGAAGG + Intronic
1053621749 9:39826604-39826626 CTGCATTCATTCAGGAGAGAGGG - Intergenic
1053660913 9:40277958-40277980 CTTTTCTCAATGAGGAAATAAGG - Intronic
1053837684 9:42158470-42158492 CTGCATTCATTCAGGAGAGAGGG - Intergenic
1053883346 9:42617692-42617714 CTGCATTCATTCAGGAGAGAGGG + Intergenic
1053889323 9:42676607-42676629 CTGCATTCATTCAGGAGAGAGGG - Intergenic
1054222369 9:62425159-62425181 CTGCATTCATTCAGGAGAGAGGG + Intergenic
1054228344 9:62484013-62484035 CTGCATTCATTCAGGAGAGAGGG - Intergenic
1054373035 9:64424172-64424194 CTTTTCTCAATGAGGAAATAAGG - Intergenic
1054523697 9:66098326-66098348 CTTTTCTCAATGAGGAAATAAGG + Intergenic
1054680664 9:67913951-67913973 CTTTTCTCAATGAGGAAATAAGG - Intergenic
1056896657 9:90557224-90557246 CTTCTCTCCTTGAGTAAATATGG + Intergenic
1058169500 9:101663210-101663232 CTGATCTGAATGGGGAAAGAAGG - Intronic
1061604319 9:131697414-131697436 CTTCGCTCATTTAGGAAAGCAGG - Intronic
1203450966 Un_GL000219v1:115925-115947 CAGCTCTCATTTAGAAATGAAGG - Intergenic
1185434527 X:32117-32139 TAGGTCTCATTGAGGACAGATGG + Intergenic
1185435153 X:38153-38175 TGGGTCTCATTGAGGAAAAATGG + Intergenic
1185435207 X:38701-38723 TAGGTCTCATTGAGGACAGATGG + Intergenic
1185436297 X:98456-98478 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185436872 X:104189-104211 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185436927 X:104738-104760 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185436934 X:104799-104821 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185437026 X:105592-105614 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185437197 X:107239-107261 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185437226 X:107544-107566 TAGGTCTCATTGAGGAGAGATGG - Intergenic
1185437336 X:108642-108664 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185437527 X:110532-110554 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185437582 X:111081-111103 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185437589 X:111142-111164 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185437681 X:111935-111957 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185437852 X:113582-113604 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185437881 X:113887-113909 TAGGTCTCATTGAGGAGAGATGG - Intergenic
1185437991 X:114985-115007 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185438287 X:117912-117934 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185438592 X:120961-120983 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185438648 X:121510-121532 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185438655 X:121571-121593 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185438760 X:122486-122508 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185438876 X:123584-123606 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185438901 X:123828-123850 TAGGTCTCATTGAGGAGAGATGG - Intergenic
1185439012 X:124926-124948 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185439217 X:126938-126960 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185439336 X:128155-128177 TAGGTCTCATTGAGGAGAGATGG - Intergenic
1185439447 X:129253-129275 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185439652 X:131265-131287 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185439707 X:131814-131836 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185439714 X:131875-131897 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185439819 X:132790-132812 TAGGTCTCATTGAGGACAGATGG - Intergenic
1185443441 X:241442-241464 TAGGTCTCATTGAGGACAGATGG + Intergenic
1185443541 X:242418-242440 TAGGTCTCATTGAGGACAGATGG + Intergenic
1185443548 X:242479-242501 TAGGTCTCATTGAGGACAGATGG + Intergenic
1185443615 X:243150-243172 TAGGTCTCATTGAGGACAGATGG + Intergenic
1185443788 X:244797-244819 TAGGTCTCATTGAGGACAGATGG + Intergenic
1185443968 X:246626-246648 TAGGTCTCATTGAGGACAGATGG + Intergenic
1185798991 X:2992535-2992557 CTGTTCTCAATGACGAAGGATGG - Intergenic
1186235030 X:7498501-7498523 CTGCTCTCATTTTGGAAAGAAGG + Intergenic
1186246435 X:7621047-7621069 CAGCTCTCAGGGAGGAAGGATGG + Intergenic
1186676776 X:11825777-11825799 ATGTTCTCATTTAGGAAAGCTGG + Intergenic
1186754967 X:12661017-12661039 ATGCTCACTTTGAGGAAAGCCGG - Intronic
1189260859 X:39678010-39678032 TTGCTCTGGTTTAGGAAAGATGG - Intergenic
1189770622 X:44422680-44422702 CTGCTCTCATGGTAAAAAGATGG - Intergenic
1190568846 X:51761596-51761618 CTGCTCTCATTACAAAAAGAGGG + Intergenic
1193832754 X:86308686-86308708 GTGGTCTCCTTGGGGAAAGATGG - Intronic
1195828837 X:109033093-109033115 CTCCTCTCCTCAAGGAAAGAAGG + Intergenic
1195918102 X:109955772-109955794 ATCCTCACATGGAGGAAAGAGGG + Intergenic
1198615381 X:138452713-138452735 ATGCTCTGATTGGAGAAAGAGGG + Intergenic
1198683611 X:139205492-139205514 CGGCTCTCAGTGGGGAGAGAAGG + Intronic
1199895812 X:152127246-152127268 ATGCTCTGATTGAAGAAAAAGGG - Intergenic
1200063455 X:153494044-153494066 CTGCTCTTGCTGAGGGAAGAAGG + Intronic