ID: 1128287912

View in Genome Browser
Species Human (GRCh38)
Location 15:66453689-66453711
Sequence CTTCTGTCCTTGAGGAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 287}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128287910_1128287912 27 Left 1128287910 15:66453639-66453661 CCTCTGTTCTAAATATATTCTTC 0: 1
1: 0
2: 2
3: 42
4: 411
Right 1128287912 15:66453689-66453711 CTTCTGTCCTTGAGGAAAAGTGG 0: 1
1: 0
2: 1
3: 23
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128287912 Original CRISPR CTTCTGTCCTTGAGGAAAAG TGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900383304 1:2396253-2396275 GTTCTGTCCTTGAGGGTGAGAGG + Intronic
901640515 1:10690781-10690803 CTTCTCTTCTTGAGACAAAGGGG - Intronic
903461560 1:23524481-23524503 CTTTTGGCCTTGGAGAAAAGGGG + Exonic
903754447 1:25651204-25651226 CTTCTGTCCCAGAGGAGAAGCGG + Intronic
907675892 1:56517723-56517745 CCTCTGTCTTTGGAGAAAAGAGG + Intronic
907707188 1:56842733-56842755 CCTCTATCCTGGAGGAAAAGAGG - Intergenic
907911925 1:58834461-58834483 CTTCTTTCCTGGAGGATAATTGG - Intergenic
907922711 1:58928562-58928584 CTTCTAGTCTTGGGGAAAAGGGG - Intergenic
908206270 1:61853037-61853059 GTTCTGTCGTCCAGGAAAAGGGG + Intronic
908748692 1:67399513-67399535 CTTCTGTCATTCATGGAAAGAGG - Intergenic
911151516 1:94600797-94600819 CTCCTCTCCTGGAGGAAAGGAGG + Intergenic
912557951 1:110529836-110529858 CTGCTGTTCTCGAGGTAAAGAGG + Intergenic
913055895 1:115159407-115159429 TTTCTTTCCTTGGGGAAGAGAGG - Intergenic
913297966 1:117340106-117340128 CCTCTGTTCTTGAGGGAAAATGG + Intergenic
913563479 1:120047125-120047147 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
913634644 1:120746452-120746474 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
914284073 1:146206489-146206511 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914545104 1:148657228-148657250 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914621462 1:149413460-149413482 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918322436 1:183377039-183377061 TTTCCTTCCTTGAGGAAGAGAGG - Intronic
918643636 1:186876049-186876071 CTTATGGCCTTGAGGAAAGAAGG + Intronic
919846558 1:201646515-201646537 ATTCTGTCCTTGAGGAACTCTGG - Intronic
919847921 1:201653263-201653285 CTTCTGTCCTCCAGGAAAAGGGG + Intronic
920385525 1:205568524-205568546 CTTCTGTTCTGGGGGAAAGGGGG + Intergenic
921190448 1:212703712-212703734 CTTCTCTCTTTTAGGAAAATTGG + Intergenic
921482733 1:215681498-215681520 CTTCTTTCCTTGATGAACAAGGG + Intronic
1064262482 10:13797239-13797261 TTTCAGTCCTTCAGGAAAAAAGG - Intronic
1065171335 10:23033562-23033584 TTTGTGTGCATGAGGAAAAGAGG + Intronic
1065760478 10:28977472-28977494 TTTAGGTCCTTGAGGAACAGAGG - Intergenic
1066058850 10:31705127-31705149 CTTCTGGCACTCAGGAAAAGTGG - Intergenic
1066286674 10:33973861-33973883 CATCTGTATTTAAGGAAAAGAGG + Intergenic
1071427211 10:85571240-85571262 CAGCTGGCTTTGAGGAAAAGAGG + Intergenic
1071724826 10:88187622-88187644 CAGCTGTCCTGGAGGACAAGTGG + Intergenic
1072267236 10:93742445-93742467 TTTCTGTCCTTAGGAAAAAGGGG - Intergenic
1072729926 10:97839031-97839053 CTTCTGTCACTGAAGAAAACAGG + Intergenic
1077793734 11:5469083-5469105 ACTCTGTCCAGGAGGAAAAGTGG + Intronic
1078294006 11:10046964-10046986 CTTCTGACATAAAGGAAAAGTGG - Intronic
1079240753 11:18720870-18720892 CTTCTGTCTGTGGGGAAAAAAGG + Intronic
1080741095 11:35064926-35064948 TTTCTGCCCAGGAGGAAAAGTGG + Intergenic
1080760605 11:35245414-35245436 GTTGTCTCCTTGAGGAAACGAGG - Intergenic
1081045462 11:38268675-38268697 CTTCTATGCCTGAAGAAAAGGGG - Intergenic
1081416761 11:42824543-42824565 CATCTATCATTGAGAAAAAGAGG + Intergenic
1081667214 11:44923569-44923591 CCTCTGTGCTTAAGGGAAAGGGG - Intronic
1084289413 11:68152235-68152257 CTTCCTTCCAGGAGGAAAAGAGG - Intergenic
1084470897 11:69358460-69358482 GTTCTTTCCTTGAAGAAAATGGG + Intronic
1084808365 11:71595957-71595979 CTTCTGTGTTTGAAGAAAAAAGG + Intronic
1086560666 11:88164949-88164971 CTTCTGTCCCTCAGGCACAGTGG + Intronic
1088775462 11:113078284-113078306 CTCGTGTCCTTAAAGAAAAGGGG - Intronic
1089394376 11:118126352-118126374 CTTCCTTCCTTGTGAAAAAGGGG - Intergenic
1089676696 11:120095318-120095340 CTGCTGTCCTAGAGCAAGAGTGG + Intergenic
1090188356 11:124752378-124752400 CTTCAGACCTTGGGGAGAAGAGG - Intergenic
1090631445 11:128652655-128652677 CTTCTGTCCTTGAGGAGTTAAGG + Intergenic
1091484470 12:871251-871273 CTTCTTTCCTTCAGGCACAGGGG + Exonic
1093105538 12:15081710-15081732 ATTCTGTCCTTGAGGAACTTAGG - Intergenic
1095852961 12:46831015-46831037 CTGCTGACTTGGAGGAAAAGGGG - Intronic
1097021776 12:56025899-56025921 CTTCTGTCGCTGAGGAGAGGAGG - Intronic
1097519180 12:60646649-60646671 CTTTTCTCCCTGAGGAAACGAGG - Intergenic
1098490754 12:71074226-71074248 CCTCTGCCCTTGAGGAGCAGGGG - Intronic
1098848229 12:75564167-75564189 ACTTTGTACTTGAGGAAAAGTGG - Intergenic
1098937020 12:76491631-76491653 CCTCTGTCCTTGAAGAGAATTGG - Intronic
1100404786 12:94263563-94263585 GATCTGTGCTGGAGGAAAAGAGG + Intronic
1100953113 12:99875019-99875041 CTCCTGGCCTTGGGGTAAAGAGG + Intronic
1101080086 12:101173015-101173037 CTTCAGCCCTTGATGAAAAGAGG + Intronic
1102037379 12:109779708-109779730 CTTGTGTCCTTGAGGAAAGCTGG + Intergenic
1102892493 12:116571210-116571232 CTTCTGTGGTTGAGGAAAGGTGG + Intergenic
1102975931 12:117207299-117207321 CAGCTGTGCTGGAGGAAAAGGGG + Intergenic
1104964301 12:132502155-132502177 CCTCTGTCCCTAAGGAAATGCGG - Intronic
1106068235 13:26379906-26379928 CTTCTGTCATTAAGGGAGAGGGG + Intronic
1106110371 13:26771737-26771759 CTTGTATCCTGGTGGAAAAGTGG - Intergenic
1107215427 13:37912022-37912044 CTTGTATCCTTGAGGAATAAAGG + Intergenic
1109960037 13:69617704-69617726 GTAATGTCCTTGAGGAAGAGAGG - Intergenic
1110645133 13:77873849-77873871 CTGCTGTGCTTGAGTAGAAGTGG + Intergenic
1110691729 13:78437909-78437931 CATCAGTCTTTGGGGAAAAGAGG + Intergenic
1111252311 13:85618568-85618590 CTGCTTTCCATAAGGAAAAGTGG - Intergenic
1111534060 13:89578363-89578385 TATCTTTGCTTGAGGAAAAGAGG - Intergenic
1112717915 13:102207590-102207612 CATCTGTCCTTGAGAAAAAAGGG + Intronic
1113597289 13:111542313-111542335 CATCTGTCCTGGTGGAAAACAGG + Intergenic
1113955756 13:114099208-114099230 GTTCTGACCTTGAGAAAAGGAGG - Intronic
1114310409 14:21461578-21461600 TTTTTTTCCTTGAGGAAATGAGG + Intronic
1114911492 14:27204531-27204553 CTTCTGTCCCTGAGAACAAGTGG + Intergenic
1115772827 14:36684271-36684293 CTTGTTTACTTGAGAAAAAGAGG + Intronic
1116551079 14:46238572-46238594 CTACAATCCTTGAGAAAAAGAGG + Intergenic
1116614759 14:47120514-47120536 CTTCTGTTCCTGAAGAAAATAGG - Intronic
1117309383 14:54506772-54506794 CTCCTTTCCTAGAGGGAAAGTGG - Intergenic
1117448581 14:55828651-55828673 ACTATTTCCTTGAGGAAAAGGGG - Intergenic
1117834874 14:59793415-59793437 CTTCTGTACTTAAGAAAAAAAGG - Intronic
1117961914 14:61171643-61171665 CTTCTTTCCTGGAGAAAAGGTGG + Intergenic
1122077390 14:99245375-99245397 CTTTTGTCCTTGAGAAAAGCGGG + Intronic
1122262218 14:100530088-100530110 CATCTACCCTTGAGGAAGAGGGG - Exonic
1123550213 15:21370443-21370465 CTCCTGTACTGGAGGAAGAGTGG + Intergenic
1123904301 15:24906885-24906907 CTGCTGTCCCTTAGGAGAAGAGG + Intronic
1126319735 15:47409239-47409261 GTTCTCTCCTGGAGGAAATGTGG + Intronic
1128287912 15:66453689-66453711 CTTCTGTCCTTGAGGAAAAGTGG + Intronic
1128909198 15:71496734-71496756 GTTCTGTCCTTAGGGAGAAGGGG + Intronic
1131612632 15:93981233-93981255 CTTCTATCCTTGAGCTAAAAGGG - Intergenic
1202958554 15_KI270727v1_random:97698-97720 CTCCTGTACTGGAGGAAGAGTGG + Intergenic
1132888783 16:2194333-2194355 CAGCTGTCCTTGAGGGGAAGAGG - Intronic
1133098779 16:3466555-3466577 CTCCTGTCTTTGGGGAACAGGGG - Intronic
1134248366 16:12556795-12556817 CTTCTGTACTTTAGTAAAGGGGG - Intronic
1134348005 16:13409366-13409388 CCTCTGTCCTTGCAGAAAGGTGG + Intergenic
1134686002 16:16159248-16159270 CTTCTGAGCTTGAGGAAAGCAGG - Intronic
1136701359 16:32146981-32147003 CATATGTGCTTGAGGTAAAGAGG - Intergenic
1136766305 16:32780483-32780505 CATATGTGCTTGAGGTAAAGAGG + Intergenic
1136801793 16:33089895-33089917 CATATGTGCTTGAGGTAAAGAGG - Intergenic
1138099442 16:54240680-54240702 CTTCTTTCCTTGGGGAATAATGG - Intergenic
1141004329 16:80337998-80338020 CAGCTGTCCTCCAGGAAAAGTGG + Intergenic
1141027809 16:80564329-80564351 GCTCTGTCCTTGGGCAAAAGTGG + Intergenic
1141086852 16:81101957-81101979 ACTCTGACCTAGAGGAAAAGGGG - Intergenic
1141347380 16:83259772-83259794 CTTCTAGCCCTGAGGCAAAGAGG + Intronic
1203068691 16_KI270728v1_random:1042729-1042751 CATATGTGCTTGAGGTAAAGAGG + Intergenic
1142895573 17:2975658-2975680 GCTCTGTCCAAGAGGAAAAGGGG - Intronic
1143726194 17:8848289-8848311 ATGCTGTCTTTTAGGAAAAGAGG - Intronic
1143902538 17:10184865-10184887 CTGCTGACCTCCAGGAAAAGGGG + Intronic
1143952181 17:10641969-10641991 CTGGTGTCCTTTAGGAAAATTGG + Intronic
1144511642 17:15882071-15882093 TTCGTGTCCTTAAGGAAAAGGGG + Intergenic
1145083694 17:19917337-19917359 CTTCTGTCCATAAGGATAATGGG - Intronic
1146727537 17:35168444-35168466 CTGCTGTCCTTGAGGAGACCAGG + Intronic
1146956573 17:36939549-36939571 ATCCAGTCCTTGAGGAAAACCGG - Intronic
1147052053 17:37802664-37802686 CTTGTCTCTTTGAGGGAAAGAGG - Intergenic
1147231634 17:39023626-39023648 CTCCTGCCATTGAGGATAAGTGG + Intergenic
1147626717 17:41905086-41905108 CTTCTTTCCTTGAGCCAGAGAGG - Intronic
1148543908 17:48502424-48502446 TTTCTCTCCTGGGGGAAAAGAGG - Intergenic
1148712607 17:49692747-49692769 CTCCTTTCCTTTAGCAAAAGAGG + Intergenic
1148783569 17:50134678-50134700 CATGTGTCCTTCGGGAAAAGGGG - Exonic
1149569680 17:57663503-57663525 CTTCTGACCTTGGGGAGAAGAGG + Intronic
1150011240 17:61506121-61506143 CTGGTATCCTTGAGGAAAGGGGG - Intergenic
1150864212 17:68832698-68832720 CTCCTCTCCTTGAGGAATTGGGG + Intergenic
1153852103 18:9104536-9104558 CTTTTGTTTTTGAGGCAAAGGGG + Intronic
1154428663 18:14291673-14291695 GTTAAGTCCTTGAGGAAGAGGGG + Intergenic
1156001650 18:32391557-32391579 TTTCTGTCTTTGTGGAAAACTGG - Intronic
1156013147 18:32516908-32516930 ATTCTGTACTTATGGAAAAGTGG + Intergenic
1157318642 18:46617118-46617140 TTTCTGTACTTGAGGGAGAGGGG + Intronic
1157799014 18:50603297-50603319 CTTCTGTCCCAGAGTCAAAGTGG + Intronic
1158165115 18:54531560-54531582 GTTAACTCCTTGAGGAAAAGGGG + Intergenic
1158914674 18:62111151-62111173 CATGTGTCCTTGTGGAAAACAGG + Intronic
1161614311 19:5261405-5261427 CTTCTTACCAAGAGGAAAAGAGG + Intronic
1161778758 19:6278278-6278300 CTTCTGGGCTTGAGGAAGAGGGG + Intronic
1161837290 19:6656521-6656543 CTTAAGTCCTTGAGGAAGGGGGG + Intergenic
1161838125 19:6661602-6661624 CTTAAGTCCTTGAGGAAGGGGGG + Intronic
1162457753 19:10796223-10796245 CTCCTGACCTTGTGGAAACGGGG + Intronic
1166995678 19:46718651-46718673 CATCTGCCCTTCAGGAAAAAGGG - Intergenic
1202671523 1_KI270709v1_random:59050-59072 CATACGTCCTTGAGGTAAAGAGG - Intergenic
926197451 2:10772441-10772463 CTTCAGGCCTTCAGGAAAAGGGG + Intronic
926856170 2:17258421-17258443 CGTCTGTCCTCTAGGACAAGTGG + Intergenic
926950143 2:18233664-18233686 CTTATTTCCTTGATGAACAGTGG + Intronic
928727742 2:34194230-34194252 CTTCTGTCCTGAAGGACCAGAGG + Intergenic
929407216 2:41656551-41656573 CTGCTGTCCTTGCGATAAAGAGG + Intergenic
930023312 2:47014463-47014485 TTCCAGTCCTTGAGAAAAAGGGG - Intronic
933905635 2:86889848-86889870 TTTCTATCCGTGAGGAAATGTGG + Intergenic
934667259 2:96181158-96181180 CTACTGTTCTAGATGAAAAGTGG + Intergenic
935881574 2:107570895-107570917 CTTCTGTCCTTGTGGAGTTGGGG + Intergenic
937438987 2:121901235-121901257 TGTCACTCCTTGAGGAAAAGCGG + Intergenic
938756664 2:134386780-134386802 ATTCTGTTCATAAGGAAAAGGGG + Intronic
938943920 2:136193342-136193364 TGTCTGGCTTTGAGGAAAAGGGG - Intergenic
939260351 2:139800376-139800398 CTACTGTCTTTGAGGCAAAGTGG - Intergenic
939910934 2:147982136-147982158 CTTCTTTCTTAGAAGAAAAGTGG + Intronic
940849159 2:158671995-158672017 CTTGTGTGCTTGAGGAACAGAGG + Intronic
943837688 2:192534401-192534423 CATTAGTCCTTAAGGAAAAGCGG + Intergenic
945114300 2:206396125-206396147 CTTTTTTCCTTGAGGTTAAGTGG + Intergenic
945662319 2:212701730-212701752 CTTCTTTGCTGGAGAAAAAGAGG - Intergenic
946130206 2:217600777-217600799 CTACTGTCCTGGTGGAGAAGAGG + Intronic
946892545 2:224293161-224293183 CATCTGTCCTTGGCCAAAAGAGG + Intergenic
948467559 2:238159455-238159477 CTTCTGTCCCAAAAGAAAAGGGG - Intronic
948614237 2:239188094-239188116 CCTCTGGCCTTGAGGGAACGGGG - Intronic
948788154 2:240363789-240363811 CTGCTGTCCTTGGGGAGATGTGG - Intergenic
948793630 2:240391494-240391516 CCTCAGTCCTGGAGGAAGAGGGG - Intergenic
948841972 2:240655866-240655888 CGTCCGTCCTCGGGGAAAAGAGG - Intergenic
1168772530 20:424514-424536 GTTCTGCCCCTGGGGAAAAGGGG + Intronic
1172878421 20:38180767-38180789 CTTCTGTCCCTGATGAACGGTGG - Intergenic
1173212783 20:41049774-41049796 CTTCTGTCCTTAAGGAAGTTGGG - Intronic
1174978869 20:55368975-55368997 GTTCTGTCATTTAGGAAAACAGG - Intergenic
1176905317 21:14493373-14493395 CTATTGTCCTTGGGGAAAATGGG - Intronic
1178244687 21:30939016-30939038 CTTCTGTTCTTTAGGGATAGGGG - Intergenic
1179460365 21:41530702-41530724 CTGCTGTCAGTGAGGGAAAGGGG + Intronic
1180917418 22:19498924-19498946 CCTCTCTCCTTGAGGTGAAGAGG - Intronic
1182330567 22:29548764-29548786 CTTCTGACCATCAGGAAAACTGG + Intronic
1183049805 22:35251535-35251557 GCCCTGTCCTTGAGGAACAGGGG + Intergenic
1184277929 22:43420838-43420860 CTCCTGCCCTTGAGGAACATGGG - Intronic
1185180251 22:49355805-49355827 GTTCTGTCCTCCAAGAAAAGGGG - Intergenic
949450764 3:4182457-4182479 CTTTTTTCCTTAAGGCAAAGGGG - Intronic
950642224 3:14355779-14355801 CTTCTGCCCTTGAAAGAAAGTGG + Intergenic
951090925 3:18573255-18573277 GTTCTGCCCTTGAAGACAAGGGG + Intergenic
952337564 3:32417346-32417368 CTTCTTTCACTTAGGAAAAGGGG + Intronic
952917662 3:38261324-38261346 CTTCTGTCCTTGTGGAATTGGGG - Intergenic
953502960 3:43455501-43455523 CTTAAGTCCTTGAGGAATGGGGG + Intronic
954819211 3:53310584-53310606 CTTCTACCCTTGATGACAAGCGG - Intronic
955314874 3:57929483-57929505 TTTCTATTCTTGAGGAAAACTGG - Intergenic
956267832 3:67417708-67417730 TTTCTCTGCTGGAGGAAAAGGGG - Intronic
956987555 3:74719772-74719794 GTTCTGTCCTTTATTAAAAGTGG + Intergenic
958549955 3:95599584-95599606 TGGCTGTCTTTGAGGAAAAGGGG - Intergenic
959179014 3:102955017-102955039 CTTTTTTCCTGGAGGAAGAGAGG - Intergenic
959275747 3:104275607-104275629 AATCTGTCCTTTAGCAAAAGGGG - Intergenic
960162105 3:114361732-114361754 CTTCTGCATTTGAGGGAAAGTGG - Intronic
960292029 3:115897421-115897443 CTTCTCTCCATGAAGAGAAGAGG + Intronic
960431989 3:117580660-117580682 TTTCTGGCCTTGAGGTAATGAGG - Intergenic
960839415 3:121941118-121941140 CTTCTGTCATTGGAGAAAGGTGG - Exonic
963063347 3:141242439-141242461 TTTCTTTCCCTAAGGAAAAGAGG + Intronic
963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG + Intronic
963986919 3:151606932-151606954 ATACTGTCCCTGTGGAAAAGTGG - Intergenic
966254422 3:177900777-177900799 CCTCTATCCTAGAGTAAAAGTGG - Intergenic
966769083 3:183488247-183488269 CTCCTGTCCTAGAGGGAAGGTGG - Exonic
973938446 4:55876981-55877003 TTTCTGGCCTAGAGGAAATGAGG - Intronic
976025745 4:80686294-80686316 CTTATGTCTATGATGAAAAGAGG + Intronic
976926379 4:90502654-90502676 TTTTTTTCCTTGAGAAAAAGTGG - Intronic
982496487 4:156100145-156100167 ATTCTGTACATGAGGAAACGTGG + Intergenic
982752171 4:159175562-159175584 TTTATGTCCCTGACGAAAAGGGG - Intronic
982896218 4:160930793-160930815 CTTCTTTCCATGAGGTTAAGAGG + Intergenic
983111738 4:163758584-163758606 CTTCTGTCCTTCAGGGAAATTGG - Intronic
984899296 4:184570446-184570468 CTTCTGACCTGGAGGAAACTTGG + Intergenic
985341681 4:188961190-188961212 CTTCTGTCCCTGTGGAATTGGGG - Intergenic
1202758434 4_GL000008v2_random:86877-86899 TTAAAGTCCTTGAGGAAAAGGGG + Intergenic
985588481 5:752886-752908 CTTCTTTCCTGGATGAAGAGGGG - Intronic
985603152 5:845341-845363 CTTCTTTCCTGGATGAAGAGGGG - Intronic
985706452 5:1404076-1404098 TTTCTGAAATTGAGGAAAAGTGG - Intronic
986577968 5:9232083-9232105 CTTGTGTCCTTGAGACCAAGTGG - Intronic
987005730 5:13707391-13707413 CCTCTGTCCTTGCGATAAAGAGG + Intronic
988026932 5:25707279-25707301 ATTCCCTACTTGAGGAAAAGAGG - Intergenic
988526072 5:31988417-31988439 CTTCTGTCCTTGTGGAGATGGGG + Intronic
989111169 5:37907763-37907785 CTGCTGCCCTTGAGAAAATGTGG - Intergenic
989539636 5:42604122-42604144 CTTCTGTCCTTGTGGAGTTGGGG + Intronic
990308518 5:54517277-54517299 CTCCTCTCCTTGAGCAGAAGAGG + Intergenic
991095269 5:62733072-62733094 CTTCTGTTCTTGTGGACCAGTGG + Intergenic
991246529 5:64514167-64514189 CTACTGTCCTTGTAAAAAAGAGG - Intronic
992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG + Intergenic
992996686 5:82340749-82340771 TTCCTGTCATTGAGGAAAACAGG + Intronic
993476791 5:88376380-88376402 CTCCTCTCCTTGAGTATAAGTGG + Intergenic
995133943 5:108660306-108660328 CTTCTTTCTTTGCGGAAATGTGG + Intergenic
998024032 5:138798060-138798082 CCTCTGTCCTTTAGGAAACTTGG + Intronic
999572626 5:152937841-152937863 CTCTTGTCCTTGCTGAAAAGAGG - Intergenic
999936957 5:156497216-156497238 CTTCTGTTATTGAGGAAAGATGG + Intronic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1004256566 6:14069843-14069865 TTTGTATCTTTGAGGAAAAGAGG - Intergenic
1004270391 6:14190106-14190128 CTTCTGCTCTTTAGCAAAAGGGG - Intergenic
1004401163 6:15289937-15289959 CTTCTTTCCATGAAGACAAGTGG - Intronic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1008720604 6:54345626-54345648 CTCCTTTCCTTGATGAAATGGGG + Intronic
1009866010 6:69398654-69398676 CATCTCTCCATGAAGAAAAGTGG - Intergenic
1010713694 6:79204694-79204716 TTTATGCCCTTGATGAAAAGGGG - Intronic
1010760390 6:79715947-79715969 CTTTTGTCATTCAGGAAAATAGG - Intergenic
1011749179 6:90438309-90438331 CTCCTGTCCCTGAGGAGAGGTGG - Intergenic
1012168989 6:95994843-95994865 ATTCTGTCCTTCATGAAAAATGG - Intergenic
1014717990 6:124887924-124887946 CTTCTGTCCTTGTGATAAGGAGG + Intergenic
1015235880 6:130970753-130970775 CTTCTTTCCCCGAGGATAAGGGG - Intronic
1015581524 6:134730336-134730358 ATTCTGTCCTTGAGGAGGAGGGG + Intergenic
1016535230 6:145102759-145102781 TTTCTGTCCTTGATGAAGAGGGG - Intergenic
1018082058 6:160267616-160267638 ATTCAGTCCTAGAGGAAAATGGG - Intronic
1020032991 7:4945880-4945902 CCTCTGTCCTGGAGGAAAGAAGG - Intronic
1021508830 7:21413666-21413688 GCTGTGGCCTTGAGGAAAAGGGG - Intergenic
1023187796 7:37549622-37549644 CATCAGACCTTGAGGAAATGTGG - Intergenic
1023390012 7:39700657-39700679 CTTCAGCTCTTGATGAAAAGTGG + Intronic
1023618925 7:42049816-42049838 CCTCTGTGAATGAGGAAAAGCGG - Intronic
1024222719 7:47301117-47301139 CTTCTGAAGTTGAGGTAAAGAGG + Intronic
1024638861 7:51313682-51313704 CTTCTGTCCTTTATTAACAGAGG + Intronic
1024827588 7:53410082-53410104 ATGCTGTCCTTGAAGAAAATAGG - Intergenic
1025035858 7:55592160-55592182 CTACTGCCCTTGAGGACAATGGG - Intergenic
1028181542 7:87730467-87730489 CTCTTCTGCTTGAGGAAAAGGGG + Intronic
1031015569 7:116572584-116572606 CTTGTGTGTTTGAGGGAAAGTGG - Intergenic
1031774328 7:125888147-125888169 CTCCTGACCTTGAGGGAATGAGG - Intergenic
1032592603 7:133206026-133206048 CTTCTGTTTTAGAGGAAAAGTGG + Intergenic
1033820127 7:145125253-145125275 CTTTTGTCCAGGAGGGAAAGTGG + Intergenic
1034637199 7:152576821-152576843 CTCCTGCCCTTAAGGAAAAAGGG + Intergenic
1034831363 7:154310935-154310957 CCTCTGTCATTGAGAAAGAGAGG + Intronic
1034962706 7:155372599-155372621 CTTCTCTCCCTGGGGAGAAGCGG - Intergenic
1035126696 7:156613055-156613077 TTTCTGTCCTTGAGTTGAAGTGG + Intergenic
1035287870 7:157817565-157817587 CATCTGTCCTCAGGGAAAAGAGG + Intronic
1035329651 7:158087996-158088018 CTTCTTCCCCTGAGGAAAGGGGG + Intronic
1035329673 7:158088110-158088132 CTTCTTCCCCTGAGGAAAGGGGG + Intronic
1035329862 7:158089181-158089203 CTTCTTCCCCTGAGGAAAGGGGG + Intronic
1035329898 7:158089371-158089393 CTTCTTCCCCTGAGGAAAGGGGG + Intronic
1035329922 7:158089485-158089507 CTTCTTCCCCTGAGGAAAGGGGG + Intronic
1035329972 7:158089752-158089774 CTTCTTCCCCTGATGAAAAGGGG + Intronic
1036934134 8:12984535-12984557 CTTCTTTCCTGGGAGAAAAGAGG + Intronic
1037513919 8:19610818-19610840 CCTCTGTCCTTGAGACAAGGTGG + Intronic
1038239473 8:25795427-25795449 CATTTGTGTTTGAGGAAAAGAGG + Intergenic
1038998888 8:32957526-32957548 GTTCTGTTATTAAGGAAAAGGGG - Intergenic
1039269678 8:35867339-35867361 CTTGTGTCCTGGAGGCAAACTGG + Intergenic
1040812906 8:51476361-51476383 CTTCTGTCCTTTAGAGCAAGTGG - Intronic
1040908897 8:52498154-52498176 CTTCTCTCCTTGAACAAAAGGGG - Intergenic
1042052326 8:64724860-64724882 TGTCTGTCTTTGGGGAAAAGGGG - Intronic
1043475375 8:80600580-80600602 ATTTTGTCCTTGAGGAAACCAGG + Intergenic
1044078613 8:87856070-87856092 CCTCTGTTCTTGGGGAAAACAGG - Intergenic
1045372026 8:101533948-101533970 CTTCTATTCTAAAGGAAAAGGGG + Intronic
1046337441 8:112808450-112808472 GTTAAGTCCTTGAAGAAAAGTGG - Intronic
1048031141 8:130633561-130633583 CTGCTGCCCATCAGGAAAAGAGG - Intergenic
1048356563 8:133658511-133658533 TTTCTGTTTTTGAGGAAATGAGG + Intergenic
1050825636 9:9941683-9941705 GATCTGTCCTTTGGGAAAAGAGG - Intronic
1052047122 9:23806970-23806992 CTTCTGCACCTAAGGAAAAGGGG + Intronic
1052201073 9:25781020-25781042 CTTCTGTACTGAAGGAAAAGGGG - Intergenic
1055914959 9:81391516-81391538 CCACTGTCCTTTAGGGAAAGGGG + Intergenic
1056552951 9:87666066-87666088 CTTCTGTCTGAGAGGGAAAGGGG - Intronic
1056896657 9:90557224-90557246 CTTCTCTCCTTGAGTAAATATGG + Intergenic
1057200611 9:93137814-93137836 CCTCTGTCCTTCTGGAAATGGGG - Intergenic
1057791939 9:98130437-98130459 CTTCTGTCTTAGAGGAAAAAGGG - Intronic
1058285955 9:103178419-103178441 CTTATGTCTATGAGCAAAAGAGG - Intergenic
1059142878 9:111870666-111870688 CTTCTGTCCTTGCGGAGTTGAGG - Intergenic
1060944490 9:127561916-127561938 CTTCTGTGCTGGAGGAAGAAGGG - Intronic
1062059664 9:134488309-134488331 CCTCTGTCCTGGAGGAAATAAGG - Intergenic
1187236923 X:17476309-17476331 CTACTTTCCAGGAGGAAAAGGGG - Intronic
1187368394 X:18683388-18683410 CTTGTCTTATTGAGGAAAAGAGG - Intronic
1188793583 X:34435484-34435506 CTTCTGTCTTTCAACAAAAGAGG + Intergenic
1193016441 X:76738981-76739003 CTTCTGTCTTTGGAGAAAGGAGG + Intergenic
1193803665 X:85968679-85968701 CTTCTAAACATGAGGAAAAGGGG - Intronic
1195458295 X:105094441-105094463 ATTCTTTCCTTGAGTAATAGTGG + Intronic
1196250647 X:113456173-113456195 AGTCAGTCCTGGAGGAAAAGAGG - Intergenic
1197111290 X:122778246-122778268 ATTCCGTCCTAGGGGAAAAGAGG - Intergenic
1197891462 X:131274379-131274401 CTCCTTTCCTTGGGGAAAAGAGG + Intronic
1198839301 X:140839737-140839759 ATTCTGTCCATGAGGAGAAAGGG - Intergenic
1200924969 Y:8646163-8646185 CTTGTGCCATTAAGGAAAAGTGG - Intergenic
1202338334 Y:23833124-23833146 TTAAAGTCCTTGAGGAAAAGGGG - Intergenic
1202532432 Y:25836947-25836969 TTAAAGTCCTTGAGGAAAAGGGG + Intergenic