ID: 1128290759

View in Genome Browser
Species Human (GRCh38)
Location 15:66476705-66476727
Sequence CCATGGCAGGCTCTGTGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 547}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128290759 Original CRISPR CCATGGCAGGCTCTGTGCAG GGG Intronic
900823869 1:4910910-4910932 GCCTGGCAGGCTCTGTCCTGTGG + Intergenic
900846201 1:5103552-5103574 TCATTGCAGGCTGCGTGCAGTGG + Intergenic
900964876 1:5950956-5950978 CCGTGGGAGGCTGTCTGCAGTGG - Intronic
901606327 1:10462143-10462165 CCATGGCAGGCTGGGCGCGGTGG - Intronic
902159690 1:14519997-14520019 CTATGGCACGATCTGTGCAATGG - Intergenic
902569645 1:17338931-17338953 GCATGTCAGGCACTGTACAGAGG - Intronic
902706029 1:18205211-18205233 CCATGGCTTTCTCTGTGTAGTGG + Intronic
902751465 1:18514591-18514613 ACATGGGAGGCTCTGTGAACTGG + Intergenic
902936947 1:19771443-19771465 TCATGGCAGGCCTGGTGCAGTGG - Exonic
902961162 1:19963640-19963662 GCATGGCTGGCTCTGTTCTGGGG + Intergenic
902980484 1:20119303-20119325 CCACTGAAGGCTCTTTGCAGAGG + Intronic
903127963 1:21260559-21260581 GCTTGCCAGGCTCTGTCCAGGGG - Intronic
903944764 1:26955143-26955165 CCATAGTAGGCTGGGTGCAGTGG - Intronic
903971327 1:27120797-27120819 TGATGCAAGGCTCTGTGCAGGGG + Intronic
904402387 1:30265381-30265403 CCGTGGCAGGCCCTGAGGAGTGG - Intergenic
905172720 1:36118610-36118632 CAGCGGCAGGCTCTGTGCAAAGG - Intronic
905568501 1:38985240-38985262 CCATTGCAGGCTAGGTGCAGTGG - Intergenic
905708462 1:40080540-40080562 CCAGGGCATGCTCAGTGCAAAGG + Intronic
906157950 1:43625184-43625206 CCCAGGCAGGCTCTGCGCTGAGG + Intergenic
906376716 1:45302560-45302582 CCATGGTAGGCTGGGCGCAGTGG + Intronic
906747568 1:48232410-48232432 CCAAGGGAGGCTCCGTGCTGGGG + Exonic
907354398 1:53860610-53860632 CTGTGCCAGGCCCTGTGCAGGGG - Intronic
907526641 1:55057592-55057614 CAGTGCCAGGCTCTGTGCAGGGG + Intronic
907754681 1:57300103-57300125 ACATGGAAGGCTCTGTGCAGGGG - Intronic
909873975 1:80779585-80779607 CAAGGGCAGTCTCAGTGCAGTGG - Intergenic
911025647 1:93433759-93433781 GCATGCCTGGCTGTGTGCAGTGG - Intergenic
911563666 1:99436301-99436323 CCAGGGCAGAGGCTGTGCAGAGG + Intergenic
912745412 1:112241733-112241755 CCACTTCAGGCTCTGTGCATAGG - Intergenic
913272207 1:117105428-117105450 CCATTGCAGGCCCAGCGCAGTGG + Exonic
913396510 1:118377748-118377770 CCACATCAGGCACTGTGCAGTGG + Intergenic
915441089 1:155945953-155945975 CCAGGGCTGGCTGGGTGCAGTGG - Intergenic
915733744 1:158071757-158071779 CCAGGGCAGGCTCTGCTCTGTGG + Intronic
918118546 1:181517421-181517443 CCACGGAAGGCTTTGAGCAGGGG + Intronic
919454055 1:197801852-197801874 GCATGCCTGGCTATGTGCAGTGG + Intergenic
919666471 1:200297514-200297536 ACATGGCAGGCCGGGTGCAGTGG - Intergenic
920457784 1:206114285-206114307 CCTAGGCAGGCCCTGTGCACAGG - Intronic
921000272 1:211036938-211036960 CAATGCCAGGCTTTGTCCAGAGG + Intronic
923251579 1:232183512-232183534 CCATGACAGGTTCTGCACAGGGG + Intergenic
923895194 1:238261900-238261922 CCAGGGGAGGCTGGGTGCAGTGG + Intergenic
923917843 1:238529467-238529489 GCATGCCTGGCTGTGTGCAGTGG - Intergenic
924225338 1:241917299-241917321 CCATGTGAGGCACTGTGCTGGGG - Intergenic
924295374 1:242581716-242581738 ACATGGAAAGCTCTTTGCAGTGG - Intergenic
1063240564 10:4165349-4165371 CCATGGAAGTCTCTGTGCTCTGG + Intergenic
1063665274 10:8056949-8056971 TCAAGGCAGGCTCTGAGTAGGGG - Intronic
1063977417 10:11428538-11428560 CCATGGCAGGCTGGGTGCGGTGG - Intergenic
1064457841 10:15505157-15505179 ACATGGCATGCTCTGGCCAGTGG - Intergenic
1064604645 10:17026170-17026192 CCACAGCAGGATCTGTGGAGAGG + Intronic
1066358483 10:34707780-34707802 CAACTCCAGGCTCTGTGCAGGGG + Intronic
1066457926 10:35587766-35587788 ACATGGCTGGCTGGGTGCAGTGG - Intergenic
1067188470 10:44050063-44050085 CCACAGCAGACTCTGTGCTGGGG + Intergenic
1067526196 10:47040173-47040195 CCATGGCAGGGCCTGTGCTCTGG + Intergenic
1068907791 10:62345748-62345770 CCATAGCAGGCCAGGTGCAGTGG + Intergenic
1068936136 10:62637415-62637437 TTATGGCAGGATCTGTGCACAGG - Intronic
1068938555 10:62658655-62658677 GCATGCCTGGCTGTGTGCAGTGG + Intronic
1069121931 10:64577685-64577707 GCATGTCTGGCTGTGTGCAGTGG + Intergenic
1069561649 10:69435161-69435183 GCATGCCTGGCTGTGTGCAGTGG - Intergenic
1069697671 10:70398871-70398893 CCATGGTAGGCTCTGGGGATGGG + Intergenic
1069798710 10:71069327-71069349 GCAGGGCAGGCACTGTCCAGGGG - Intergenic
1070114124 10:73512424-73512446 ACATGACAGGCTGGGTGCAGTGG - Intronic
1070390117 10:75962572-75962594 TCATGGCAGGCCATGTGCATGGG - Intronic
1070960792 10:80498904-80498926 CCAGGGCCGGCTTTGTTCAGGGG + Intronic
1071326484 10:84523733-84523755 CCAGGTCAGGCTCTGTGCACAGG + Intergenic
1071338394 10:84620891-84620913 CCATTGGGGACTCTGTGCAGGGG - Intergenic
1071469871 10:85976443-85976465 CCATGTCTGGCTCTCTCCAGAGG + Intronic
1071514406 10:86287638-86287660 TCAGGGAAGGCTCTGTGGAGGGG - Intronic
1071570380 10:86693386-86693408 CTGTGGCAGCCTCTGTGCAAGGG + Intronic
1072977264 10:100069512-100069534 CCATGGAGGGCTCTATGCTGAGG + Intronic
1074284798 10:112088190-112088212 CCAAGGGAGGCACTCTGCAGGGG - Intergenic
1074431750 10:113400684-113400706 CCATGGTAGGCTTTGGGGAGGGG - Intergenic
1075021082 10:118952939-118952961 GCCTGGCAGGTTCTGTGCACTGG - Intergenic
1075344582 10:121672919-121672941 CCATGGGAGGCGCTGTGGTGGGG + Intergenic
1075615385 10:123887180-123887202 CCATGGAAGCCTGTGAGCAGAGG + Intronic
1075654208 10:124150735-124150757 CCAGGGAAGGCTCCGGGCAGAGG + Intergenic
1075744267 10:124715613-124715635 CGTGGGCAGGCTCTGTGCTGAGG - Intronic
1075762219 10:124865544-124865566 CAATGGCTGGCTGGGTGCAGTGG - Intergenic
1076259070 10:129051277-129051299 GCATGACAGCCTCAGTGCAGAGG + Intergenic
1077170392 11:1163510-1163532 GCAAGGCAGGCTCAGTGCTGGGG + Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077362747 11:2147925-2147947 CCTTGTCAGGATCTGGGCAGCGG + Intronic
1077474501 11:2779973-2779995 CCCTGTCAGGCTCTGAGCCGGGG + Intronic
1077974860 11:7237515-7237537 ACATGGAAGGCTCTGTGAAAAGG + Intergenic
1078006264 11:7534797-7534819 CTCTGGCAGGCATTGTGCAGTGG + Intronic
1079043670 11:17081008-17081030 CTATGGCAGGCCGGGTGCAGTGG - Intronic
1080371993 11:31659698-31659720 CCATTATAGGCTCAGTGCAGTGG + Intronic
1081077384 11:38693660-38693682 CCATGGCAGTTTTGGTGCAGAGG - Intergenic
1081737550 11:45414491-45414513 AAATGCCAGGCTCTGTGCTGAGG + Intergenic
1083175702 11:60948806-60948828 CCACGGGAGGCTCTGCTCAGTGG + Intronic
1083224109 11:61273861-61273883 CCCTGGGAAGCTCTGGGCAGTGG - Intronic
1083310763 11:61782510-61782532 CTGTGGCTGGCTCTGTACAGGGG + Intronic
1083652013 11:64209356-64209378 CCAGGGCAGGGTCTGGGCCGAGG + Intronic
1084085067 11:66851267-66851289 CCCTTGCAGGTTCTGTGAAGTGG - Exonic
1084191988 11:67503623-67503645 CCAGGGCAGGCCCTCAGCAGTGG - Intronic
1084393917 11:68896616-68896638 GTATGGCAGGCTCTTTGCCGTGG - Exonic
1084715993 11:70873703-70873725 CAATGGCTGGCTGTGAGCAGGGG - Intronic
1084757324 11:71248087-71248109 CCAGGGCAGGCTCTGGGTAGTGG + Intronic
1085374276 11:76044343-76044365 CCATGTCAGGCTCTGTGTGCTGG - Intronic
1085526109 11:77165249-77165271 CTATGTCCTGCTCTGTGCAGTGG + Intronic
1085769585 11:79312868-79312890 GCAGGGAAGGCTCTGTGGAGTGG - Intronic
1088150070 11:106734328-106734350 CCAAGGCAGGCTAAGGGCAGAGG - Intronic
1088906090 11:114156496-114156518 CCACAGCAGGCTCTGAGGAGGGG - Intronic
1089241627 11:117086402-117086424 CAATGGTAGGCTGGGTGCAGTGG + Intronic
1089330323 11:117684953-117684975 CCATGACAGGCTCAGAGCACCGG - Intronic
1089337921 11:117737850-117737872 GCATGGCAGGCTCTGGGGACTGG + Intronic
1090410883 11:126508853-126508875 CTATGACAGGCACTGTGCTGAGG - Intronic
1090765533 11:129873040-129873062 CTACGGCAGCCACTGTGCAGCGG - Exonic
1091322944 11:134664624-134664646 CCAGCTGAGGCTCTGTGCAGGGG + Intergenic
1091660487 12:2379697-2379719 TCATGGCAGGCTCTCTGTAATGG - Intronic
1091845104 12:3649712-3649734 CCATGCCAGGCACTGTGTTGAGG - Intronic
1092275724 12:7059670-7059692 TCAGGGAAGGCTCTGTGGAGTGG + Intronic
1093215919 12:16361165-16361187 ACATGGCTGGCTATGTGCTGAGG + Intronic
1093455126 12:19357531-19357553 GCAGGGCAGGCTGGGTGCAGTGG - Intronic
1093525585 12:20101361-20101383 GCATGCCTGGCTGTGTGCAGTGG - Intergenic
1094216816 12:27951336-27951358 CAATTGCTGGCTGTGTGCAGTGG - Intergenic
1097450586 12:59733340-59733362 GCATGCCTGGCTGTGTGCAGTGG - Intronic
1098290709 12:68955001-68955023 GCATGCCTGGCTGTGTGCAGTGG + Intronic
1098399026 12:70053513-70053535 CAATGACAGGCTCTGAGAAGAGG - Intergenic
1099295529 12:80823502-80823524 GCATGCCTGGCTCTGTGCAGTGG + Intronic
1100135130 12:91544846-91544868 CCCCTGCAGGCTCTGTCCAGGGG - Intergenic
1100585105 12:95972211-95972233 CCATCACAGGCTGGGTGCAGTGG - Intergenic
1100616866 12:96237572-96237594 CCATGCCAGGCTCTGAGGAATGG - Intronic
1101157394 12:101940635-101940657 ACGTGGGAGGCTCTGTGTAGGGG - Intronic
1102151157 12:110689584-110689606 GCATGGCAGAAACTGTGCAGGGG - Intronic
1102762582 12:115401354-115401376 CTCTGGCAGGCACTGTGCTGGGG - Intergenic
1104028022 12:125043383-125043405 TCATAGCAGGAACTGTGCAGCGG - Intergenic
1104133077 12:125913407-125913429 ACATGGAGGGCTCTGTGCAAAGG - Intergenic
1104904207 12:132204864-132204886 GCATGGCAGGCTCAGGGCTGAGG - Intronic
1105837713 13:24225246-24225268 ACATGCCTGGCTGTGTGCAGAGG - Intronic
1105944507 13:25177839-25177861 CCATGGCAGGGCCAGTGGAGGGG - Intergenic
1107017800 13:35721599-35721621 CAAAGCCAGGCTCTGTGGAGGGG + Intergenic
1108380125 13:49847202-49847224 TCATGCAAGGCTCTGTGCTGTGG - Intergenic
1108559242 13:51626993-51627015 GCATGCCTGGCTGTGTGCAGTGG - Intronic
1108608342 13:52062704-52062726 TCATAGCAGGCTGGGTGCAGTGG - Intronic
1110178596 13:72587761-72587783 CCACTGCAGGCTGTGTGCAAAGG + Intergenic
1110439014 13:75507285-75507307 GCATGCCTGGCTGTGTGCAGTGG - Intergenic
1112611304 13:100957348-100957370 CAATGGCATGCACTGAGCAGAGG - Intergenic
1113104770 13:106760098-106760120 ACATGCCAGGCTCTGAGCTGAGG - Intergenic
1113533115 13:111043768-111043790 CCAGGGGAGGGTGTGTGCAGAGG - Intergenic
1113692673 13:112322769-112322791 CCATGGCATGCCCTGTGCTGGGG + Intergenic
1114503641 14:23191064-23191086 CCATCGCAGGCTGCGCGCAGTGG + Intronic
1114540643 14:23455251-23455273 TAATGGCAGGCTGGGTGCAGTGG + Intergenic
1115393774 14:32883314-32883336 CCATACCAGGCTGGGTGCAGTGG - Intergenic
1116981271 14:51173725-51173747 GTATGGGAGGCTCTTTGCAGAGG - Intergenic
1117700851 14:58411822-58411844 CCATGTCAGGCTGGGTGCAGTGG - Intronic
1119257039 14:73207847-73207869 GCATGCCTGGCTGTGTGCAGTGG - Intronic
1119446843 14:74672037-74672059 CTATGCCAGTGTCTGTGCAGTGG + Intronic
1119852080 14:77873369-77873391 CCATGGGAGGCCCTGTTCAAGGG + Intronic
1122978045 14:105179036-105179058 ACATGGCAGGCTGTGGGCAGGGG - Intronic
1123018760 14:105387771-105387793 CCATGGCTGGCTCGGTGGGGGGG + Intronic
1124494580 15:30178581-30178603 CTAAGTCAGGCTCTGTGGAGAGG - Intergenic
1124748990 15:32360064-32360086 CTAAGTCAGGCTCTGTGGAGAGG + Intergenic
1125561739 15:40639078-40639100 AAATGGCAGGCTGGGTGCAGAGG - Intronic
1125579086 15:40773245-40773267 CCCTGGCAGGCTGGGCGCAGTGG - Intronic
1127403009 15:58610477-58610499 CCAGTACAGGGTCTGTGCAGTGG - Exonic
1128290759 15:66476705-66476727 CCATGGCAGGCTCTGTGCAGGGG + Intronic
1129136375 15:73555930-73555952 CCATGGCAGCCTACATGCAGTGG - Intronic
1129188412 15:73924131-73924153 ACATGTCTGGCTCTGTGCTGGGG + Intergenic
1129297942 15:74610103-74610125 GCATGGCAGGCCCTGCGCACTGG - Intronic
1129332379 15:74834251-74834273 CCAGGGCTGGCTCTGTGCTTGGG + Intergenic
1129600838 15:76997072-76997094 CCATGGCAGGATCTGGGCACAGG + Intronic
1129787175 15:78317174-78317196 CAATGGCAGGAGCTGTGCCGAGG + Intergenic
1130152080 15:81318929-81318951 GAATGGCAGGGGCTGTGCAGAGG + Intronic
1130938823 15:88491203-88491225 GCATGGCAGTCACTGTGCTGGGG + Intergenic
1130969364 15:88720155-88720177 GCATGCCAGGCTCTGTGCTATGG + Intergenic
1131553845 15:93379937-93379959 CCATGGCTGGCCAGGTGCAGTGG + Intergenic
1131960870 15:97789032-97789054 CTATGCCAGGCTTTGTGCTGAGG - Intergenic
1132394505 15:101462961-101462983 CCTGGGAAGGCTTTGTGCAGAGG + Intronic
1132394685 15:101464130-101464152 CCTGGGAAGGCTTTGTGCAGAGG - Intronic
1132551517 16:555695-555717 ACCTGGCAGGGTCTGTGCTGTGG - Intergenic
1132750739 16:1456278-1456300 CCAGGACAGGGGCTGTGCAGGGG + Intronic
1133035871 16:3033966-3033988 CCAGGTCAGGCTCAGGGCAGTGG + Intronic
1133893958 16:9907931-9907953 ACATGCCAGACACTGTGCAGGGG - Intronic
1134064643 16:11220011-11220033 CAGTGGCAGGCTGGGTGCAGTGG - Intergenic
1135760596 16:25134999-25135021 CAATGGCAGGATCTCTCCAGCGG - Intronic
1135862204 16:26066943-26066965 CATTGGCAGGGTCTGTGCTGTGG + Intronic
1136108822 16:28051846-28051868 CCATTGGAGGGTCTGAGCAGAGG + Intronic
1136136534 16:28259747-28259769 CCATGGAGGGCTCTGAGCAGGGG - Intergenic
1136374490 16:29857263-29857285 GCATGCCAGACTCTGTGCTGCGG - Intergenic
1137518558 16:49172038-49172060 CCACAGCAGGCTCTGGCCAGGGG + Intergenic
1138112029 16:54331286-54331308 CCAGGCCTGGCTCTGTGCACAGG + Intergenic
1138597376 16:58036215-58036237 CCATGGGAGGCAGTGAGCAGAGG - Intronic
1139200841 16:64975318-64975340 TCATGGAAGGCTTTGAGCAGAGG + Intronic
1140041646 16:71412266-71412288 TGACGGCAGGCTCTGTGCATGGG + Intergenic
1140554216 16:75901962-75901984 CCATCGCAGTCTCTGTACAGTGG + Intergenic
1141511165 16:84513099-84513121 CCATGCCAGGCCAGGTGCAGTGG - Intronic
1141678235 16:85528994-85529016 CCATGGAGGGTTCTGGGCAGAGG + Intergenic
1141726634 16:85793603-85793625 CCAGGGCAGCCGCCGTGCAGAGG + Intronic
1141847546 16:86621315-86621337 CAATGGCAGGCCGGGTGCAGTGG - Intergenic
1141932281 16:87213987-87214009 CCATGGAAGGCTGTGGGCTGTGG + Intronic
1142419619 16:89962212-89962234 CCACGGGAGGTTCTGAGCAGAGG + Intronic
1143378195 17:6479583-6479605 GAAGGGCAGGCTCTGGGCAGGGG - Intronic
1143749440 17:9017729-9017751 GCATGTCAGGCTCTAAGCAGCGG - Intergenic
1144643318 17:16951599-16951621 ACAAGGCAGGCTGGGTGCAGTGG + Intronic
1144654262 17:17025296-17025318 CCATGGCTGGCTCTGTTAAGGGG + Intergenic
1144790334 17:17854819-17854841 GCATGTCAGGCTGGGTGCAGTGG - Intronic
1145893104 17:28432537-28432559 CCATGCCCAGCTCTTTGCAGAGG + Intergenic
1146031861 17:29373088-29373110 GCATGGCAGGCTGGGTGCGGTGG - Intergenic
1147895154 17:43745693-43745715 CAATGCCGGGCTCTGTGCAAAGG + Intergenic
1148586778 17:48786641-48786663 CCATGGCAGGTGCTGGGGAGAGG + Intronic
1148973472 17:51505556-51505578 TCCTGGCAGTCTGTGTGCAGTGG + Intergenic
1149125777 17:53229963-53229985 GTATGTCAGGCTTTGTGCAGTGG - Intergenic
1149190461 17:54055423-54055445 CCATCACTGGCTCTGTGCAAGGG - Intergenic
1149276873 17:55050952-55050974 CCATTTCAGGCCCGGTGCAGTGG - Intronic
1150298465 17:64028379-64028401 CAATGACAGGCTCAGAGCAGAGG + Intergenic
1150343262 17:64385752-64385774 GCCTGGCAGGCTCAGTTCAGTGG - Intronic
1151217156 17:72584937-72584959 GTATGGCAGGCTGAGTGCAGTGG + Intergenic
1151434798 17:74088414-74088436 CAGAGGCAGGCTGTGTGCAGAGG - Intergenic
1151686334 17:75648981-75649003 CCATGGCCGGCTCTGGGACGGGG + Intronic
1152263960 17:79282649-79282671 CCATAAGAGGCACTGTGCAGGGG + Intronic
1152631892 17:81414199-81414221 CCATGGCAGGACCTGTGCTGGGG + Intronic
1152811298 17:82384041-82384063 CCCTGGAAGGCCCTGGGCAGTGG + Intergenic
1152989965 18:354280-354302 CCCAGACAGGGTCTGTGCAGTGG - Intronic
1153680463 18:7495697-7495719 CCATTGCAGGCTGGGTGCAGTGG - Intergenic
1153917116 18:9755851-9755873 ACATTGCAGCCTCTGAGCAGAGG - Intronic
1154016855 18:10626683-10626705 CTATCGCAGGCTCTGGGCTGTGG - Intergenic
1154170258 18:12046333-12046355 CCATGGCAGGGGCAGTGCTGCGG - Intergenic
1154188658 18:12208982-12209004 CTATCGCAGGCTCTGGGCTGTGG + Intergenic
1157243382 18:46032464-46032486 CCATGACAGGCTGGGTGCCGTGG + Intronic
1157298862 18:46465402-46465424 CCATGGCAGGAAGTGGGCAGAGG - Intergenic
1157423546 18:47565776-47565798 ACATGGCAGCCTCAGAGCAGTGG + Intergenic
1157534404 18:48447934-48447956 CATTGGAAGGCTCTGAGCAGAGG - Intergenic
1157814093 18:50718503-50718525 TCTTGGCAGGCTGGGTGCAGTGG - Intronic
1157881450 18:51324850-51324872 CCATGCCTGCCTTTGTGCAGAGG + Intergenic
1158585273 18:58727584-58727606 CTTTGGCAGGCTGGGTGCAGTGG - Intronic
1160474058 18:79166923-79166945 GCATGCCTGGCTGTGTGCAGTGG - Intronic
1161226125 19:3146808-3146830 CCATGGAGGGCTGTGGGCAGAGG - Intronic
1161262451 19:3345400-3345422 CCATGGAAGGCTGCGGGCAGAGG - Intergenic
1161289435 19:3485123-3485145 CCATGGAGGGCTGTGGGCAGAGG + Intergenic
1161480112 19:4506160-4506182 CCCTGGAGGGCTCTGGGCAGAGG - Intronic
1161482905 19:4519592-4519614 CCATGGGTGGCTCTGGGCACTGG + Intergenic
1161541047 19:4851741-4851763 CCATGGAGGGCTGTGGGCAGAGG + Intronic
1161599197 19:5170537-5170559 CCATGGAGGGCTGTGGGCAGAGG + Intronic
1161605626 19:5213279-5213301 CCATGGAGGGCTGTGGGCAGAGG - Intronic
1161619175 19:5289468-5289490 CCATGGAGGGCTGTGGGCAGAGG - Intronic
1161621391 19:5299160-5299182 CCATGGAGGGCTGTGGGCAGAGG - Intronic
1161661142 19:5547017-5547039 CCATGGAGGGCTCTGGACAGAGG + Intergenic
1161739469 19:6011787-6011809 ACACGGGTGGCTCTGTGCAGAGG + Intronic
1161994054 19:7701718-7701740 CCATGGAAGACTCTAGGCAGAGG - Intronic
1161994183 19:7702416-7702438 CCACGGAAGGCTCTAGGCAGAGG + Intergenic
1162026664 19:7898167-7898189 CTCTGTCAGGCTGTGTGCAGTGG - Intronic
1162304466 19:9863340-9863362 CCATGGAGGGTTCTGTGCAGAGG + Intronic
1162400740 19:10445112-10445134 CCATCGAAGGTTCTGAGCAGAGG + Intronic
1162457077 19:10791796-10791818 CCATTCCAGGCTGGGTGCAGTGG + Intronic
1162470488 19:10869958-10869980 CCATGCCAGGGTCTCTGCAACGG + Intergenic
1162536358 19:11264834-11264856 CCATGGAAGGTTCTGAACAGAGG - Intergenic
1162871685 19:13591213-13591235 CCATGGAGGGTTCTGAGCAGAGG + Intronic
1162894573 19:13757606-13757628 CCATGGAAGCCCCTTTGCAGAGG + Intronic
1163419395 19:17205759-17205781 GCATGGCAGCCACTGGGCAGGGG - Intronic
1163500809 19:17675038-17675060 CCTTTGCAGGCTGGGTGCAGTGG + Intronic
1164694201 19:30231481-30231503 CCAGGGCAGGGTCTGGGCTGAGG + Intronic
1164703561 19:30303318-30303340 CCATGGCAGGCTCTATGTGATGG + Intronic
1164823099 19:31265107-31265129 CCATAGCCGGCTGGGTGCAGTGG + Intergenic
1165494994 19:36147419-36147441 CCATGGCAGGTTCTAGGCAGAGG + Intronic
1165707705 19:37988175-37988197 CCATGGGAGGTTCTGAGCAGGGG - Intronic
1165863607 19:38922498-38922520 CCATGCCAGGCTCTATGTACAGG + Intronic
1166673625 19:44725980-44726002 CCATGGCAGATTCTGACCAGGGG - Intergenic
1166673906 19:44727696-44727718 CCATGGAGGGTTCTGGGCAGGGG - Intergenic
1166689712 19:44815075-44815097 CCATGGCAGATTCTGAGCAGAGG - Intronic
1166703792 19:44897097-44897119 CCATGGCAGGTTCTGGGCAGGGG + Intronic
1166756632 19:45196475-45196497 CCTTGGCAGGCTCAGTGCTGTGG - Intronic
1166778455 19:45326623-45326645 CCATGGCAAGCTCTGAGGAGGGG - Intergenic
1166861303 19:45813061-45813083 CCATAGCAGGTTCTGAGCATTGG + Intronic
1166945625 19:46394256-46394278 CCATGGGAGGGTGTGGGCAGAGG - Intergenic
1167002374 19:46753623-46753645 CCATGGCAAGTTCAGAGCAGGGG + Intronic
1167043748 19:47038174-47038196 CTATGGCAGGTTCAGAGCAGGGG + Intronic
1167044452 19:47041431-47041453 CCACGGCAGGCTCTTACCAGGGG + Intronic
1167143446 19:47667908-47667930 CCCAGGCAGGCTCACTGCAGAGG - Intronic
1167233457 19:48299120-48299142 CCAGGACAGGCTGGGTGCAGTGG + Intronic
1167339665 19:48907724-48907746 CGGGGGCAGGCTCTGGGCAGAGG - Intronic
1167343006 19:48927215-48927237 ACACGGCAGGCTGGGTGCAGTGG + Intergenic
1167468492 19:49662745-49662767 CCATGGCTGGCTCTGTCCCCAGG - Intronic
1167556893 19:50202424-50202446 CCATGGAAGGCTCTGAACAGAGG + Intronic
1167566954 19:50262630-50262652 CCATGGAGGGCTGTGAGCAGGGG + Intronic
1167734294 19:51282477-51282499 ACCTGGCAGGTGCTGTGCAGAGG - Intergenic
1167850171 19:52195225-52195247 ACAGAGCAGGCTCTGTGCCGAGG + Intronic
1168571823 19:57476927-57476949 CCATGGAAGGTTCTGAACAGAGG - Intronic
1168622267 19:57888919-57888941 CCAGAGTAGCCTCTGTGCAGCGG + Exonic
925092234 2:1164786-1164808 TGTTGGCAGGCTCTGTGTAGAGG + Intronic
925171352 2:1752005-1752027 CCTTGGCACGCTGTGTGCGGAGG + Intergenic
926219594 2:10925844-10925866 CCATGGAAGGCTTTAGGCAGAGG - Intergenic
926684378 2:15687588-15687610 CCATGTAAGGGTCTTTGCAGAGG - Intergenic
926825559 2:16902154-16902176 CCATCACATGCTCTGTGAAGGGG + Intergenic
926834491 2:17002892-17002914 CAATGTCAGGTTCTGTGCAATGG + Intergenic
926861784 2:17317555-17317577 CCATGACAGGCTCTCCGGAGGGG + Intergenic
927496765 2:23556321-23556343 GACTGGCAGGCTCTGTGCACAGG + Intronic
927533729 2:23836186-23836208 GCATGCCAGACTGTGTGCAGTGG - Intronic
927588878 2:24335619-24335641 CCCTGGAAGGCTGGGTGCAGTGG - Intronic
928568314 2:32576420-32576442 TCATGGCAGAATCTGTTCAGTGG + Intronic
930188780 2:48436703-48436725 AGATGGAAGGCTCAGTGCAGTGG + Intergenic
930207390 2:48601773-48601795 CCCTGGAAGGCTTTGTGTAGAGG + Intronic
930240694 2:48932947-48932969 CCCTGGCAGTTTCTGAGCAGAGG + Intergenic
930316298 2:49800744-49800766 CCAGGGCAGGGTCATTGCAGTGG - Intergenic
930855411 2:56011286-56011308 TCAGGTCATGCTCTGTGCAGTGG + Intergenic
932317634 2:70796410-70796432 GCAAGGCAGGCTCCCTGCAGAGG - Intergenic
932717535 2:74112713-74112735 CCACAGCAGGCTGGGTGCAGTGG + Intergenic
932892960 2:75611862-75611884 GCAGGGCAGGCTGTGAGCAGAGG - Intergenic
933724640 2:85419498-85419520 CCAGGGCAGCCTCTTTCCAGAGG + Intronic
933748788 2:85589943-85589965 CCAAGGCAGGCTGGGCGCAGTGG - Intronic
934570705 2:95371054-95371076 CAATGACAGGCTGGGTGCAGTGG - Intronic
934682482 2:96294921-96294943 ACATGGCAGGCTAGGCGCAGTGG + Intronic
934780925 2:96969166-96969188 CCATGCCAGGCTCTGGATAGTGG - Intronic
935294966 2:101640823-101640845 CCAGAGCAGGGGCTGTGCAGAGG + Intergenic
936105426 2:109620126-109620148 ACATGCCAGGCACTGTGCAAGGG - Intergenic
936970705 2:118173785-118173807 CCATGGCAGGCACTGGAAAGGGG + Intergenic
936987143 2:118322191-118322213 CCATGCCATGCACTGTGCAAAGG + Intergenic
937236512 2:120434599-120434621 CCGGGGCAGCCTCTGTCCAGTGG - Intergenic
937375483 2:121333270-121333292 CCATGGGATGCTGTTTGCAGGGG + Intergenic
938342467 2:130544639-130544661 ACAGGGCAGGCATTGTGCAGGGG - Intronic
938347365 2:130576070-130576092 ACAGGGCAGGCATTGTGCAGGGG + Intronic
939413875 2:141866953-141866975 CCATGTCAGTATCTGTGGAGTGG + Intronic
941131185 2:161651746-161651768 GCATGCCTGGCTGTGTGCAGTGG + Intronic
941611032 2:167662655-167662677 CCATTGAAGGCTGTGAGCAGAGG - Intergenic
941771444 2:169349919-169349941 CCATGGGAGCTTCTGAGCAGAGG + Intronic
941843458 2:170111443-170111465 CAATGCCAGGCTCAGTGCAAGGG - Intergenic
942114226 2:172712499-172712521 GCATGCCTGGCTGTGTGCAGTGG - Intergenic
944040799 2:195351904-195351926 CCATGGCAGGCCGGGTGCAGTGG + Intergenic
944573395 2:201067995-201068017 CTATGACAGGCTGGGTGCAGTGG + Intronic
944737515 2:202581150-202581172 CCAATACAGGCTCAGTGCAGTGG - Intergenic
944971733 2:205001274-205001296 GCATTGCAGGCTGGGTGCAGTGG - Intronic
945184659 2:207127552-207127574 CCATGACAGGCCGGGTGCAGTGG + Intronic
946070657 2:217031946-217031968 CCACTCCAGGCTCTGTGCTGTGG - Intergenic
946131706 2:217611626-217611648 CAAAAGCAGGCTCTGTGTAGGGG + Intronic
946401414 2:219470394-219470416 TCATGGGAGGCTGTGGGCAGGGG - Intronic
946767996 2:223057903-223057925 CCATGGCAGCCTCTATTCACAGG + Intronic
946880853 2:224175937-224175959 CCATGCCAGGCTTTATGGAGGGG - Intergenic
947316580 2:228866023-228866045 CCATGGCAGGGCAGGTGCAGTGG - Intronic
948264493 2:236627092-236627114 CCATGGCAGCTCCTGTGCTGGGG - Intergenic
948618494 2:239217082-239217104 CCATGGCAGGCTGCGGGCACTGG + Intronic
948703014 2:239772516-239772538 CCATTCCTGGGTCTGTGCAGTGG - Intronic
948843956 2:240674406-240674428 TCCTGGAAGGATCTGTGCAGAGG + Intergenic
948849855 2:240700229-240700251 TCCTGGAAGGATCTGTGCAGAGG - Intergenic
948903871 2:240968758-240968780 ACATGCCAGGCTTTGTGCTGGGG + Intronic
1169087842 20:2838449-2838471 CCCTGGCAGGCTCCCTGCGGCGG - Exonic
1169122211 20:3103679-3103701 CCATGTCACCCTCTGTGGAGGGG - Intergenic
1169309452 20:4522442-4522464 GCATGCCTGGCTGTGTGCAGTGG + Intergenic
1169749486 20:8977114-8977136 CTATGTTAGGCTGTGTGCAGAGG + Intergenic
1170213674 20:13870465-13870487 CCATAGTAGGCACTGGGCAGAGG + Intronic
1170485915 20:16816336-16816358 CCATCGCAGGCCCTGTGAAGGGG - Intergenic
1170648356 20:18216502-18216524 CCAAAGCAGGCTTTGTACAGTGG + Intergenic
1172125359 20:32622328-32622350 CTATGGAGGGCTCTGAGCAGGGG + Intergenic
1172994981 20:39064136-39064158 CCATGCCTGGCCCTGTGCTGTGG + Intergenic
1173658834 20:44719211-44719233 GCATGCCAGGCCCTGTGCTGAGG + Intronic
1173972065 20:47160868-47160890 CCATCAGAGTCTCTGTGCAGAGG - Intronic
1174196074 20:48773788-48773810 CCATGGAGGGTTCTGAGCAGGGG + Intronic
1174363232 20:50041236-50041258 CCCTGGAGGGCTCTGAGCAGAGG - Intergenic
1174559659 20:51421606-51421628 CCAAGGCTGGCCCTGAGCAGAGG - Intronic
1174674925 20:52344576-52344598 CCATGGGAGGCTTTGAGAAGAGG + Intergenic
1174847142 20:53953521-53953543 CCGTGGCCTGCTCTGTGCACTGG + Exonic
1174932339 20:54829548-54829570 CCCAGGCAGGCTGTTTGCAGAGG - Intergenic
1175228326 20:57458352-57458374 CCTTGTCAGGCCCTGGGCAGTGG - Intergenic
1176244083 20:64089109-64089131 GCATGCCAGGGTCTGTGCTGGGG + Intronic
1177827777 21:26103319-26103341 CGATGGAAGGCTGGGTGCAGTGG + Intronic
1179514568 21:41897802-41897824 CCATGGCAGGCTGTGGGCTTTGG + Intronic
1179999806 21:44990364-44990386 TGGTGGCAGGCTCTGGGCAGAGG + Intergenic
1180070288 21:45432427-45432449 CCACTCCAGGCCCTGTGCAGAGG - Intronic
1181625134 22:24118082-24118104 CCATGGTAGGCTCTGGGCCTGGG + Intronic
1181857974 22:25796295-25796317 CTTTGGCAGGCTGGGTGCAGTGG + Intronic
1182368834 22:29796889-29796911 CCATCCCTGGTTCTGTGCAGTGG + Intronic
1182452411 22:30429327-30429349 CAATGCCAGGCTGAGTGCAGTGG - Intergenic
1183605251 22:38864052-38864074 GCATCGCAGGCACTGTGGAGAGG - Exonic
1183619101 22:38962288-38962310 CCAGAGGAGGCTCTGAGCAGAGG - Intronic
1183624301 22:38992224-38992246 CCAGAGGAGGCTCTGAGCAGAGG - Intronic
1183640054 22:39087201-39087223 CCAGAGGAGGCTCTGAGCAGAGG - Intronic
1183661860 22:39225904-39225926 CCATGGCAGGCCTTGGTCAGTGG - Intronic
1184094895 22:42311188-42311210 CTGCGGCAGGCTCTGGGCAGGGG + Intronic
1184098463 22:42329265-42329287 CCTTGGCAGCCTGTGTGCTGGGG - Intronic
1184119518 22:42441015-42441037 CCAGGCCAGGCTGTGGGCAGTGG - Intergenic
1184274112 22:43400479-43400501 CCATGGGAGTATCAGTGCAGGGG - Intergenic
1184480559 22:44744455-44744477 CAATGGGAGTATCTGTGCAGTGG - Intronic
1184480571 22:44744527-44744549 CAATGGGAGTATCTGTGCAGTGG - Intronic
1184480584 22:44744599-44744621 CCGTGGGAGCATCTGTGCAGTGG - Intronic
1184480595 22:44744654-44744676 CAATGGGAGTATCTGTGCAGTGG - Intronic
1184480608 22:44744726-44744748 CCGTGGGAGCATCTGTGCAGTGG - Intronic
1184480619 22:44744781-44744803 CAATGGGAGTATCTGTGCAGTGG - Intronic
1184480632 22:44744853-44744875 CCGTGGGAGCATCTGTGCAGTGG - Intronic
1184480643 22:44744908-44744930 CAATGGGAGTATCTGTGCAGTGG - Intronic
1184480656 22:44744980-44745002 CAATGGGAGTATCTGTGCAGTGG - Intronic
1184480692 22:44745195-44745217 CCGTGGGAGCATCTGTGCAGTGG - Intronic
1184621586 22:45683015-45683037 CCATGGAAGGTTCTGAGCAGAGG - Intronic
1184649179 22:45911824-45911846 CCCTGGGAGGCTCTCTGGAGCGG + Intergenic
1184820354 22:46905418-46905440 TCATGAAAGGCTCTGAGCAGAGG - Intronic
950670271 3:14521716-14521738 GCATGGCTGGCCCCGTGCAGCGG + Exonic
952736552 3:36697102-36697124 CCATGGCTGGCACTGTCCATAGG + Intergenic
952968176 3:38633792-38633814 CCTTGGGAGCCTCTCTGCAGGGG - Intronic
953660919 3:44890988-44891010 CGAAGGCAGCCTCTGTACAGTGG - Intronic
953748057 3:45590385-45590407 GCATGCCTGGCTGTGTGCAGTGG - Intronic
954143874 3:48624490-48624512 AGGTGCCAGGCTCTGTGCAGGGG - Intergenic
954368471 3:50158137-50158159 GAATGGCAGGCTCTGAGAAGTGG - Intronic
955200368 3:56846719-56846741 CCATGGCTGGGTCTGAGGAGGGG - Intronic
956736121 3:72239655-72239677 CCATTGCAGGGTTTGAGCAGAGG - Intergenic
957775750 3:84756117-84756139 CCATGCCTGGCTGTGTGCAGTGG - Intergenic
960754930 3:121001137-121001159 GCATGGCAGGGTCTGTGCATAGG + Intronic
961318325 3:126055791-126055813 CCATGGCGGTCTCCCTGCAGTGG - Intronic
961723560 3:128911343-128911365 CCTTGGCAGGCCCGGTGCGGTGG - Intronic
961826149 3:129600145-129600167 CCATCTCAGTCTCTGTGCTGGGG + Intronic
961854852 3:129859822-129859844 CCATGTCAGGCACTATGAAGAGG - Intronic
962428425 3:135296536-135296558 TCATTGCAGGCTGGGTGCAGTGG - Intergenic
962596875 3:136955140-136955162 CCAGGGCAGACTCTGTGCAATGG + Intronic
962935779 3:140079460-140079482 CCAGGGTAGGCTGGGTGCAGTGG + Intronic
963463179 3:145643672-145643694 CAAAGGCAGGCTATGTGCAAGGG - Intergenic
963521161 3:146361318-146361340 CCTTGGCAGCTTCTGTGCAGTGG + Intergenic
963538917 3:146562252-146562274 CCAGTGGGGGCTCTGTGCAGGGG + Intergenic
964202225 3:154130728-154130750 CCATGGCTGGCTTGGTTCAGGGG + Intronic
965155577 3:165048902-165048924 ACATGGTAGGCTGGGTGCAGTGG - Intronic
966917302 3:184592156-184592178 ACATGGCAGGGTCTGGGCTGTGG - Intronic
967925149 3:194640068-194640090 CCATGGCAGCAGCTCTGCAGAGG + Intergenic
967985836 3:195094773-195094795 CCTTCGCAGGCTGTGTGGAGAGG - Intronic
968634394 4:1670466-1670488 CCCAGGCAGGGTCTGTGCACAGG + Intronic
968875138 4:3262743-3262765 GCAGGGCAGGGGCTGTGCAGGGG - Intronic
968980665 4:3847744-3847766 GCATGCCTGGCTGTGTGCAGTGG - Intergenic
969045800 4:4335754-4335776 CCATGTCAGGCCAGGTGCAGTGG + Intergenic
969305181 4:6322244-6322266 CCATGGCAGGTGCCGTGCAGTGG - Exonic
969331935 4:6478868-6478890 ACATGGCTGGCTTTGTGCAGAGG + Intronic
969375529 4:6761025-6761047 CCATGGAAGGCTTTGAGCAGAGG - Intergenic
969643736 4:8413858-8413880 ACAAGGCAGGCTCTTCGCAGAGG + Intronic
971255360 4:25009114-25009136 CCATGGAGGGTTTTGTGCAGAGG - Intronic
972398286 4:38675813-38675835 CCATGGGCGGCTCAGTGCACTGG - Intronic
972632590 4:40855209-40855231 CCATTGCAGGTTCTCTGCACTGG - Intronic
972653784 4:41046806-41046828 CCCTGGCAGGCTCTATTCACAGG + Intronic
973598652 4:52519023-52519045 CCATGGCAGGTTGGGTGCAGTGG + Intergenic
976314795 4:83647968-83647990 CTCTGGCAGGCTCTGAGCACTGG + Intergenic
977173963 4:93796831-93796853 CCATGACTGGCTGGGTGCAGTGG - Intergenic
977645811 4:99410342-99410364 GCATGCCTGGCTGTGTGCAGTGG - Intergenic
978338093 4:107691272-107691294 ACATGCCAGGCACTGTGCTGAGG + Intronic
978370740 4:108027449-108027471 TTATGTCAGGATCTGTGCAGTGG + Intronic
978556590 4:109987549-109987571 CCATAGCTGGCTGGGTGCAGTGG - Intronic
979637763 4:122977347-122977369 GCATGCCTGGCTGTGTGCAGTGG - Intronic
979956263 4:126956631-126956653 GCATGCCTGGCTCTGCGCAGTGG + Intergenic
980240353 4:130165431-130165453 GCATAGCAGGCTCTGCGCAGGGG - Intergenic
981079200 4:140622317-140622339 CCAGGGCAGGCTCAGTTAAGAGG + Exonic
982071700 4:151701241-151701263 CCATGGCAGCCTGTGTGTGGCGG + Intronic
982118731 4:152118989-152119011 TCCTGCCAGGCTCTGTGCAGTGG + Intergenic
983323899 4:166228274-166228296 GCATGCCTGGCTGTGTGCAGTGG + Intergenic
984158414 4:176222359-176222381 CCAAGGCAGGCTTCGTGCAATGG + Exonic
984747929 4:183241023-183241045 CCATGAGAGGCCCTGTGGAGTGG - Intronic
984763932 4:183385143-183385165 GCATGCCTGGCTATGTGCAGTGG + Intergenic
986116643 5:4781841-4781863 CAATGGAGGGATCTGTGCAGAGG + Intergenic
986735045 5:10662205-10662227 CCATGGAAGCCGCTCTGCAGGGG + Intergenic
987999699 5:25331849-25331871 CCATCGCAACCTGTGTGCAGTGG + Intergenic
989491620 5:42062148-42062170 CAATGGCAGGCTGGGTGCAGTGG + Intergenic
990252069 5:53926315-53926337 CCATGGCAGGGGCTGCCCAGTGG + Intronic
991320007 5:65362020-65362042 CCATGGTAGGCCGTCTGCAGTGG - Intronic
991359150 5:65802267-65802289 GCATGCCTGGCTGTGTGCAGTGG - Intronic
991615853 5:68496647-68496669 CCATTTCAGGCTATGTGCAGAGG - Intergenic
992000266 5:72429509-72429531 ACATGGCAGGCACTGTGTTGGGG - Intergenic
992406394 5:76461580-76461602 CGATGAAAGGCTCTCTGCAGAGG + Exonic
993617913 5:90136185-90136207 GCATGTCTGGCTGTGTGCAGTGG - Intergenic
995332857 5:110965024-110965046 CCATGGCAGGTTCTGTCATGTGG - Intergenic
995851449 5:116550449-116550471 CCATGGCAGGCTCTGAGGGCTGG + Intronic
997042690 5:130277230-130277252 GCATGCCTGGCTGTGTGCAGTGG - Intergenic
997160982 5:131609073-131609095 ACATGGCAGGCTGGGCGCAGTGG - Intronic
997810637 5:136964448-136964470 CCATGACAAACTCTATGCAGAGG + Intergenic
997952606 5:138253889-138253911 TCATGGCAGTCCCTGTGAAGAGG + Exonic
998081324 5:139277288-139277310 CCAGGCCAGGCACGGTGCAGTGG - Intronic
998468495 5:142364730-142364752 CTACGGCAGGCCCTGTGCAGTGG - Intergenic
999746495 5:154596138-154596160 CCAAGGCAGGCCAGGTGCAGTGG + Intergenic
1000266392 5:159641823-159641845 GCATGCCTGGCTGTGTGCAGTGG + Intergenic
1001081728 5:168672247-168672269 CCAGGGAAAGCTCTGTGCCGAGG - Intronic
1001278617 5:170369560-170369582 CCTTGCCAGGCTCTGTGCCAGGG - Intronic
1001548406 5:172584802-172584824 CCATGGCAGCCTCAGAGCTGAGG + Intergenic
1001721518 5:173860738-173860760 CCCCGGAAGGCTCTGGGCAGAGG - Intergenic
1002365038 5:178703218-178703240 CCATGGCAAGCCCTGTGCACAGG + Intergenic
1002691706 5:181054450-181054472 AGCTGGCAGGGTCTGTGCAGAGG - Intronic
1003553362 6:7118934-7118956 CCATGGGAGGCCAGGTGCAGTGG - Intronic
1004775055 6:18834787-18834809 GCCTGGCAGGCACTGTGGAGGGG + Intergenic
1005275719 6:24215475-24215497 TCATGACAGGCTGTGTGGAGGGG + Intronic
1005431803 6:25765047-25765069 GCATGGGTGGCCCTGTGCAGGGG + Intronic
1006456752 6:34136388-34136410 TCATGACAGGCTGTGTGCTGGGG + Intronic
1006555842 6:34865921-34865943 TCATGGCAGGCCCGGGGCAGTGG + Intronic
1006929557 6:37679584-37679606 GCATGGGAGGCTCTGTGTACAGG - Intronic
1007083702 6:39127710-39127732 ACATGGAAGGCTCTGTGGTGAGG + Intergenic
1007281446 6:40715253-40715275 CCATGACAGGCTCTGCACACAGG - Intergenic
1007446891 6:41913610-41913632 ACATGACAGGCTGGGTGCAGTGG + Intronic
1007815841 6:44525110-44525132 CCAGGGCAGGCCCTGCCCAGAGG + Intergenic
1008490205 6:52078461-52078483 CCACAGCAGGCTCTTTGCAGTGG + Intronic
1009243254 6:61204274-61204296 GCATGCCTGGCTCTGTGCAGTGG - Intergenic
1009765262 6:68065429-68065451 CCATTTCAGGCTGGGTGCAGTGG + Intergenic
1010190768 6:73194121-73194143 CCATTCCAGGCTGGGTGCAGTGG - Intronic
1010519818 6:76818661-76818683 ACATGCCCGGCTCTGTGCAGTGG + Intergenic
1011284058 6:85705456-85705478 GCATGCCTGGCTGTGTGCAGTGG - Intergenic
1012376458 6:98567491-98567513 CCAAGGCAGGCCGGGTGCAGTGG - Intergenic
1012812673 6:103981004-103981026 CCATAGCAGGGTCATTGCAGGGG + Intergenic
1013094942 6:106936044-106936066 CCAGGGCAGGCCGGGTGCAGTGG - Intergenic
1013147723 6:107411171-107411193 CCATGGTAGGCCGGGTGCAGTGG - Intronic
1013184583 6:107746636-107746658 CCATGGATGTCTCTCTGCAGAGG - Intronic
1013192301 6:107813961-107813983 GCATGGCAGCCTCAGGGCAGTGG + Intronic
1013414628 6:109913505-109913527 CCATTGCAGGCCCTGACCAGGGG + Intergenic
1014817744 6:125953661-125953683 GCATGCCTGGCTGTGTGCAGTGG + Intergenic
1015333776 6:132011146-132011168 CCAAGGCAGCTTCTGTGAAGGGG + Intergenic
1015870342 6:137769840-137769862 ATATGCCAGGCTCTGTGCTGAGG - Intergenic
1017665895 6:156720042-156720064 CCTGGGCCGGCTCTGCGCAGAGG - Intergenic
1017788151 6:157773338-157773360 CCTCGGCTGCCTCTGTGCAGTGG - Intronic
1017876042 6:158524959-158524981 CCGTGGAAGGCTCTGGGCAGAGG - Intergenic
1018212463 6:161495673-161495695 CCATGGCTGGCTCTGTGGTAAGG - Intronic
1018564700 6:165139019-165139041 CCTTGGAAAACTCTGTGCAGAGG - Intergenic
1018633602 6:165841480-165841502 CCATTGCTGGCTCTGAGCAGTGG + Intronic
1018790455 6:167144016-167144038 CCACGGCAGGCCCAGGGCAGGGG - Intergenic
1019108366 6:169689264-169689286 CCTAAGCAGGCTCTGTGAAGTGG - Intronic
1019256765 7:57349-57371 CCATGGCAGGCTGGGTGCTGGGG + Intergenic
1019746082 7:2701046-2701068 CCATCCCAGGCACTGTGCTGCGG + Intronic
1019934351 7:4244677-4244699 CCATGCAAGGCCCTGAGCAGAGG - Intronic
1019984650 7:4646810-4646832 CCATGAGAGGCTCTGAGCAGAGG + Intergenic
1020619036 7:10496495-10496517 GCATAGCAGGCTGGGTGCAGTGG - Intergenic
1020768476 7:12356204-12356226 CCATGGCAGCCTTTGTGAAGTGG - Exonic
1022111382 7:27234557-27234579 CCATTCCAGGCTGGGTGCAGGGG + Intergenic
1022491716 7:30825532-30825554 CCATGGAAGTTTCTGAGCAGGGG + Intronic
1022494594 7:30844941-30844963 CCATGGCAGGCTGAGTTCAATGG - Intronic
1023334924 7:39158882-39158904 CCGTTGCAGGCTGGGTGCAGTGG + Intronic
1023882201 7:44326722-44326744 CCTGGGCAGGCTCTGAGGAGGGG + Intronic
1024757742 7:52556008-52556030 CCGTGGCAGGAGCAGTGCAGCGG + Intergenic
1025231916 7:57208172-57208194 CCATGGAGGGTTCTGAGCAGAGG + Intergenic
1026846544 7:73701982-73702004 CCTTGGCAGGCAGTGTGCTGGGG - Intronic
1027175237 7:75899207-75899229 CCAGGGCAGGTCCTGTGCTGAGG - Intronic
1027191470 7:75998583-75998605 CCTTGACAGGCCCGGTGCAGTGG - Intronic
1027218274 7:76198154-76198176 CCATGGCTGGGTGTGTGGAGAGG - Intergenic
1027699920 7:81456973-81456995 ACATGCCAGGCTCTGTGCCAGGG + Intergenic
1029906778 7:104100711-104100733 CTTGGCCAGGCTCTGTGCAGGGG - Intergenic
1030359574 7:108580496-108580518 GCATGCCTGGCTGTGTGCAGTGG + Intergenic
1030763522 7:113380316-113380338 ACATGGGGGGCTCGGTGCAGTGG + Intergenic
1031847554 7:126824589-126824611 CCATGGCAGGCTCCAAGCTGTGG + Intronic
1032017047 7:128387076-128387098 CCATTCCAGGGACTGTGCAGAGG - Intergenic
1032565809 7:132941683-132941705 CCATCCCAGGCTCTTAGCAGAGG - Intronic
1032838431 7:135695278-135695300 CCCTGGATGGCTCTGTGCAAGGG - Intronic
1033132393 7:138755742-138755764 CCACCGCAGGCTCTGGGCAAGGG + Exonic
1033139623 7:138813781-138813803 CCATGTTAGGCTGGGTGCAGTGG - Intronic
1033357635 7:140613250-140613272 CCACTGCAGGCTGAGTGCAGTGG + Intronic
1033461854 7:141553606-141553628 ATATGGTAGGCTCTGTGCTGGGG - Intronic
1034641319 7:152605880-152605902 CATTGGCAGGCTGGGTGCAGTGG + Intergenic
1035148368 7:156843556-156843578 CCAGGGAAGGCTGGGTGCAGTGG + Intronic
1035644696 8:1210161-1210183 CCAGGCCAGGCTCTGTGGAGTGG + Intergenic
1036656143 8:10678722-10678744 CCATGCCAGGCTGGCTGCAGTGG + Intronic
1037150366 8:15627773-15627795 GCATGCCTGGCTGTGTGCAGTGG + Intronic
1038146689 8:24903985-24904007 TAATGGCAGGCTGGGTGCAGTGG - Intergenic
1038608163 8:29031784-29031806 CCCTGGCAGGCTCAGTCCATTGG + Intronic
1038791840 8:30675066-30675088 CCATGGCAGTCTCAGAGCAGTGG - Intergenic
1039234254 8:35484551-35484573 CCATGGAAGGGTCTTAGCAGAGG - Intronic
1039377442 8:37050125-37050147 CCATCCAAGGCTCTGAGCAGTGG - Intergenic
1039437233 8:37568038-37568060 GCATGCCAGGCACTGTGCTGGGG + Intergenic
1039489972 8:37940139-37940161 CCTTGGCAGCCCCAGTGCAGAGG + Intergenic
1039972338 8:42331014-42331036 CCATAGCAGGCCTTGTGCAGTGG + Exonic
1041254378 8:55966909-55966931 CCCTTGCAAGCTCTGGGCAGTGG - Intronic
1041274528 8:56143249-56143271 GCATGCCTGGCTGTGTGCAGTGG + Intergenic
1044580522 8:93821575-93821597 TCTTGGCAGGCTAGGTGCAGTGG - Intergenic
1047398942 8:124529802-124529824 CCATGGTAGGCCGGGTGCAGTGG + Intronic
1048162621 8:132034912-132034934 ACATGGCTGCCTGTGTGCAGTGG - Intronic
1048180515 8:132190071-132190093 CCATGGCTGGATCAGTGCATGGG + Intronic
1048473523 8:134723493-134723515 CCAGGACAGGGCCTGTGCAGAGG + Intergenic
1048750955 8:137674949-137674971 ACAAGGCAGGCTCTGTGCTAGGG + Intergenic
1048977284 8:139680157-139680179 GCTTGGCTGGCTCTGGGCAGAGG - Intronic
1049245558 8:141560443-141560465 ACGTGCCAGGCTCTGTGCTGAGG + Intergenic
1049261427 8:141641261-141641283 CTATGTCAGGCTCTGTGCTCTGG - Intergenic
1049590990 8:143462495-143462517 CCAAGACAGGCGCTGTCCAGAGG + Intronic
1049625880 8:143620460-143620482 CCATGACTGGCTGGGTGCAGTGG - Intergenic
1049749783 8:144277651-144277673 CACAGGCAGGCTCTGGGCAGGGG + Intronic
1050168942 9:2795586-2795608 CCTTGGCAGGCTGGGTGCAGTGG + Intronic
1051634303 9:19167594-19167616 CCATGGAAAGCTGGGTGCAGTGG - Intergenic
1052338347 9:27341378-27341400 CAATGGCAAGCTCTGTCCTGTGG - Intronic
1053005822 9:34603788-34603810 CCTTTCCAGGGTCTGTGCAGAGG - Intergenic
1053138646 9:35667959-35667981 CCATGGAAGGCACAGTGGAGTGG - Intronic
1053448057 9:38168410-38168432 TCATGACAGGCTAGGTGCAGTGG + Intergenic
1053619059 9:39797965-39797987 GCATGCCTGGCTGTGTGCAGTGG - Intergenic
1053877221 9:42557314-42557336 GCATGCCTGGCTGTGTGCAGTGG - Intergenic
1053895448 9:42737379-42737401 GCATGCCTGGCTGTGTGCAGTGG + Intergenic
1054234473 9:62544408-62544430 GCATGCCTGGCTGTGTGCAGTGG + Intergenic
1054265097 9:62909464-62909486 GCATGCCTGGCTGTGTGCAGTGG + Intergenic
1054912273 9:70465554-70465576 CCATGGCATGCTCTGCGAGGGGG - Intergenic
1056377516 9:86028810-86028832 CCATTGCATGCCCTGTGAAGGGG + Intronic
1056660227 9:88537742-88537764 CCATGTCTGGCTCTGTCCTGTGG - Intronic
1058674255 9:107387194-107387216 CCATGGAAGGCCCAGCGCAGTGG - Intergenic
1059203402 9:112440583-112440605 CCAGTGGAGGCTGTGTGCAGTGG + Intronic
1059238586 9:112783764-112783786 CCATGTCAGTTTCTGTGCTGAGG + Intronic
1060528969 9:124336719-124336741 CCAGGCCAGGCTGGGTGCAGTGG + Intronic
1060860836 9:126953727-126953749 CCAAGCCCTGCTCTGTGCAGGGG - Intronic
1061078490 9:128355880-128355902 CCCGGCCAGGCTGTGTGCAGAGG - Intronic
1061277872 9:129579755-129579777 CAATGGGGGGCTCTGAGCAGGGG + Intergenic
1061372067 9:130202865-130202887 CAATGGCAGGCCACGTGCAGTGG - Intronic
1061675613 9:132214045-132214067 CCAGGGCTGGCTCTCTGCAAAGG - Intronic
1061700373 9:132410733-132410755 CCATGTCAGGCGCTGTCCCGAGG - Intronic
1061897028 9:133653547-133653569 TGAAGGAAGGCTCTGTGCAGGGG + Intronic
1062094528 9:134695985-134696007 GCATGGCAGGCCCAGGGCAGAGG - Intronic
1062267485 9:135693930-135693952 TCATCACAGCCTCTGTGCAGCGG - Intronic
1062631610 9:137465501-137465523 CCATGGCGGGTTCTGTCCCGAGG + Intronic
1185503149 X:614149-614171 CCATAGAAGGCTCTGAGGAGGGG - Intergenic
1185936086 X:4258163-4258185 GCATGGCTAGCTGTGTGCAGTGG + Intergenic
1188195054 X:27222843-27222865 GCATGCCTGGCTGTGTGCAGTGG + Intergenic
1189125930 X:38446239-38446261 CCATTGCAGGCTGGGTGCGGTGG - Intronic
1189695787 X:43660388-43660410 CCATTGAAGGCCCTGAGCAGAGG - Intronic
1190466520 X:50730138-50730160 CAATTGCAGGCTGGGTGCAGTGG + Intronic
1190700008 X:52980636-52980658 CCATGGCTGGCAGTCTGCAGAGG + Intronic
1190793050 X:53717661-53717683 CAATGGCAGGCTGAGTGCGGTGG + Intergenic
1190871465 X:54428089-54428111 CTATGGCAGGCCAGGTGCAGTGG + Intergenic
1191851504 X:65589153-65589175 CCAAGGGAGGCTAAGTGCAGGGG - Intronic
1193112443 X:77743305-77743327 CCATGGCAGGATCTCAGCAGTGG + Intronic
1193601066 X:83508794-83508816 CGGGTGCAGGCTCTGTGCAGAGG - Exonic
1196425934 X:115569693-115569715 CCATGGAAGGGTCTGTGAAATGG - Intronic
1198311277 X:135427034-135427056 ACATGGCAGGCTCTCATCAGAGG - Intergenic
1198683091 X:139203183-139203205 CGATGGGAGGCCCTGGGCAGAGG + Intronic
1199977911 X:152905172-152905194 GCATGGCTGGCTCTGCGCCGGGG + Intergenic
1200117424 X:153775468-153775490 CCTGGGCGGGCTCTGTCCAGGGG + Intronic
1202560480 Y:26147081-26147103 CCAGGGCAGGCTGTGTTCACTGG + Intergenic