ID: 1128291721

View in Genome Browser
Species Human (GRCh38)
Location 15:66483237-66483259
Sequence CTGGAGTCACAGTGGGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 348}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128291721_1128291729 1 Left 1128291721 15:66483237-66483259 CCTACCCCCCACTGTGACTCCAG 0: 1
1: 0
2: 1
3: 36
4: 348
Right 1128291729 15:66483261-66483283 CACTGTCAACATCACTCACCTGG 0: 1
1: 1
2: 5
3: 21
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128291721 Original CRISPR CTGGAGTCACAGTGGGGGGT AGG (reversed) Intronic
900172147 1:1274246-1274268 CTGGAGGCTCAGTGGAGGGTTGG + Intergenic
900326464 1:2110795-2110817 GTGGAGTCCCTGTGGGGGGCAGG + Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
901012192 1:6208205-6208227 CTGGAGTCACACTTGGGGGCGGG - Intronic
901679900 1:10906895-10906917 TTTGTGTCACAGTGTGGGGTGGG - Intergenic
902167940 1:14587589-14587611 CAGGAGTGAGAGTGGGGGGCGGG + Intergenic
902381664 1:16055664-16055686 CTGGAGACACTGCTGGGGGTGGG - Exonic
902701096 1:18172698-18172720 ATGCAGTCACATTGGGGGTTAGG + Intronic
902991323 1:20189287-20189309 CAGGAGTCACAGTGGTGGTCAGG + Intronic
903047314 1:20574589-20574611 CTGCAGGCACAGTGGGGCATGGG + Intergenic
903386498 1:22930423-22930445 CTGCACTGACAGTGGGGGATGGG + Intergenic
904622040 1:31781543-31781565 GTGGAGGCAGAGTGGGGGGAGGG + Intergenic
904623480 1:31789315-31789337 CCGGAGTCAAAGCGGGGGGTGGG - Intergenic
905841759 1:41186616-41186638 ATGTAGTCACATTGGGGGTTAGG - Intronic
905879497 1:41454462-41454484 CTGGGCTCAAAGTGGGGGGCGGG + Intergenic
905974363 1:42164340-42164362 GTGGAGCCACAGTGAGGGGCTGG + Intronic
906222080 1:44088671-44088693 ATGCAGTCACATTGGGGGTTAGG + Intergenic
907515972 1:54993666-54993688 TGGGAGCCACAGTGGGGGGTGGG - Intergenic
908285650 1:62596308-62596330 CTGGAGTCAGACTGTGGTGTGGG - Intronic
908571690 1:65418138-65418160 CTGGAGACAGAATGGGTGGTTGG + Intergenic
911296911 1:96128846-96128868 CTGGAGTGACAGTGGTGACTGGG + Intergenic
912738976 1:112175773-112175795 AAGGAGTCACAGTAGGGGCTGGG - Intergenic
912798082 1:112704951-112704973 CCTGAGTCACAGGGAGGGGTGGG - Intronic
914802526 1:150971995-150972017 CTGGAGTCGCAGAGGGAGGGTGG + Intronic
915058306 1:153157907-153157929 CAGGAGACAGAGAGGGGGGTGGG + Intergenic
915490274 1:156246757-156246779 CTAGAGACAGAGTGGGAGGTAGG + Intronic
915565123 1:156708661-156708683 CTGGAGACTCAGTGAGGGGAGGG + Intergenic
915973764 1:160371587-160371609 CTGGGGTTAGAGTGGGGAGTGGG + Exonic
917478318 1:175387750-175387772 CTGGAGACAGAGTAGGAGGTGGG - Intronic
917526611 1:175793852-175793874 CTGGAGACCCAGTGAGGAGTTGG + Intergenic
917849562 1:179049343-179049365 CTGGACTGGCAGTGGGAGGTTGG - Intronic
920037798 1:203076902-203076924 CTGCAGTCACGGTGATGGGTTGG - Exonic
920839641 1:209543615-209543637 CTGGTGTCAGCATGGGGGGTGGG + Intergenic
921765778 1:218971494-218971516 CAGGAGTGCCAGTGAGGGGTGGG + Intergenic
923633284 1:235669900-235669922 CTGGGAGCAGAGTGGGGGGTGGG + Intronic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063814780 10:9759295-9759317 TTACAGTCACACTGGGGGGTAGG + Intergenic
1064585376 10:16834388-16834410 CTGGGGTGGGAGTGGGGGGTGGG + Intronic
1065483527 10:26216362-26216384 CTGGAGTCAGAGTGAGGGGGTGG - Exonic
1066687482 10:37994497-37994519 ATGGAGTCACAGATGGGAGTGGG + Intergenic
1067841340 10:49681861-49681883 CTGTAGTCACATTGGGAGTTAGG + Intronic
1068533008 10:58210100-58210122 CTGCAGCCACTGTGGGGGATGGG + Intronic
1069832809 10:71291445-71291467 CAGGAGGCACAGAGGGGTGTAGG - Exonic
1069839011 10:71327713-71327735 GTGGAGTCAAAGTGTGGGGGTGG - Intronic
1069850011 10:71398182-71398204 CTGGGGTCGCAGTGGGGCGGCGG - Intronic
1069943633 10:71971682-71971704 GTGTAGTCACAGTGCGGGGACGG - Intronic
1071123659 10:82309753-82309775 CTGGAATCACAGTGTCGGGGAGG + Intronic
1071454716 10:85837091-85837113 CTGCAGTGACAGTCGGTGGTGGG - Intronic
1071461193 10:85897874-85897896 CCAGAGTGACAGTGGGGGGTTGG - Intronic
1072707588 10:97692420-97692442 GTGGAGTCACACTGGAGGTTAGG + Intergenic
1072760312 10:98051238-98051260 CTCCAGTCACATTGGGGGTTAGG + Intergenic
1073788930 10:106920195-106920217 CTTGAGTCCCAGTGGGTGGGCGG - Intronic
1074912269 10:117922099-117922121 CTGGGGACACAGTGGTGCGTCGG - Intergenic
1075409254 10:122215257-122215279 CTGGAGTGACAGAGGTGGGAGGG + Intronic
1075702767 10:124479768-124479790 ATGCAGTCACATTGGGGGTTAGG + Intronic
1076267669 10:129121497-129121519 CTGGAACCACAGTGGGGCTTGGG + Intergenic
1076268468 10:129129822-129129844 ATGGAGTCACAGGGGGGTCTCGG - Intergenic
1076312403 10:129517774-129517796 GTGGGGTCACAGTGAGGGTTTGG - Intronic
1076693639 10:132236669-132236691 CTGGAGCCACTGGGGTGGGTGGG - Intronic
1076799158 10:132812638-132812660 CTGCAGTCACAGAGGGTGGGGGG + Intronic
1077056537 11:596742-596764 CTGCTGTCACATTGGGGGTTAGG + Intronic
1078519805 11:12053733-12053755 CTGGAGGGGCTGTGGGGGGTGGG + Intergenic
1083739207 11:64699232-64699254 CTGGAGTCACTGTGGGGTGGTGG - Intronic
1084062459 11:66685358-66685380 CTGGAGTTACAGGGTGGGGGTGG + Exonic
1084427969 11:69095938-69095960 CTGGAGTAACAGTGGGTCTTCGG - Intergenic
1085283454 11:75345397-75345419 CTTGAGTCCTAGTAGGGGGTTGG - Intronic
1087762831 11:102120590-102120612 CAGGATTCTCAGTTGGGGGTGGG + Intronic
1088693041 11:112344052-112344074 CTGGAGGCACAGTGGGGGTGGGG + Intergenic
1089763468 11:120745958-120745980 CTGGAATCACAATGCTGGGTTGG - Intronic
1090622013 11:128568559-128568581 GTGGTGTCACAGTGGGGAGGTGG - Intronic
1091208369 11:133835841-133835863 CTGGGGGCACAGTTGGGGGATGG - Intergenic
1091288560 11:134423299-134423321 CTGGAGTCCCTGTGGAGGGCGGG + Intergenic
1092259462 12:6945090-6945112 CTGACTTCATAGTGGGGGGTGGG - Intronic
1092847811 12:12600378-12600400 GTGGAGGCACACTGGGGAGTAGG + Intergenic
1092904272 12:13087873-13087895 CTGGAGTGAGAGAGGGTGGTTGG - Intronic
1095225797 12:39675239-39675261 CTGCAGCCACTGTGGGGGATGGG - Intronic
1095803808 12:46296525-46296547 CTGGAGTGGCAGTGGAGGGTAGG - Intergenic
1096713388 12:53475041-53475063 CTGGAGACACAAGGGGCGGTCGG - Intronic
1102493951 12:113306440-113306462 CTGGTGTCACAGCCGTGGGTGGG - Intronic
1102554985 12:113720877-113720899 ATGGAGTCAGAGTTGGGGGGAGG + Intergenic
1103156732 12:118691773-118691795 ATACAGTCACAGTGGGGGTTAGG + Intergenic
1104356146 12:128088908-128088930 CTAGAGTCACAGTGGATGTTGGG - Intergenic
1104667198 12:130656059-130656081 CTGGGGACACGGTGGAGGGTGGG + Intronic
1114438237 14:22726065-22726087 CTGGAGACACCGTGGGGGAGTGG - Intergenic
1114493069 14:23115224-23115246 CTGGGATCACAGTGGGGAGACGG + Intergenic
1115531359 14:34331045-34331067 GTGGGGTCACAGTGGGTGGTGGG - Intronic
1115602228 14:34966498-34966520 CTGGAGTCATTCTTGGGGGTTGG + Intergenic
1116360585 14:43991605-43991627 CTGTAGTCACAGAGTGTGGTAGG + Intergenic
1118884289 14:69853574-69853596 CTGGAGGCAGGGTGTGGGGTGGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1121045652 14:90785714-90785736 CTGGCGTCACAGTTGGGAGGGGG - Intronic
1121652425 14:95568940-95568962 GTGTGGTCACAGTGGGGAGTGGG + Intergenic
1122005110 14:98697015-98697037 CTGGGGCCACAGGTGGGGGTGGG + Intergenic
1122428851 14:101627454-101627476 CTGTAGTCCCAGTGGGAGTTTGG - Intergenic
1122687503 14:103516896-103516918 CAGTAGTCACTGTGGGTGGTGGG - Intergenic
1122854396 14:104553222-104553244 CTGGACTCAGGGTGGTGGGTAGG + Intronic
1123204036 14:106694774-106694796 CTGGAGCCACCGGGGGGGGGGGG - Intergenic
1123790061 15:23711134-23711156 CTGGAGGGACAGTGGAGGGCAGG - Intergenic
1124268866 15:28262523-28262545 GTGGAGCCACATTGGGAGGTGGG - Intronic
1124385953 15:29208153-29208175 CTGGACTCAGGGTGGGGGGAGGG - Intronic
1125599150 15:40906260-40906282 CTGGAGGGCCAGAGGGGGGTGGG + Intergenic
1125919822 15:43518705-43518727 CTGGAGTTGCGGGGGGGGGTGGG - Intronic
1126079485 15:44945567-44945589 CTACAGTCACATTGGGGGTTAGG - Intergenic
1128291721 15:66483237-66483259 CTGGAGTCACAGTGGGGGGTAGG - Intronic
1129232724 15:74205746-74205768 CTGGGCTCTCCGTGGGGGGTGGG - Intronic
1129325923 15:74800285-74800307 CTGGAGTCACTGAGTGGGGAGGG - Intronic
1130031886 15:80322970-80322992 CTGGAGACAGAGTGGGGTGGAGG - Intergenic
1130230355 15:82092270-82092292 CTGGTATCACTGTGGGGTGTGGG - Intergenic
1130328899 15:82904344-82904366 CTGAAGACTCAGTGTGGGGTAGG + Intronic
1130765755 15:86869326-86869348 CTGGATTCTCTGTGGTGGGTGGG - Intronic
1132414558 15:101611047-101611069 CTGGAGGAACAGTGGGGAGGAGG - Intergenic
1132693935 16:1193839-1193861 CTGGAGTGACAGGTGGGGGCAGG + Intronic
1132881086 16:2162018-2162040 CTCGAGTCGCAGTGGGGCCTGGG + Intronic
1133004606 16:2872179-2872201 CTGGGGTCAGCGTGGGGAGTGGG - Intergenic
1134429999 16:14194471-14194493 ATGCAGTCACATTGGGGGTTAGG + Intronic
1134808631 16:17147647-17147669 CTGGAGTCACAGGGGTGAATGGG + Intronic
1134881506 16:17748419-17748441 CTGGAGCTACAGGGTGGGGTGGG + Intergenic
1135423914 16:22322950-22322972 CTGGACTCACGGTGGGGGCGTGG + Intronic
1136561592 16:31042334-31042356 CGGGAGGCGCAGTCGGGGGTCGG - Intronic
1138507428 16:57485391-57485413 CTGGGATCAGAGTTGGGGGTGGG + Intronic
1139203009 16:64998502-64998524 CTGGTGTCTCTGTGGTGGGTGGG - Intronic
1139477782 16:67211285-67211307 GTGGAGACAGAGTGGGGAGTTGG + Intronic
1139560035 16:67736070-67736092 CTGCAGTGACAGTGGGGAGGAGG - Intronic
1139708829 16:68761042-68761064 CTCGAGTCACACAGGAGGGTAGG + Intronic
1140710152 16:77670267-77670289 ATACAGTCACAGTGGGGGCTGGG - Intergenic
1141257610 16:82417274-82417296 CTGGACTCACAGTGGGGCTGTGG + Intergenic
1141324884 16:83047204-83047226 CTGGAGTAAGAGTGAGGGGCAGG - Intronic
1141484678 16:84330790-84330812 CTGGAGCCTGAGTGTGGGGTGGG - Intergenic
1141798569 16:86291610-86291632 CTGGGTTCACAGTGGGTGGCAGG - Intergenic
1142140881 16:88472187-88472209 CTGGAGGCACGGTGGTGGGCAGG + Intronic
1142262564 16:89049752-89049774 CGGGAGGCACAGTGGGCGGCCGG + Intergenic
1142365468 16:89647602-89647624 GTGGAGACCCAGTGCGGGGTCGG + Intronic
1143141110 17:4742308-4742330 CTGGGGACACAGCGGGTGGTGGG - Intronic
1145058637 17:19718755-19718777 GTGCAGGCAGAGTGGGGGGTGGG + Intronic
1145271219 17:21405848-21405870 CTGAAGTCACAGTGCAGGGCAGG - Intronic
1147587549 17:41661035-41661057 CTGGAGTGGGGGTGGGGGGTGGG - Intergenic
1147671138 17:42177594-42177616 CTGGGGGCCCAGTGGGGGCTGGG + Intronic
1147900162 17:43778659-43778681 CGGGAGCCACAGCGGGGGCTTGG - Intronic
1148696913 17:49566096-49566118 CTGGGGTTACAGTGGTGGGAGGG + Intergenic
1150063018 17:62085066-62085088 TTGGAATCACAGGGGTGGGTGGG + Intergenic
1151360499 17:73585707-73585729 CTGCATTCACAGTGTGGGGTTGG - Intronic
1152068575 17:78124405-78124427 CTGGAGTCACAGCGGGGCAAGGG + Intronic
1152283518 17:79399137-79399159 CTGGAGTCTCAGAGGGGGCATGG + Intronic
1152777978 17:82213943-82213965 CTAGACACAGAGTGGGGGGTGGG - Intergenic
1153551013 18:6261958-6261980 CTGGCGGCAGAGTGGGGGGGTGG + Intronic
1154260472 18:12827505-12827527 CTGGAGTCCCAGCTGGGGTTGGG - Intronic
1155721123 18:29013024-29013046 CAGGAGTCACAGTGAAGGGAAGG - Intergenic
1156120870 18:33841396-33841418 CTGAAATCAGAGAGGGGGGTAGG - Intergenic
1156841879 18:41618654-41618676 CTGAAGTCACACTGGAGTGTAGG - Intergenic
1157912017 18:51625285-51625307 CTGGAATCCCAGTGGGGTGGGGG + Intergenic
1158319418 18:56246990-56247012 CAGGACACACAGTGGGGTGTGGG - Intergenic
1159656131 18:71031650-71031672 CTGGAGTTCCAGGTGGGGGTGGG - Intergenic
1160010809 18:75105984-75106006 CTAGAGTCCCAGTTGGGGATAGG - Intergenic
1160295090 18:77630384-77630406 CTGGAGTCACCTTCTGGGGTTGG + Intergenic
1161031166 19:2058359-2058381 CTGGAGTCTCATGGTGGGGTGGG - Intergenic
1161152399 19:2716616-2716638 CTGTCTTCACAGTGGGGTGTGGG - Exonic
1161251994 19:3285537-3285559 GTGGGGTCACAGTGGAGGGCGGG - Intronic
1162032877 19:7925006-7925028 CGGGATTCAGAGTCGGGGGTGGG + Exonic
1162174973 19:8823736-8823758 CTGGCATGACAGTGGGGGGTAGG - Intronic
1163090291 19:15014711-15014733 CAGGAGACTCAGTGGGGGGGCGG + Intronic
1164923154 19:32104812-32104834 CTGGAGTGAAGGTGCGGGGTGGG - Intergenic
1165139423 19:33689923-33689945 CTGGAGTCACAGAGGGCTGCTGG + Intronic
1165827620 19:38714227-38714249 CTGGAGGCACCGAGGAGGGTTGG - Intronic
1165905070 19:39188808-39188830 CTGGAGTCTGAGAGAGGGGTCGG - Intergenic
1165942676 19:39423113-39423135 CAGGAGTCACAGGAGAGGGTGGG - Exonic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166283228 19:41808957-41808979 CTGGAGTCAGCCTAGGGGGTGGG - Intronic
1166749459 19:45158116-45158138 CTAGGGGCACAGTGGGGAGTGGG - Intronic
1167506236 19:49872605-49872627 CTGGAGTCCCGGTGGGGGTTGGG - Intronic
1167887724 19:52515965-52515987 GTGGAGCCACAGTGAGGGGTTGG - Intergenic
1167894889 19:52572735-52572757 GTGGAGTGACAGTGAGGAGTTGG - Intronic
1167904090 19:52644002-52644024 GTGGAGCCACAGTGAGGAGTGGG + Intronic
1167908839 19:52684888-52684910 GTGGAGCCACAGTGAGGAGTTGG + Intronic
1167910916 19:52700960-52700982 GTGGAGCCACAGTGAGGGGTTGG + Intergenic
1167918573 19:52762230-52762252 GTGGAGCCACAGTGAGGGGTTGG + Intergenic
1167939999 19:52938794-52938816 ATGGAGCCACAGTGAGGAGTTGG + Intronic
1167960285 19:53099448-53099470 GTGGAGCCACAGTGAGGAGTTGG + Intronic
1167964082 19:53129280-53129302 GTGGAGCCACAGTGAGGAGTTGG + Intronic
1167988305 19:53337034-53337056 ATGGAGCCACAGTGAGGAGTTGG - Intronic
1167992320 19:53370861-53370883 GTGGAGCCACAGTGAGGAGTTGG - Intronic
1168000979 19:53445869-53445891 GTGGAGCCACAGTGAGGAGTTGG - Intronic
1168005345 19:53482368-53482390 GTGGAGCCACAGTGAGGAGTTGG - Intronic
1168230169 19:55026136-55026158 CCAGGGTCACAGTGAGGGGTAGG - Intronic
1168266953 19:55228515-55228537 CTGGGGTCCCAGGTGGGGGTGGG - Intronic
1168327037 19:55543829-55543851 CTGGAGTCAATGAAGGGGGTGGG - Intronic
1168345891 19:55650056-55650078 CTGGTGTCACAGAGGGGAGGGGG - Intronic
925449179 2:3953612-3953634 TTGGAGTCACAGTGATGGGAGGG + Intergenic
925702812 2:6655876-6655898 CTGGAGTCACAGTGATTGGCTGG - Intergenic
925750273 2:7083766-7083788 GTGGAGTCAGAGTGGGTTGTGGG - Intergenic
927397122 2:22665352-22665374 CTCGAGAGACAGTTGGGGGTAGG - Intergenic
928011986 2:27617749-27617771 TTGAAGTCACTGTGAGGGGTGGG + Intronic
928049037 2:27969330-27969352 CTGGAAGCACAGTGAGGGGGTGG + Intronic
928979994 2:37127635-37127657 CTGGGGTCACAGTTGTGGGGAGG - Intronic
930774428 2:55158579-55158601 CTGGAGTGACAGAGGGGTGGTGG - Intergenic
931128014 2:59299036-59299058 ATGCAGTCACAGTGGGGGTTAGG - Intergenic
931257265 2:60584543-60584565 CTGGAGTTACAGAGGGAGTTGGG - Intergenic
932265640 2:70365092-70365114 ATGGAGTCACAGCTGGGGGGTGG + Intergenic
932316140 2:70784629-70784651 GTGGAGTCACAGATGGTGGTTGG - Intronic
935217886 2:100988896-100988918 CTGGAGGAACAGTGGGGGCCTGG - Intronic
937069258 2:119050318-119050340 CTGGAGTTGCTGTGGGGGATGGG + Intergenic
937400963 2:121583213-121583235 CTGGACTAATAGTAGGGGGTAGG - Intronic
937904384 2:127045841-127045863 CGGGAGTGACAGTGGCGGTTTGG - Intergenic
938341539 2:130539602-130539624 CTGGAGACACAGTGGAGCATGGG + Exonic
938348291 2:130581107-130581129 CTGGAGACACAGTGGAGCATGGG - Intronic
940419608 2:153464281-153464303 CTGGAGGCACAGTGATGGGGTGG - Intergenic
940778402 2:157907666-157907688 ATGCAGTCACATTGGGGGTTGGG + Intronic
941262116 2:163310621-163310643 CTGGGGGCAGCGTGGGGGGTTGG - Intergenic
941911578 2:170770319-170770341 CTTGGGTCACAGTAGGGGGTGGG - Intergenic
942320918 2:174735154-174735176 CTGGAATCAGAGTGAGGGGAAGG - Intergenic
943409538 2:187529618-187529640 ATGCAGTCACATTGGGGGTTAGG + Intronic
944590562 2:201213538-201213560 CTAGATTAATAGTGGGGGGTAGG + Intronic
945323421 2:208454313-208454335 ATAGAGTCACATTGGGGGTTAGG - Intronic
948213205 2:236210162-236210184 CTGGAGTCACAGTGAGGAGCAGG - Intronic
948455826 2:238104227-238104249 CTGGGGTCACAGTGGCGGCGTGG - Intronic
949034309 2:241809618-241809640 ATGGGGTGACAGTTGGGGGTTGG + Intronic
1168789810 20:568453-568475 CAGGAGTGACAATGGGGGGAAGG - Intergenic
1169745123 20:8935617-8935639 CGGGATTCTCAGTGGGGTGTGGG + Intronic
1171087074 20:22247345-22247367 CTGGAGCCACAGTAGCAGGTGGG + Intergenic
1171163126 20:22946634-22946656 CTGGAGTCACAGAGGCTGGCTGG + Intergenic
1171284264 20:23924466-23924488 CTGGATTCACAGTGGGTGAGAGG - Intergenic
1172285057 20:33734400-33734422 CCAGAGTGGCAGTGGGGGGTCGG + Intronic
1175221993 20:57422508-57422530 CTAAAGGCACAGTGGGGGATGGG + Intergenic
1175389079 20:58615047-58615069 GTAGAGTCACAGTGGGGAGTAGG + Intergenic
1176155938 20:63620448-63620470 CTGGAGTCAGAGTGTGGGGGAGG + Intronic
1176203690 20:63876753-63876775 CTGGTGTCACGGTGGGAGGCTGG + Intronic
1177762245 21:25415011-25415033 CAAGAGTAACAGTGGGGAGTCGG + Intergenic
1178623374 21:34195699-34195721 CTGGAGTCCCAGTGGCCTGTTGG + Intergenic
1179167168 21:38944242-38944264 CTGGAGTCACAGAGGGCAGTGGG - Intergenic
1179288088 21:39995278-39995300 CTGGAGTCCAAGTGGCTGGTTGG + Intergenic
1179311366 21:40198742-40198764 CTGGAGAGGCAGTGGGAGGTGGG + Intronic
1179553775 21:42159869-42159891 ATGGGATGACAGTGGGGGGTTGG + Intergenic
1179670381 21:42942826-42942848 CTGAAGTCACAGGGGAGGGGTGG + Intergenic
1179900780 21:44392668-44392690 CTATAGTCACACTGGGGGTTAGG + Intronic
1180018626 21:45104453-45104475 GTGGAGACACAGTGGGGGTCAGG + Intronic
1181673071 22:24434936-24434958 CTGAAGTCACAGTGGGGATCAGG - Intronic
1182256371 22:29041757-29041779 CTGGAGACACTGTCGGTGGTGGG - Intronic
1183951285 22:41354481-41354503 CTGGGGACACGGTGGGGAGTAGG + Intronic
949146052 3:701254-701276 CTGCAGTCACTGTGGAGGATGGG + Intergenic
949432200 3:3989774-3989796 CAGGAGGGACAGTGGGGAGTTGG - Intronic
951071762 3:18337466-18337488 CTGGAGTCCTAGTGGGGAGCTGG - Intronic
952195211 3:31068303-31068325 GTGGAGTCACAGAGGGAGGGAGG - Intergenic
953502116 3:43446929-43446951 CAGGAGGCACAGTGGGGCATTGG - Intronic
954003931 3:47578055-47578077 CTGGGGTCACACTGGGGCGGTGG - Intronic
954648094 3:52143667-52143689 CTGGCATCAGAGTGGGGGATGGG - Intronic
955239393 3:57165525-57165547 CCAGAGTCTCAGTGGGGGCTTGG - Intronic
955266484 3:57449657-57449679 CTGGAGTTACAGGTGGGCGTGGG - Intronic
955884964 3:63588332-63588354 CAGGAGACACAGTGGAAGGTTGG - Intronic
956794896 3:72709032-72709054 ATGCAGTCACATTGGGGGTTAGG - Intergenic
957877621 3:86169590-86169612 CTGGAATCAAATTGTGGGGTTGG + Intergenic
959249386 3:103922305-103922327 CTAGAATCAATGTGGGGGGTGGG - Intergenic
959500370 3:107099833-107099855 GTGTTGTCACAGTGGTGGGTGGG - Intergenic
959727535 3:109560990-109561012 CTGCAGCCACTGTGGGGGATGGG + Intergenic
960953518 3:123014915-123014937 ATGAAGTCACACTGGAGGGTGGG + Intronic
961817496 3:129558813-129558835 CTGGAGGCTCAGGAGGGGGTTGG - Intronic
961820786 3:129574719-129574741 CTGGAGTCTCTGTGAGGGGAAGG - Intronic
962310155 3:134320553-134320575 CAGGAATCAGACTGGGGGGTGGG - Intergenic
963773958 3:149419954-149419976 TTACAGTCACAGTGGGGGTTAGG - Intergenic
965327881 3:167330487-167330509 ATGTAGTCACATTGGGGGTTAGG - Intronic
967143751 3:186587806-186587828 CAGGACTCACAGTGAAGGGTTGG + Intronic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968520494 4:1032762-1032784 CTGGAGTTACAGTGGGTAGGCGG + Intergenic
968682136 4:1928710-1928732 CTGGAGTCATGGTGGGTGATGGG + Intronic
969215368 4:5717818-5717840 CTAGAGTAACAGTGGAGGGTGGG - Intronic
969237132 4:5873501-5873523 CTGAAGGCAAAGTGGGGGGTGGG + Intronic
969437653 4:7198036-7198058 CTGGAGGCACTGTGGGGGATGGG + Intronic
970075228 4:12210803-12210825 CTGGAGTCAGAGTCGGGGCAGGG + Intergenic
973323403 4:48832744-48832766 CTTGAGTAACAGTGGCAGGTGGG + Intronic
973829677 4:54746060-54746082 CTGGATTTACAGAGGGGTGTGGG + Intergenic
978290820 4:107137688-107137710 CTATGGTCACAGTGGGGGCTTGG + Intronic
979434605 4:120673703-120673725 CTGCAGCCACTGTGGGGGATGGG - Intergenic
985271583 4:188198489-188198511 CTGGGGTCATAGTGGCGAGTTGG - Intergenic
985652212 5:1112384-1112406 CTGGAGCAGGAGTGGGGGGTCGG - Intergenic
985915675 5:2917358-2917380 ATGGAGTAACAGTGAGGGGATGG - Intergenic
986306919 5:6522963-6522985 CTACAGTCACACTGGGGGTTGGG + Intergenic
987258119 5:16178933-16178955 CTGGAGGCAAACTGGGAGGTAGG + Intronic
987434922 5:17883244-17883266 CTGTGGTCACTGTTGGGGGTAGG + Intergenic
988113714 5:26855687-26855709 GTGGAGGCAGAGTGGTGGGTGGG + Intergenic
988774390 5:34464082-34464104 GTGGAGTCACAGAGGGTGGAAGG + Intergenic
990464124 5:56056216-56056238 CTGGCACCACAGTGGGGTGTGGG + Intergenic
991060814 5:62373769-62373791 TTAGAGACACAGTGGGGTGTGGG + Exonic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
994745809 5:103676922-103676944 CTGGAGGGAGAGTGGGGGCTTGG + Intergenic
995234260 5:109808047-109808069 CTCAAGTCATAGTGGGGAGTGGG - Intronic
995543109 5:113203288-113203310 GTGGAGGCACAGTCCGGGGTTGG + Intronic
996326998 5:122286483-122286505 CTGCAGTCACTGTGGAGGATGGG + Intergenic
996758810 5:126966171-126966193 CTGGAGGCAAAGTGGGTGTTGGG + Intronic
998150963 5:139757215-139757237 GTGGAGTCACAGAGTGGGCTGGG + Intergenic
998446733 5:142204645-142204667 CTGGAGACACAGTGTGGGGTTGG - Intergenic
998885862 5:146693036-146693058 CTGGCGTCAGAGTGGGGATTGGG - Intronic
999321818 5:150619863-150619885 CTGGGGTCACACAGGGGGCTGGG + Intronic
999897042 5:156045851-156045873 CTGTAGCCACAGTGGGAGTTAGG + Intronic
1000038503 5:157467154-157467176 CTGGAGACAAAGGGAGGGGTGGG + Intronic
1000663800 5:163969759-163969781 CTATAGTCACATTGGGGGTTAGG + Intergenic
1001676292 5:173519322-173519344 CTGGACTCACCCTGGGTGGTGGG + Intergenic
1002099357 5:176849755-176849777 GTGGAGGCAGAGTGGGGGCTGGG + Intronic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1005046771 6:21650684-21650706 ATGGAGACACAGCAGGGGGTGGG + Intergenic
1005259473 6:24042695-24042717 CTGCAGCCACTGTGGGGGCTGGG + Intergenic
1006054811 6:31376385-31376407 CTGGAATCACAGAGGGGTGTTGG + Intergenic
1006135443 6:31892973-31892995 CTGGAGCCCCAGGCGGGGGTGGG + Intronic
1006333855 6:33410665-33410687 TTGGAGTGACCATGGGGGGTGGG + Intronic
1006501746 6:34463826-34463848 CTGGAGTGGGAGTGGGGGGTGGG + Intergenic
1007227513 6:40325395-40325417 CTGGAGTTGCAGAGGAGGGTGGG + Intergenic
1007566707 6:42857115-42857137 CTGGTGTCACAGTGTGGGCTTGG - Exonic
1011601589 6:89065074-89065096 CTGGAGTTCCAGGGGGGCGTGGG + Intergenic
1013172382 6:107648417-107648439 CTGTAGTCACAGTGGGGAGAGGG + Intronic
1013422475 6:109978973-109978995 CTGGGGTCCCAGGGTGGGGTGGG + Intronic
1014750074 6:125245583-125245605 CTGCAGCCACTGTGGGGGTTGGG + Intronic
1015607757 6:134976738-134976760 CTGGAGACTCAGTAGCGGGTAGG + Intronic
1015693883 6:135957765-135957787 CTAGAGTCACCATGGGTGGTGGG - Intronic
1016409339 6:143765571-143765593 CTGGAGCCACAGGGGGTGGAGGG - Exonic
1016622169 6:146123613-146123635 CTGGAGGCACAGTTGGGTATTGG - Intronic
1016977417 6:149822962-149822984 CTGCAGTCACAATAGGGGTTAGG + Intronic
1017484406 6:154889665-154889687 ATGGAGACAAAATGGGGGGTGGG + Intronic
1017995381 6:159527637-159527659 CTGGAGCCACAGCCTGGGGTAGG - Intergenic
1018047673 6:159979562-159979584 CTGGTGGCAGAGTCGGGGGTTGG + Intronic
1018899288 6:168043235-168043257 CTGGAGTCTGAGTCGGGGGAGGG - Intronic
1018927664 6:168217603-168217625 CTGGGGTAACTGTGGGGTGTGGG + Intergenic
1019106500 6:169671857-169671879 CTGGAGACACAGTGGTGAATAGG - Intronic
1019779248 7:2929888-2929910 CTGGAGGGAGAGTGGGTGGTGGG + Intronic
1020799821 7:12719751-12719773 CCTGAGTCACTGTGGGTGGTGGG + Intergenic
1021570502 7:22059986-22060008 CTGGACTGACAGTGGGGAATTGG + Intergenic
1022102334 7:27175869-27175891 CTGGATTCACACTGGGAGGAAGG - Intronic
1023835091 7:44063199-44063221 CTGGAGTCACACTGGGCTGAGGG - Intronic
1023859976 7:44212749-44212771 CTGGGGCCACTGTTGGGGGTGGG + Exonic
1026306041 7:69142857-69142879 GTGGGGTCACAGGGTGGGGTTGG - Intergenic
1027425039 7:78053676-78053698 ATGGACTCACAGTTGGGGATTGG - Intronic
1029128652 7:98313128-98313150 GTGGGGTGACAGTTGGGGGTGGG - Intronic
1029505340 7:100960518-100960540 CTGAAGTCCTAGTGGTGGGTGGG - Exonic
1029747706 7:102525586-102525608 ATGGAGCCACAGTGGGGGCATGG + Intergenic
1029765657 7:102624676-102624698 ATGGAGCCACAGTGGGGGCATGG + Intronic
1031037623 7:116805360-116805382 CGAGAGTGAGAGTGGGGGGTGGG - Intergenic
1031731414 7:125306599-125306621 CTGGAGTCTTGGTGTGGGGTTGG + Intergenic
1031981603 7:128130526-128130548 CTGGAGTCAGGGTGGAGGTTAGG + Intergenic
1032096363 7:128940238-128940260 CTGGACTGACAGTAGGGGGCAGG + Intronic
1032152291 7:129439822-129439844 CTTGAGTCTCAGTGTGGGGAGGG - Intronic
1033098833 7:138453622-138453644 AGGGAGTGGCAGTGGGGGGTGGG - Intergenic
1035055913 7:156036395-156036417 CAGGAGGCACACTGGGGGTTGGG - Intergenic
1035312320 7:157977366-157977388 CTGGAGTGACAGGGGTGGGAGGG + Intronic
1035657729 8:1323473-1323495 CAGGAGCCACAGTGTGGGGTGGG - Intergenic
1035839718 8:2797361-2797383 CTAGAGTAACACTGGGGGTTTGG + Intergenic
1036018052 8:4808159-4808181 GTGGAGTCACAGAGGGCGGCAGG + Intronic
1036596246 8:10215015-10215037 ATGGAGTCACAGAGGAGGGTGGG + Intronic
1037231796 8:16668150-16668172 TTGGAGTTATAGTGGGGGTTTGG - Intergenic
1039442966 8:37608082-37608104 CTTGTGACACTGTGGGGGGTGGG + Intergenic
1039811137 8:41049277-41049299 CTGCAGTCACTGTGGGAGATGGG - Intergenic
1040529369 8:48253958-48253980 CTGCAGTCATTGTGGGGGATGGG + Intergenic
1041223190 8:55671868-55671890 CCAGAGTCACAGTGAGGGGAGGG + Intergenic
1041424417 8:57703964-57703986 CTGGAGCCACAGAGAGGGATGGG - Intergenic
1041763710 8:61394503-61394525 CTGCAGCCACTGTGGGGGATTGG + Intronic
1042653102 8:71065206-71065228 ATGCAGTCACATTGGGGGTTAGG - Intergenic
1045222008 8:100208251-100208273 ATGGAGTCACAGTGTTGGCTGGG + Intronic
1047350284 8:124067073-124067095 CTGGAGAGACAGTGGGGAGTAGG + Intronic
1048140643 8:131790962-131790984 ATGCAGTCACAGTGGAGGTTAGG + Intergenic
1049086057 8:140479460-140479482 CTGGGGTCCTGGTGGGGGGTGGG + Intergenic
1049231967 8:141489165-141489187 CGGCAGCCACAGTGAGGGGTGGG - Intergenic
1049470454 8:142773016-142773038 CTCGAGTCTCAGTGGGGTGATGG - Intronic
1049600423 8:143505001-143505023 CTCCAATCACAGTGAGGGGTCGG + Intronic
1049759069 8:144323756-144323778 CTGGAGACAGGGTGGCGGGTGGG - Intronic
1049917701 9:334462-334484 CTGGGGGCACAGTGAGGTGTGGG + Intronic
1049989872 9:980860-980882 CTGGAGGAAAAGTTGGGGGTAGG - Intronic
1053311666 9:37024638-37024660 CTGGCAGCACAGTGGGGGCTGGG - Intronic
1054833500 9:69651907-69651929 ATGCAGTCACATTGGGGGTTTGG - Intronic
1056938643 9:90936976-90936998 GTAGTGTCACAGTGGGGAGTGGG + Intergenic
1057034892 9:91804724-91804746 ATGGATTCAGAGTGGGGGGGTGG + Intronic
1057421893 9:94919473-94919495 CTGAAGCCAAAGTGGGGGGGTGG - Intronic
1057897817 9:98923896-98923918 ATGGTGTCACAGTGGAGGGTAGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058745242 9:107983966-107983988 CTGGAAACACAGTGGGAGGGAGG - Intergenic
1059747873 9:117220329-117220351 CTGGAGTCACCCTGGGCAGTTGG + Intronic
1061235434 9:129339491-129339513 CTTGAGCCCTAGTGGGGGGTAGG + Intergenic
1061322600 9:129840402-129840424 CTGGAGGCTCAGTGGGTGCTGGG + Intronic
1062551525 9:137089690-137089712 GTGGAGACACAGTGGAGGGCAGG + Intronic
1062622258 9:137428418-137428440 CTGGGGGCACAGTGGAGGGTGGG - Intronic
1062722867 9:138053595-138053617 GTGGAGCCATGGTGGGGGGTGGG - Intronic
1186917102 X:14234507-14234529 CTGGATTCACAGTGGCAAGTGGG + Intergenic
1188058972 X:25577057-25577079 CTGGAGCCAGGGTGGGGGTTAGG - Intergenic
1189224214 X:39398910-39398932 CTGGGGAGAGAGTGGGGGGTGGG + Intergenic
1191783661 X:64894692-64894714 CTGGAGTCAGAGTTGGGAGTAGG + Intergenic
1192583708 X:72304833-72304855 CTGGGGTCAGGGTGGGTGGTGGG - Intronic
1192597473 X:72426789-72426811 GTATAGTCACAGTGGGGGTTAGG - Intronic
1193928394 X:87520314-87520336 CTGGAGTCATATTGAGGGGATGG - Intronic
1194553797 X:95332927-95332949 CTGGAGCCACTGTTGGGGGCTGG - Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1196971184 X:121110132-121110154 CTGCAGCCACTGTGGGGGATGGG - Intergenic
1200274295 X:154717368-154717390 CTGGAGATGGAGTGGGGGGTGGG + Intronic