ID: 1128293566

View in Genome Browser
Species Human (GRCh38)
Location 15:66497791-66497813
Sequence TTTCCGGGAGTCGGCGGCGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128293566_1128293575 -7 Left 1128293566 15:66497791-66497813 CCATCGCCGCCGACTCCCGGAAA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1128293575 15:66497807-66497829 CCGGAAACCGAGCGGGGAGGCGG 0: 1
1: 0
2: 0
3: 12
4: 119
1128293566_1128293579 13 Left 1128293566 15:66497791-66497813 CCATCGCCGCCGACTCCCGGAAA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1128293579 15:66497827-66497849 CGGGGCTGCCCGACACATTGAGG 0: 1
1: 0
2: 0
3: 2
4: 49
1128293566_1128293572 -10 Left 1128293566 15:66497791-66497813 CCATCGCCGCCGACTCCCGGAAA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1128293572 15:66497804-66497826 CTCCCGGAAACCGAGCGGGGAGG 0: 1
1: 0
2: 1
3: 4
4: 96
1128293566_1128293576 -6 Left 1128293566 15:66497791-66497813 CCATCGCCGCCGACTCCCGGAAA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1128293576 15:66497808-66497830 CGGAAACCGAGCGGGGAGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 153
1128293566_1128293583 23 Left 1128293566 15:66497791-66497813 CCATCGCCGCCGACTCCCGGAAA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1128293583 15:66497837-66497859 CGACACATTGAGGAAAGGCGAGG 0: 1
1: 0
2: 0
3: 1
4: 100
1128293566_1128293577 -5 Left 1128293566 15:66497791-66497813 CCATCGCCGCCGACTCCCGGAAA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1128293577 15:66497809-66497831 GGAAACCGAGCGGGGAGGCGGGG 0: 1
1: 0
2: 0
3: 12
4: 211
1128293566_1128293580 18 Left 1128293566 15:66497791-66497813 CCATCGCCGCCGACTCCCGGAAA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1128293580 15:66497832-66497854 CTGCCCGACACATTGAGGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128293566 Original CRISPR TTTCCGGGAGTCGGCGGCGA TGG (reversed) Exonic
902940940 1:19799851-19799873 TTACCTGGAGGCGGCTGCGAAGG + Exonic
904762700 1:32817303-32817325 TTCCCGGCACGCGGCGGCGACGG - Exonic
913975068 1:143449542-143449564 CTTCCGGAAGTCGGCGTTGAAGG + Intergenic
914069460 1:144275158-144275180 CTTCCGGAAGTCGGCGTTGAAGG + Intergenic
914109695 1:144691196-144691218 CTTCCGGAAGTCGGCGTTGAAGG - Intergenic
917058446 1:171010094-171010116 TTTCAGGGAGTTGGGGGCTAGGG - Intronic
1071835735 10:89415232-89415254 TTTCCCGGAGGCGGCGGCCGCGG - Intronic
1077389876 11:2295577-2295599 TTTCCAGGAGTCAGTGGGGAGGG + Intergenic
1081851551 11:46278093-46278115 GTCCCGGGAGCCGGCTGCGATGG + Exonic
1086608997 11:88730863-88730885 TGTCAGGGAGTCGGGGGCTAGGG + Intronic
1091214788 11:133894064-133894086 TTTCCAGGGGTGGGGGGCGAAGG + Intergenic
1091422160 12:351205-351227 TGTCCGGGAGTAGGGGGCTAGGG - Intronic
1094564938 12:31590855-31590877 TTCCCGGGCGGCGGCGGCGGCGG - Exonic
1096675044 12:53221704-53221726 TTTCCGGGAGTCGCCGCTGCTGG - Intronic
1113200742 13:107866175-107866197 TCCCCGGGAGACGGCGGCGGCGG - Exonic
1114037906 14:18646470-18646492 CTTTCGGGAGGCGGCGGCGGCGG - Intergenic
1122647951 14:103207427-103207449 TGTCCGGGACGCGGCGGGGAGGG - Intergenic
1124398012 15:29321820-29321842 TTTGGGGGAGTGGGCGGGGAGGG + Intronic
1126436766 15:48645327-48645349 TCGCCCGGAGTCGGCGGGGACGG - Intronic
1128293566 15:66497791-66497813 TTTCCGGGAGTCGGCGGCGATGG - Exonic
1132718048 16:1301797-1301819 TTTCCGGGATGCAGCGGTGAAGG - Intergenic
1140328363 16:74028016-74028038 TCTTTGGGAGTCGGGGGCGAGGG + Intergenic
1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG + Exonic
1145110391 17:20156567-20156589 TTTCCGGGCGTTTGCGGGGAGGG + Intronic
1146187267 17:30731957-30731979 CTTCGGGGGTTCGGCGGCGACGG + Intergenic
1146763505 17:35498165-35498187 GATCCGGGAGGCGGCGGCGTGGG + Intronic
1148126971 17:45242080-45242102 CCTCCGGGAGGCGGCGGCGGCGG - Exonic
1156275326 18:35578411-35578433 CTTCCGGGAGTCGGGGGCTGTGG + Intergenic
1160897204 19:1408348-1408370 AAGCCGGGAGGCGGCGGCGACGG - Intronic
1163662996 19:18589559-18589581 CTCCCGCGAGGCGGCGGCGAAGG - Exonic
1166094149 19:40529311-40529333 TTTCCCGGAGTCGGCGTGGGCGG - Intronic
1166117168 19:40663167-40663189 TCTCCGGGAGCCGGCCGCGCAGG - Intergenic
927472317 2:23385557-23385579 CTGCCGGGAGGCGGCGGCGGCGG + Exonic
934290062 2:91684776-91684798 CTTCCGGAAGTCGGCGTTGAAGG + Intergenic
947800574 2:232927063-232927085 TCTCCAGGAGTCGGCGGGAATGG + Exonic
1168757401 20:326562-326584 TGTCGGGGAGGCGGCGGCGGCGG - Exonic
1170691713 20:18622229-18622251 TTTCAGGGGGTCGGGGGCAAGGG - Intronic
1171971544 20:31568189-31568211 TCTGCGGGCGCCGGCGGCGAGGG - Exonic
1179561776 21:42219862-42219884 ACTCGGGGAGGCGGCGGCGAAGG + Intronic
1180462033 22:15573512-15573534 CTTTCGGGAGGCGGCGGCGGCGG - Intergenic
1181917029 22:26289725-26289747 TTTCATGGAGTTGGCGGCGGTGG - Intronic
1185413378 22:50697398-50697420 CTCCCGGGGGTCGGCGGCGAGGG + Intergenic
960602175 3:119469174-119469196 TTCCCGGGAGCCGGCCGCGCGGG - Intronic
964021970 3:152023236-152023258 TGTCAGGGAGTCGGGGGCTAGGG + Intergenic
964087384 3:152834892-152834914 GCTACCGGAGTCGGCGGCGAGGG - Exonic
969674579 4:8607781-8607803 TTTCCGGGAGGCGCCGGCAGAGG + Intronic
974280482 4:59785287-59785309 TTTCAGGGGGTCGGGGGCCAGGG + Intergenic
975743736 4:77455676-77455698 TGTCCAGGAGTCGGGGGCTAGGG - Intergenic
977205574 4:94161679-94161701 TGTCCGGGGGTCGGGGGCAAGGG - Intergenic
979349664 4:119628962-119628984 TTCCCAGGAGGCGGCGGCGGCGG + Exonic
980583324 4:134783102-134783124 TTTCGGGGAGTGGGTGGCTAGGG - Intergenic
986051059 5:4090706-4090728 TGTCGGGGAGTCGGGGGCTAGGG + Intergenic
989571617 5:42951181-42951203 TTACCGGGCGGCGGCGGCGCTGG - Intergenic
998334364 5:141357473-141357495 CTTCCGCGAGTCCGCGGTGAGGG - Exonic
998337430 5:141385172-141385194 CTTCCGAGAGTCCGCGGTGAGGG - Exonic
998338498 5:141395086-141395108 CTTCCGCGAGTCGGCGGTGAGGG - Exonic
1001315638 5:170639432-170639454 CTCCAGGGAGTCGGTGGCGAGGG + Intronic
1005701205 6:28402065-28402087 TTTCAGGGCGTCTGCGGAGAAGG + Intergenic
1008799981 6:55355220-55355242 TGTTAGGGAGTCGGGGGCGAGGG + Intronic
1011886070 6:92097062-92097084 TTTCAGGGAGTAGGGGGCTAGGG + Intergenic
1014902822 6:126988500-126988522 TGTCCGGGAGTGGGGGGCAAGGG + Intergenic
1015393539 6:132710518-132710540 TGTCGGGGAGTCGGGGGCTAAGG - Intronic
1022466514 7:30656086-30656108 TTTCCAGGGGTCTGCGGGGAAGG - Intronic
1022971626 7:35522974-35522996 TTTGTGGGAGTTGGGGGCGAGGG - Intergenic
1023051301 7:36254274-36254296 TGTCAGGGAGTCGGGGGCTAGGG - Intronic
1024629977 7:51238860-51238882 TTCCCGGGAGTCCCCGGTGAAGG + Intronic
1026765216 7:73155596-73155618 TTTCGGGGAGGGGGCTGCGATGG - Intergenic
1027041690 7:74965352-74965374 TTTCGGGGAGGGGGCTGCGATGG - Intronic
1027081952 7:75237017-75237039 TTTCGGGGAGGGGGCTGCGATGG + Intergenic
1027570443 7:79859446-79859468 TTTCCGGGGGTGGGGGGCTAGGG + Intergenic
1033236525 7:139642287-139642309 TGACCGGGAGTGGGAGGCGAGGG + Intronic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1042039297 8:64576072-64576094 TTTGTAGGACTCGGCGGCGAAGG + Intergenic
1042997488 8:74717154-74717176 TTTCAGGGGGTCGGGGGTGAGGG - Intronic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1045041193 8:98226632-98226654 TTGCCTGGAGTTGGGGGCGAGGG + Intronic
1047874769 8:129123738-129123760 TTTCCAGGAGTGGGGGGCGAGGG - Intergenic
1049522601 8:143101921-143101943 GTGCCGGGAGTCGGTGGCGATGG + Intergenic
1061517274 9:131097016-131097038 CTACCTGGAGTCGGAGGCGACGG - Intronic
1061714547 9:132510455-132510477 TTTCCGGGACACGGAGGAGATGG + Intronic
1062147458 9:134997521-134997543 TTTCCGGGAGTCTGTGGCCTGGG + Intergenic
1186426113 X:9465270-9465292 TCTCCGGGACTCGGCGGCGGCGG + Exonic
1199612733 X:149631765-149631787 TCTCCGGGCGGCGGCGGCGGCGG - Exonic
1200746842 Y:6910806-6910828 TTTCCGGGACTCCGCGGCGGCGG + Exonic