ID: 1128300219

View in Genome Browser
Species Human (GRCh38)
Location 15:66561998-66562020
Sequence CATGGCAAAGAGGGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 376}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128300219_1128300233 30 Left 1128300219 15:66561998-66562020 CCAGCTTCCCCCTCTTTGCCATG 0: 1
1: 0
2: 0
3: 31
4: 376
Right 1128300233 15:66562051-66562073 ACCTCCTGCCCAAACCTTCCAGG 0: 1
1: 0
2: 2
3: 30
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128300219 Original CRISPR CATGGCAAAGAGGGGGAAGC TGG (reversed) Intronic
900831476 1:4968928-4968950 GATGGCCATGAGGAGGAAGCCGG + Intergenic
900911155 1:5597824-5597846 CAAGGCAAGGAGGGGAAACCAGG + Intergenic
901036396 1:6338699-6338721 CATGGGGAAGAGGAGGAAACCGG + Intronic
901193399 1:7425872-7425894 CAGGGAGAAGATGGGGAAGCTGG - Intronic
902200173 1:14827403-14827425 CAGGGCAAAGGGTGGGAAGCAGG - Intronic
902203368 1:14850572-14850594 CATGGCAGTGAGGTGGAAGGTGG - Intronic
902380558 1:16050449-16050471 CATCCCAAGGAGAGGGAAGCAGG - Intronic
903306589 1:22417301-22417323 CATTTCACAGAGGGGGAAACTGG - Intergenic
903479658 1:23644131-23644153 CTTGGGTAAGAGGGGGATGCAGG - Intergenic
903950331 1:26992948-26992970 CATTTTAAAGAGGGGGAAACTGG - Intergenic
904317077 1:29672500-29672522 CTTGGCAAAGAAAGGCAAGCAGG + Intergenic
904368928 1:30036153-30036175 CATGGCACTGGGTGGGAAGCAGG - Intergenic
904617905 1:31759898-31759920 CATTGCACAGAGAGGGAAACAGG - Intronic
904928366 1:34066348-34066370 CAAGGCAGAGAGGGGGATGCAGG - Intronic
906039580 1:42777867-42777889 GAGGGGACAGAGGGGGAAGCAGG - Intronic
906282427 1:44563408-44563430 CAGGGCCAAGGGAGGGAAGCGGG - Intronic
907073777 1:51560756-51560778 ACTGGCAGAGAGAGGGAAGCTGG + Intergenic
907275024 1:53312165-53312187 CAGGGCAGAGATGGGGAAACAGG + Intronic
907299877 1:53480182-53480204 CATGGCAAAGAAGCAGCAGCAGG + Intergenic
908151863 1:61310749-61310771 GAAGGAAAAGAGGGAGAAGCAGG - Intronic
908735715 1:67274387-67274409 CATTGCAAAGAGGGTGATGTAGG - Intergenic
910461439 1:87451890-87451912 CCAGGCAATGAGGGGGAAGATGG - Intergenic
912040839 1:105388042-105388064 CAGGGCAAAAAGGTGGAATCTGG - Intergenic
913053109 1:115134094-115134116 CCTGGCTCAGAGTGGGAAGCAGG + Intergenic
913656099 1:120961609-120961631 CATGACAAACAGAAGGAAGCAGG - Intergenic
914520657 1:148412841-148412863 CATGACAAACAGAAGGAAGCAGG - Intergenic
914916095 1:151820126-151820148 CAGGGGAAGGAGGGGGGAGCAGG - Intronic
915112121 1:153570690-153570712 GAGGGCAGAGCGGGGGAAGCAGG - Intergenic
915123106 1:153644930-153644952 CAGGGCAAAGAGGAGAAATCTGG - Intronic
915675231 1:157523725-157523747 CAGGGCAGAGAGTGGGGAGCAGG - Intronic
918571909 1:186004830-186004852 GATGGCAAAGATGGGAAAGCTGG + Intronic
920500033 1:206480131-206480153 CTGGGCACAGAGGGGGAGGCGGG + Intronic
922900110 1:229130076-229130098 AATGGCACAGAGGAGGAAGCTGG + Intergenic
923850829 1:237792533-237792555 GATGGGACAGAGGGGAAAGCTGG + Intronic
924736393 1:246760818-246760840 CATTCCACAGAGGGGGAAACGGG - Intronic
924919605 1:248613842-248613864 AAGGGCACAGAGTGGGAAGCTGG + Intergenic
1062857759 10:787948-787970 AATGGCAAAGAGGCGGGAGCAGG + Intergenic
1063067412 10:2623750-2623772 CATGACAGGGAGAGGGAAGCAGG + Intergenic
1063622309 10:7660723-7660745 CATGGGAAAGAATGGGAGGCAGG + Intronic
1063872088 10:10428658-10428680 CAAGGAAAAGAGTGGGAAGAGGG - Intergenic
1065669433 10:28099224-28099246 CATGTAAATGAGGGGGAAGTGGG + Intronic
1066195911 10:33099737-33099759 CAAGGCAAAGAGGGGAGACCAGG - Intergenic
1066239861 10:33523152-33523174 CAGGGAAAAAAGTGGGAAGCTGG + Intergenic
1066475403 10:35741968-35741990 TATGGCAAAGAGGTAGAGGCAGG + Intergenic
1068297884 10:55098565-55098587 CTTGGCAAATAGAGGGAAGATGG - Intronic
1072554430 10:96503965-96503987 CATGGCGTAGAGGGGAAAACAGG + Intronic
1074516272 10:114173747-114173769 GGTGGCAAAGAGGGGTCAGCGGG - Intronic
1074781767 10:116807361-116807383 CAGGGGTAAGAGGGGAAAGCAGG - Intergenic
1074925739 10:118068558-118068580 CACAGCAAATAGGGGGAAGGGGG - Intergenic
1076524189 10:131100956-131100978 AGTGGGAAAGAGGAGGAAGCAGG - Intronic
1077444372 11:2583502-2583524 GATGGCAAAGACAGAGAAGCAGG - Exonic
1077736640 11:4798656-4798678 TATGGCATAGAGGAGGAAGTGGG + Intronic
1077910170 11:6566364-6566386 CATGGCACAGAGGGAGAGGGTGG - Exonic
1078619113 11:12891562-12891584 CCTGGAACAGAGGAGGAAGCAGG + Intronic
1078720657 11:13880678-13880700 CAAGGTAATGAGAGGGAAGCTGG - Intergenic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079444359 11:20545961-20545983 GATGGGAAAGAGGAGAAAGCAGG - Intergenic
1079795573 11:24798709-24798731 AATGGCAAGCAGGGGGAAGCAGG - Intronic
1080053496 11:27881295-27881317 CATGGCAAAGAGGGAGAGAGAGG - Intergenic
1080392592 11:31861962-31861984 CATCTCAAAGAGCGGGAAGTGGG - Intronic
1080693933 11:34584439-34584461 TATGGTAAAGAGGGGGGAACAGG + Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083171601 11:60926727-60926749 CATGGCAATGATGGGGGAGGAGG + Intronic
1083840380 11:65301145-65301167 CAAGGCAAAGAGAGGGAGGGAGG + Intronic
1084162130 11:67355667-67355689 CCAGGCAAAGCTGGGGAAGCTGG - Intronic
1085034617 11:73292606-73292628 CAGGGGAAAGAGGGGGATGGGGG - Intronic
1085176259 11:74491083-74491105 CATGCCAAAGAGAGACAAGCTGG - Intergenic
1085417804 11:76330834-76330856 CATGGCAGTGATGGGTAAGCAGG - Intergenic
1085478250 11:76801402-76801424 CATGGCAAGGTGGGGAAACCAGG - Intergenic
1085497552 11:76984964-76984986 AATGGCAAAAAGAGGGAAGGGGG - Intronic
1085834444 11:79937391-79937413 AAAGGCAGAGCGGGGGAAGCAGG - Intergenic
1087466191 11:98509711-98509733 CAGGGGAAAGAGTGGGAAGGAGG - Intergenic
1088347368 11:108842914-108842936 GATGGCAAGGAAGGGGAAGAGGG - Intronic
1088373135 11:109113076-109113098 CATGGCAGGGAAGGGGAAGGGGG - Intergenic
1088442667 11:109889011-109889033 CAAGGAAAAGAGGGGTAAGGAGG - Intergenic
1091625160 12:2115942-2115964 CATGGCACAGAAGGGAAAGAAGG - Intronic
1091808084 12:3370460-3370482 CATTTTAAAGATGGGGAAGCGGG - Intergenic
1092197800 12:6560411-6560433 CATGGCAGAGCAGGGGAGGCTGG - Intronic
1092955172 12:13542915-13542937 AATGGCAATGAGGGGCAAGAAGG - Exonic
1093709884 12:22318549-22318571 CAGGGAAAAGAGGGGGAAGGAGG - Intronic
1094276644 12:28684665-28684687 CATGCCAAAGAGAGGAAAGTAGG - Intergenic
1095628300 12:44343948-44343970 CATGGCAAGGAGCCAGAAGCCGG + Intronic
1095639630 12:44472940-44472962 AATGGCACAGAGTGGCAAGCTGG - Intergenic
1096677235 12:53232322-53232344 CAGGGCACAGAGGAGGGAGCCGG - Intronic
1096809813 12:54162078-54162100 CATGGCAAAGAGAAGGGAGCAGG + Intergenic
1098196331 12:68005692-68005714 GATGGGAAAGAGTGGGAAGAAGG + Intergenic
1098230782 12:68370138-68370160 GAAGGCAAAGAAAGGGAAGCAGG + Intergenic
1101836833 12:108301834-108301856 CAGGGCAGAGAGGTGGAGGCTGG - Intronic
1102339327 12:112109174-112109196 CAGGGGAAAGTTGGGGAAGCGGG + Intergenic
1102819365 12:115894848-115894870 CTGAGCAAAGAGAGGGAAGCAGG + Intergenic
1103164612 12:118759561-118759583 CATGTCTCAGAGGGGAAAGCTGG - Intergenic
1106548265 13:30749327-30749349 CATGAGAAAGAGAAGGAAGCAGG + Intronic
1106644089 13:31614382-31614404 AAGGGCAAAGAGGTGGAAGTGGG - Intergenic
1106762939 13:32884923-32884945 CATGGCAGAGAGAAGAAAGCTGG + Intergenic
1106888514 13:34216726-34216748 CATGGCCAAGAGGGCGCAGGGGG + Intergenic
1107383071 13:39877631-39877653 CATGGCAAAGAGGGGAAGGTGGG - Intergenic
1108617737 13:52150767-52150789 AATGGCAAAGGGTGAGAAGCAGG - Intronic
1108709261 13:53016937-53016959 CTTGGTAAAGAGGGCAAAGCTGG + Intergenic
1108775810 13:53763614-53763636 AATGGCACAGAGTGGCAAGCTGG + Intergenic
1109986303 13:69990360-69990382 AAAGGCAAAGAGTGGCAAGCTGG + Intronic
1110570765 13:77000474-77000496 AATGGCAAAGTGGGTGAAACAGG + Exonic
1110630356 13:77698775-77698797 CATGGCAGATGGGGGGAAGGGGG - Intronic
1111068204 13:83125819-83125841 CAAGGCAAGAAGGGAGAAGCTGG + Intergenic
1111324038 13:86668018-86668040 CAGGTCAAAGTGGGAGAAGCAGG - Intergenic
1112445334 13:99459173-99459195 CATGGCAATGACAGGGAAACTGG - Intergenic
1114223146 14:20714935-20714957 GATGCCACAGAGGGGGAAGGAGG + Intergenic
1114573764 14:23694378-23694400 CTTGGCAAAGGGGGGTAGGCTGG - Intergenic
1116794421 14:49374362-49374384 CATGGCAAAGAGGGTGAGAAAGG - Intergenic
1117079108 14:52133124-52133146 AATGGAAAAGAGTGGGAACCGGG + Intergenic
1117271259 14:54146203-54146225 CATGGCAGAGAGGGAGAGGCAGG + Intergenic
1118461066 14:65987501-65987523 CATTGCAAAGAGTGGGAGGAGGG + Intronic
1118979071 14:70701601-70701623 TAGGGAAAAGAGGGGGAAGAGGG + Intergenic
1119848075 14:77845839-77845861 CATGGAAAAGAAAGAGAAGCAGG - Intronic
1120913673 14:89690743-89690765 AAGGGCAAAGAGGAGGAAGCAGG + Intergenic
1121427772 14:93864931-93864953 CATGGCAAAGAGGGAGCTGATGG + Intergenic
1124830215 15:33141540-33141562 TATGGGAAAGTGAGGGAAGCAGG + Intronic
1126753028 15:51896716-51896738 CATAGGAAGGAGGGGGAAGCTGG - Intronic
1127620281 15:60727241-60727263 AATTGCAAAGAAGGGGAAGGAGG - Intronic
1128300219 15:66561998-66562020 CATGGCAAAGAGGGGGAAGCTGG - Intronic
1128344568 15:66845359-66845381 CATGAAAAAGTGGGGGTAGCGGG + Intergenic
1129324534 15:74793197-74793219 CATTGCACAGATGGGGAAGCTGG + Intronic
1129665528 15:77577494-77577516 CATGGCCTAGAGGGGGAGGCCGG - Intergenic
1129707313 15:77802068-77802090 CGAGGAAAAGAGGGAGAAGCTGG + Intronic
1129798476 15:78395909-78395931 CAAGGCAGAGAGAGGGAAGGTGG + Intergenic
1129854719 15:78815033-78815055 CCTGGGACAGAGGAGGAAGCAGG - Intronic
1130081529 15:80738140-80738162 CTTGGGAAAAAGGGAGAAGCTGG + Intronic
1130139606 15:81213824-81213846 AAAGGCACAGAGGGGCAAGCTGG - Intronic
1130270630 15:82445199-82445221 CAAGGCGAGGAGGGGGCAGCCGG + Intergenic
1130489700 15:84422266-84422288 CAAGGCGAGGAGGGGGCAGCCGG - Intergenic
1130727965 15:86460693-86460715 CAAGGCAAAGAAGATGAAGCTGG + Intronic
1130995217 15:88899621-88899643 AATGGCAAAGGGTGGGCAGCTGG + Intronic
1131457859 15:92597308-92597330 CAAGGCAAAGAGAGAGAAGGAGG + Intergenic
1132094082 15:98969277-98969299 CACAGCAAAGAGGGGCAATCTGG + Intronic
1132095308 15:98980029-98980051 GATGGGAAAGGGTGGGAAGCAGG + Intronic
1132271721 15:100532179-100532201 GATGGGGAAGAAGGGGAAGCGGG + Intronic
1132462105 16:60577-60599 CAGGGCAATGAGGGGCACGCAGG + Intronic
1133331853 16:4979820-4979842 GATGGCAGAGAAGGGGATGCAGG - Intronic
1133741311 16:8653766-8653788 CTTGGAAATGATGGGGAAGCAGG - Intergenic
1133870538 16:9681717-9681739 CAGGGCAGAGAAGCGGAAGCTGG + Intergenic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1138527595 16:57618000-57618022 CATGGGGAAGAGGGGCAAGAGGG + Intronic
1138553108 16:57757815-57757837 CAGGGCAAAGAGTGGGCAGTGGG + Intergenic
1139556858 16:67717844-67717866 CATGGCAAAGTGGGAAAACCAGG + Intronic
1139706308 16:68743055-68743077 CCTGGCAGAGAGGGGCAGGCAGG - Intronic
1140029205 16:71321125-71321147 CATGGGAAGGAGGGAGAAGAAGG + Intergenic
1140411172 16:74741242-74741264 CATGGCAGGGAGCTGGAAGCTGG + Intronic
1141329309 16:83094247-83094269 AATGACAAAGAGGGCAAAGCAGG - Intronic
1142510480 17:389654-389676 CCTGGTCAAGAGTGGGAAGCGGG - Intergenic
1142803866 17:2361585-2361607 CCTGGGAAAGACGGGGGAGCAGG - Intronic
1143476046 17:7204567-7204589 GATGGCAAAGAGTGGGGAGAGGG + Intronic
1144096142 17:11902419-11902441 CATGGAAAAGAGGGGCAAGAAGG - Intronic
1144239732 17:13298519-13298541 CATGGCCCGGAGGGGGAAGGGGG + Intergenic
1145798608 17:27669772-27669794 CAGGGCCAAGAGGAGGAAGCAGG + Intergenic
1146282608 17:31554744-31554766 CCTGGGAAAGGGTGGGAAGCAGG + Intergenic
1146430649 17:32790763-32790785 CAGGGCAAAGAGAGAGAAGAGGG + Intronic
1146456952 17:33015990-33016012 CTTGGCAAAGAGGAGGACGAAGG - Exonic
1146515105 17:33483031-33483053 GATGGCAAAGAGGCAGAAGCGGG + Intronic
1147033488 17:37661326-37661348 CATGCCACAGAGGAGGAAACTGG - Intergenic
1147321149 17:39646878-39646900 CCTGGGTTAGAGGGGGAAGCGGG - Intronic
1147424161 17:40337858-40337880 CCAGGGAAAGAGTGGGAAGCAGG - Intronic
1147562582 17:41518296-41518318 GATGTCAAAGAGAGGGGAGCAGG - Intronic
1149016518 17:51914642-51914664 CATGGCAAAGAGAAGGAAATTGG + Intronic
1151434572 17:74086976-74086998 CATTGGGAAGAGGGGGATGCTGG - Intergenic
1151553722 17:74836296-74836318 CACGGCAATGATGGGGAAGTTGG - Exonic
1152298564 17:79482522-79482544 CTTGGCAAGGAGGGGGCTGCTGG + Exonic
1152494154 17:80659245-80659267 CATGGCTCCGAGGGGGAAGTGGG + Intronic
1152882285 17:82825180-82825202 AATGACAAATAGGGAGAAGCAGG - Intronic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1155286364 18:24293243-24293265 CCTGGCACAGAGGGGGAAAGGGG + Intronic
1155495687 18:26439620-26439642 CAAGAAAAAGAGGAGGAAGCTGG - Intergenic
1156344989 18:36249043-36249065 GCTGGCACAGAGGGGGAAGAGGG + Intronic
1156352456 18:36312646-36312668 CATGGACCAGAGGGAGAAGCAGG - Intronic
1157600490 18:48890209-48890231 CAGGGCAGAGAGGGGGAGGCCGG - Intergenic
1158079886 18:53577278-53577300 CAGGAGAAAGAGAGGGAAGCAGG - Intergenic
1158163043 18:54507635-54507657 CATGGCACTGAGGGGGACGCTGG + Intergenic
1158307934 18:56127011-56127033 CATGGAAAAGAGGGAGGAGATGG + Intergenic
1158622178 18:59042403-59042425 CAGTGCTAAGAGGAGGAAGCAGG - Intergenic
1158999956 18:62964627-62964649 CATGGAAATGAGGGAGTAGCTGG - Intronic
1159093975 18:63881162-63881184 CATAGCAAAGCGGGGAAAGCAGG + Intronic
1159600058 18:70420553-70420575 CATGACAAATAGGAGGATGCAGG + Intergenic
1161033300 19:2069944-2069966 CATGGCAGAGAGGGGCAGCCCGG - Intergenic
1161088428 19:2345524-2345546 AATGAGAAAGAGGGGGATGCAGG - Intronic
1161088458 19:2345638-2345660 AATGAGAAAGAGGGGGATGCAGG - Intronic
1161152756 19:2718201-2718223 CTGGGAAGAGAGGGGGAAGCTGG - Intronic
1162151117 19:8646362-8646384 CATTGCACAGATGAGGAAGCTGG + Intergenic
1163241338 19:16065722-16065744 CATGACAAAGAGAAGGAAGCTGG + Intergenic
1164803594 19:31098698-31098720 CATGGGAACCAGGAGGAAGCAGG - Intergenic
1164858223 19:31541920-31541942 CATGGAAAAGAGGAGGCAGAAGG + Intergenic
1165762070 19:38327268-38327290 CAGGGCACGGAGGGGGCAGCAGG - Exonic
1166514225 19:43433875-43433897 CATTTTAAAGATGGGGAAGCTGG - Intergenic
1166542855 19:43617095-43617117 CAGGCCAAAAAGGGGGAAGGAGG - Intronic
1166672435 19:44718976-44718998 CAGGGCAAAAAGGGAGAAGAAGG + Intergenic
1167557328 19:50204354-50204376 TGTGGCATAGATGGGGAAGCAGG + Intronic
1168629916 19:57948549-57948571 CATGACAAAGAGGATGAAGGTGG + Intergenic
924979331 2:206963-206985 CATGGGAAAGAGAGGGAAACTGG + Intergenic
926238748 2:11069182-11069204 CTTGGCACAGAGAAGGAAGCGGG - Intergenic
927309114 2:21608382-21608404 CATGGCAGAGAGGCTGAAGGAGG - Intergenic
927558711 2:24053792-24053814 CATGGCATGGAGGGGAATGCAGG + Intronic
928161053 2:28924746-28924768 AATGGGACAGAGGGGGAAGTAGG + Intronic
928435235 2:31250684-31250706 CATGGCACAGAGAGGGTAGTGGG - Intronic
928947028 2:36780839-36780861 CATGGAAAAGAGAGGAAAGGAGG + Intronic
931205139 2:60139627-60139649 CCTGGGAATGAGGGTGAAGCGGG - Intergenic
931340744 2:61398506-61398528 CAGGGGAAGGAGGCGGAAGCGGG + Intronic
931647953 2:64442367-64442389 CATGAGAAAGAGGGTGAAGAAGG - Intergenic
932183186 2:69668094-69668116 CAAGGCAAAGAGTGTGGAGCCGG + Intronic
934767268 2:96886654-96886676 CCTGGCAAAGACAGGGAAGAAGG + Intronic
936050927 2:109223092-109223114 CATCCCAGACAGGGGGAAGCAGG + Intronic
937102603 2:119283256-119283278 CATGACAAAGAATGGGAGGCAGG - Intergenic
938399271 2:130975540-130975562 CAAGGCAAAGTGGGGCAGGCAGG - Intronic
940372309 2:152917045-152917067 CATGGCAAAAAGGAGGAACACGG - Intergenic
940434398 2:153633632-153633654 CATGGCAAAGAGGAACAAGCTGG - Intergenic
941389780 2:164897477-164897499 AATGGGAGAGAGGGGAAAGCAGG - Intronic
942653906 2:178194945-178194967 CCTGGCAACGAGGGGGAGGGAGG - Intronic
944054487 2:195509328-195509350 CATTGCACAGATGGAGAAGCTGG - Intergenic
945030978 2:205663462-205663484 CATGGAAAAGAAGGGGAGGTAGG - Intergenic
945205805 2:207330931-207330953 CATGGCAAGGAAGGGGCAGAAGG + Intergenic
946009011 2:216549865-216549887 AATGGAATAGAAGGGGAAGCAGG + Intronic
946185876 2:217980056-217980078 CATGGGGAAGGGGGAGAAGCTGG + Intronic
947058952 2:226140028-226140050 CATGGCACAGAGCAGGAAGGTGG - Intergenic
948125779 2:235563920-235563942 CATGGCTATCAGTGGGAAGCTGG + Intronic
948575061 2:238944439-238944461 CATGGCAATGAGTGGCAAGTTGG + Intergenic
948796762 2:240407322-240407344 CATGGACAAGAGAGTGAAGCGGG - Intergenic
948826118 2:240574136-240574158 CATGGCCACGATGGGGAAGGAGG - Exonic
1168953906 20:1820955-1820977 CATTGAGAAGATGGGGAAGCTGG - Intergenic
1169149960 20:3281807-3281829 CATTGCAAAGTGGAGGAAGAGGG + Intronic
1169975129 20:11316674-11316696 CATGGAGAAGAGGAGGAAGTTGG + Intergenic
1170948857 20:20915948-20915970 CAAGGAAAAGAGAGAGAAGCAGG - Intergenic
1171163611 20:22951391-22951413 CAAGGCAAAGAGGAAGAAGATGG + Intergenic
1172010343 20:31842805-31842827 CATGGTGAGGAGGGGGAAGGAGG - Intergenic
1172882116 20:38208866-38208888 CAGTGCACAGAGAGGGAAGCAGG + Intergenic
1172905246 20:38364283-38364305 CAAGGCAAAGTAGGGGAAGAAGG - Intronic
1174190410 20:48736487-48736509 CATGGCAAGGAAGGAGAAGAGGG + Intronic
1174457753 20:50661754-50661776 CCTGGGAGAGAAGGGGAAGCTGG + Intronic
1174942198 20:54941386-54941408 CCTGGAAAAATGGGGGAAGCTGG - Intergenic
1174951829 20:55050793-55050815 GATGGGAAGGAGAGGGAAGCGGG + Intergenic
1175761134 20:61562695-61562717 CATGGCAAGGTGGGAGCAGCTGG - Intronic
1175832454 20:61973689-61973711 CACGGCCTAGAGCGGGAAGCTGG + Intronic
1175882985 20:62271234-62271256 CATGGCTTAGTGGGGGAAGCTGG - Intronic
1176265201 20:64205568-64205590 CCTGGCCAAGAAGAGGAAGCTGG + Exonic
1178000000 21:28150311-28150333 CCTGCCGCAGAGGGGGAAGCTGG - Intergenic
1178117383 21:29431414-29431436 CATGGAAAGGAGGGGGTAGAGGG - Intronic
1179573162 21:42290153-42290175 CATGGAGAAGAAGAGGAAGCCGG - Exonic
1181891653 22:26068707-26068729 CATGGGAAAGACGGGTAAGTGGG + Intergenic
1182015455 22:27035605-27035627 CATGTCAAATTGGGGGATGCAGG - Intergenic
1182026443 22:27122973-27122995 GATGGCAAAGAACGAGAAGCTGG + Intergenic
1182421126 22:30249060-30249082 CATGGACAGGAGGGGGAGGCTGG - Intergenic
1183259958 22:36788250-36788272 CCTGGCAGAGGGGAGGAAGCTGG + Intergenic
1183829239 22:40409220-40409242 CATGGCCAGGAGTGGGGAGCAGG - Intronic
1184281377 22:43439533-43439555 CACAGCAAAGAGGAGGAAACAGG - Intronic
949838756 3:8297637-8297659 CATGGCAAAGAGAGGGAGGGGGG + Intergenic
950525914 3:13523184-13523206 CACGGGAAGCAGGGGGAAGCTGG - Intergenic
951157194 3:19370075-19370097 CAAGGCAAAGAGGAAGAAGGTGG - Intronic
952505599 3:34004421-34004443 CATGGCAAAGGGTGGGATACAGG + Intergenic
955694512 3:61622316-61622338 CAAGGTAAAGAAGGGGGAGCTGG + Intronic
955796755 3:62645194-62645216 CAGGGGAAAGAGTGGGAAGGGGG + Intronic
956784941 3:72634772-72634794 CAAGACACAGAGAGGGAAGCTGG - Intergenic
958502439 3:94930706-94930728 GATGGAAAAGAGAGGGAAGGAGG - Intergenic
960183904 3:114615425-114615447 CAAGGCAAAGAAGGGCAAGTTGG + Intronic
960960672 3:123068107-123068129 TATGGAAAAGATGGGGAAGGAGG - Intronic
961214662 3:125149733-125149755 GATGGCAAAGTGGGGGCAGAGGG + Intronic
961313175 3:126016684-126016706 CATGGCTGAGAGGAGGAAGAGGG + Intronic
961359996 3:126360930-126360952 CATGGCAGAGACGGGGATGAGGG - Intergenic
961446038 3:126982337-126982359 CAGGCCAAGGAAGGGGAAGCCGG - Intergenic
962800839 3:138889255-138889277 CATGGCAAAGAGGATGAGGAAGG + Intergenic
962832053 3:139151764-139151786 AATGGCATAGAGTGGCAAGCTGG + Intronic
962851407 3:139310953-139310975 CATGGCCAGTAGTGGGAAGCAGG + Intronic
964444597 3:156745446-156745468 GAAGGGAAAGAGGAGGAAGCAGG - Intergenic
964529456 3:157651537-157651559 CATGGCAAAGCAGGGGAGGAAGG + Intronic
965108006 3:164383303-164383325 CATGGCAGAGAGGGTGAAAGAGG - Intergenic
965274826 3:166668385-166668407 CCTGGCAAAGAGGGAGTAGAGGG + Intergenic
967648050 3:191950631-191950653 CATGGACAATAGGGGGAAGGTGG + Intergenic
968163103 3:196443129-196443151 CCTGGCCAAGAGAGGGAAACAGG + Intergenic
968484228 4:850971-850993 CATTGCAGAGATGAGGAAGCAGG - Exonic
969137773 4:5044428-5044450 CAGGGCAAAGGGAGGGAAGGAGG - Intergenic
969258936 4:6021684-6021706 CTTGGGAAGGATGGGGAAGCTGG + Intergenic
969546699 4:7834749-7834771 CATGCCAAAGAGGGGGTCCCTGG + Intronic
971029734 4:22623114-22623136 CATGGCAAAGATGGTTAACCAGG + Intergenic
972746193 4:41935086-41935108 GGTGACAAAGAGGGGGAAACGGG - Intergenic
973628028 4:52792075-52792097 CATGCCATATAGGGAGAAGCAGG - Intergenic
974279839 4:59779069-59779091 CATGGTAACAAGGGGGAAGAGGG + Intergenic
975497308 4:75048748-75048770 CATGGCAAAGAGAGAGATGTGGG + Exonic
975954535 4:79821896-79821918 CATAGCAAAGAGCAGGAAGAAGG + Intergenic
980312216 4:131145783-131145805 CAGGGCAAAGAGTGGGAGGGGGG + Intergenic
980539912 4:134179577-134179599 AAAGGCAAAGAGTGGCAAGCTGG + Intergenic
980998825 4:139808567-139808589 AAAGGCAAAAAGGAGGAAGCAGG + Intronic
982312729 4:154002730-154002752 CCTGGCAAAGGTGAGGAAGCAGG - Intergenic
984320531 4:178190200-178190222 CAGGGAAAAGAAGGGGACGCAGG + Intergenic
985483438 5:134318-134340 CATGGGAAAGGGTGGGAGGCAGG + Intergenic
985845591 5:2344347-2344369 AAAGGCAAAGAGTGGCAAGCTGG - Intergenic
987116657 5:14731222-14731244 CATGGCTAGGAGGGAGAGGCGGG + Intronic
987134055 5:14884675-14884697 CATGGGAAAGAGGGGGTTGGAGG + Intergenic
992258664 5:74948199-74948221 CACTGCAAACAGGAGGAAGCAGG + Intergenic
992994972 5:82323737-82323759 CATGGAAAAGAGGGAGTAGAGGG + Intronic
993508891 5:88746735-88746757 CATGAGAAAGAAGGGGAAGATGG + Intronic
994300800 5:98144905-98144927 CTTGGCAAAGAGGGGTTGGCAGG + Intergenic
994626348 5:102224896-102224918 CAAGGAAAAGAGAGGGAAGAAGG + Intergenic
994784043 5:104132832-104132854 CATGCTGAAGAGGAGGAAGCTGG - Intergenic
996479186 5:123954274-123954296 CATGGCAAATAGAGGGAAATTGG - Intergenic
996898688 5:128518556-128518578 CATGGCAAAGTGGGGGGTGGTGG - Intronic
997105483 5:131014300-131014322 AGTGGGAAAGAGGGGGAAGGGGG - Intergenic
997578842 5:135004762-135004784 CATGAGGGAGAGGGGGAAGCTGG + Intronic
997825084 5:137098944-137098966 CTTCTCAAAGAGGGGGAAGAAGG + Intronic
998361191 5:141589200-141589222 CATGAGAAAGAAGGTGAAGCTGG + Intronic
998485212 5:142496225-142496247 CATGGCCAAAATGGGGAATCTGG + Intergenic
999065132 5:148677334-148677356 TATGGCAAAGAAAGGGCAGCAGG - Intergenic
999642136 5:153682507-153682529 CATGGCAAAGAGGGTGGACGTGG - Intronic
1000920238 5:167129288-167129310 CATGGAAAGGAGTGGCAAGCCGG - Intergenic
1001483480 5:172104073-172104095 CATGGCACACAGTAGGAAGCTGG + Intronic
1001633164 5:173191753-173191775 CGTGGCAGGGAGGAGGAAGCAGG - Intergenic
1001956881 5:175853823-175853845 CACTCCACAGAGGGGGAAGCTGG - Intronic
1002084871 5:176768190-176768212 CTTGTCACAGAGGAGGAAGCTGG + Intergenic
1002274291 5:178094390-178094412 CATGGTAAAGAGGGGGCTGCGGG + Intergenic
1002908225 6:1468210-1468232 AAAGGCAAAGAGGGGGAAGTAGG + Intergenic
1003336816 6:5181327-5181349 CAGGGCAATGAGGGGAAAGTAGG - Intronic
1003379528 6:5610819-5610841 AATGGCAGAGAGGCTGAAGCTGG - Intronic
1003383446 6:5646102-5646124 CATGACAGAGAGGGAGCAGCAGG + Intronic
1003860458 6:10317998-10318020 CATGGCCATGCGAGGGAAGCAGG - Intergenic
1005822536 6:29609383-29609405 CATGGCACAGGGGAGGAAGAGGG + Intronic
1005987491 6:30884006-30884028 CAGGGCACAGAGGAAGAAGCAGG - Intronic
1006263169 6:32894165-32894187 GAGGGGAAAGAGGGGGAAGGGGG - Intergenic
1006338546 6:33433328-33433350 CATGGCAGAGAAGGGGAGGCTGG + Intronic
1007248958 6:40482755-40482777 CCTGGCCAGGAGGGGGAGGCAGG - Intronic
1007277693 6:40687467-40687489 CATGACAAAGAGGCAGAGGCTGG + Intergenic
1008173441 6:48236551-48236573 AAAGGCACAGAGTGGGAAGCTGG + Intergenic
1010705263 6:79101264-79101286 CATGGCAAAAAGATGTAAGCCGG + Intergenic
1013255075 6:108377196-108377218 CAAGGCAAAGAGTGGCAAGTTGG - Intronic
1014532237 6:122572081-122572103 CATGGTAAAGGGGTGGAAGAAGG + Intronic
1016404048 6:143711267-143711289 AATGGCAAAGAACTGGAAGCAGG - Intronic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1017485765 6:154900714-154900736 CAAGGAAAGGAGGGGGAAGATGG + Intronic
1018370781 6:163165755-163165777 CCTGGCAGAAAGGGGAAAGCTGG + Intronic
1018371308 6:163170661-163170683 CAGTGCAAGGTGGGGGAAGCTGG - Intronic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1018842130 6:167524986-167525008 CAGGGGAAGGAGGGGGCAGCAGG - Intergenic
1019659546 7:2216358-2216380 CACGGCTAAGAGAAGGAAGCCGG + Intronic
1019685310 7:2378813-2378835 CATGGCAAAGGCGGGGCTGCGGG + Intronic
1019755609 7:2766684-2766706 AATGCCTAAGAGGTGGAAGCTGG - Intronic
1019899282 7:4007340-4007362 CTTGGAAAAGAGGGGGACCCAGG + Intronic
1020085814 7:5309534-5309556 CATGTCAAAGAGATGGAAGAGGG - Intronic
1020702484 7:11500506-11500528 CAAGGCACAGAGTGGCAAGCTGG + Intronic
1022319980 7:29279027-29279049 CATTGCAGAGAGAAGGAAGCAGG - Intronic
1022797280 7:33742180-33742202 TATGGCAAACATGGGGAAGGTGG + Intergenic
1023122796 7:36926159-36926181 CAAGGCAAAGAGGTGGAGGAAGG + Intronic
1025208491 7:57007616-57007638 CATATCAAAGAGGTGGAAGAGGG + Intergenic
1025663457 7:63569262-63569284 CATATCAAAGAGGTGGAAGAGGG - Intergenic
1026018670 7:66692316-66692338 CATGGGTAAGAGAGGGAGGCAGG - Intronic
1026258630 7:68734845-68734867 CATTGCAATGAAGGGGAAGTCGG - Intergenic
1026881732 7:73910382-73910404 CATGGGTAAGAGAGGGAGGCAGG + Intergenic
1029241602 7:99167171-99167193 CAGGGCACAGAGGTGGGAGCTGG - Intergenic
1030087656 7:105830718-105830740 CCTGGCACAGAAGTGGAAGCAGG - Intronic
1030453172 7:109738472-109738494 CATGGGAAAGGGTGGGAAGGAGG + Intergenic
1032515581 7:132503931-132503953 CATGGCTCAGAGGGTGAAGGCGG + Intronic
1033234768 7:139629576-139629598 CATGGCCAATAGGTGGCAGCTGG + Intronic
1034158526 7:148975303-148975325 CATGCCAAAGTGGGGGTGGCAGG + Intergenic
1035193393 7:157192641-157192663 CAAGAGAAAGAAGGGGAAGCTGG + Intronic
1035618519 8:1020761-1020783 CAGGGCACAGAGGGGAGAGCTGG + Intergenic
1036702940 8:11025101-11025123 CATGTCACAGAGGGGTGAGCAGG + Intronic
1037165138 8:15817973-15817995 AATGGAAAAAAGGAGGAAGCTGG + Intergenic
1037749728 8:21673335-21673357 CCAGGCAAAGAAGGGGAAGAGGG - Intergenic
1041549758 8:59087222-59087244 CATGGCACCCAGGGAGAAGCTGG + Intronic
1041907193 8:63046651-63046673 AAAGGCATAGAGGGGCAAGCTGG - Intergenic
1043243488 8:77967406-77967428 CATGGAAAAGAGGTGGGAGGAGG + Intergenic
1043744712 8:83859628-83859650 AGTGGAAAAGAGAGGGAAGCAGG + Intergenic
1045777711 8:105825247-105825269 AAAGGCAAAGAGGAGGCAGCAGG + Intergenic
1046985373 8:120381966-120381988 TATGGCAAAGAAGGGGCAGATGG + Intronic
1048500436 8:134970248-134970270 CATGGAAAGGAGGGGGGAGTAGG + Intergenic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051582863 9:18695959-18695981 GATGGAAGAGAAGGGGAAGCAGG + Intronic
1051806376 9:20997178-20997200 GATGGGAAGGAGAGGGAAGCTGG - Intergenic
1052925350 9:34010956-34010978 AATGGCAGAGTGGGGGAACCAGG + Intronic
1055307705 9:74947378-74947400 CTGGGAAAACAGGGGGAAGCAGG + Exonic
1056775825 9:89511974-89511996 CATGGCAGAGAGATGGAAGAGGG - Intergenic
1056799298 9:89680374-89680396 GATGGGAAAAAGGTGGAAGCTGG + Intergenic
1057078440 9:92153996-92154018 AGTGGGAAAGAGGAGGAAGCAGG - Intergenic
1057854992 9:98594942-98594964 CTTGGCAAACAGGAGGAAACAGG + Intronic
1058758897 9:108110349-108110371 CATGACAAAGCGAGGCAAGCAGG + Intergenic
1059994438 9:119894875-119894897 CATGGCAAAATGGGAAAAGCTGG + Intergenic
1060225502 9:121787601-121787623 CATTGCATAGAGGCAGAAGCTGG + Intergenic
1060454316 9:123776832-123776854 CATGAAAATGAGGGGGAAGTAGG + Intronic
1060485251 9:124042343-124042365 CAGGGCCAGGAGGGGGAGGCAGG - Intergenic
1060582935 9:124769129-124769151 CGTGTCACAAAGGGGGAAGCTGG - Intronic
1061884874 9:133586388-133586410 CTTGGCACAGAGTGGGGAGCTGG + Intergenic
1061901403 9:133674043-133674065 CCTGCCAAAGAGAGGGAGGCTGG + Intronic
1062270120 9:135704480-135704502 CATGGCATGGAGGTGGGAGCAGG - Intronic
1203781902 EBV:105473-105495 CCTGGCAGAGAGGTGGCAGCGGG + Intergenic
1186582309 X:10833553-10833575 CCTGGGAAAAATGGGGAAGCTGG - Intronic
1186600444 X:11030879-11030901 CATGCCAAAGAGGGAGAGCCAGG + Intergenic
1186740254 X:12509579-12509601 CAGAGGAAAGAGTGGGAAGCAGG + Intronic
1187096230 X:16151351-16151373 ACTGACAAAGAGGAGGAAGCCGG - Intronic
1187565332 X:20443964-20443986 CATGGCAAGGAGAGGGAAGAAGG + Intergenic
1188383101 X:29521830-29521852 CATGTTAAAGAGGGGGAAATAGG + Intronic
1188640387 X:32494385-32494407 AATAGCAAAAAGGGGGAGGCAGG + Intronic
1191708546 X:64120858-64120880 AAAGGCACAGAGGGGCAAGCTGG - Intergenic
1191873107 X:65766761-65766783 CATGGCAAAGAGGGTCAAAGGGG - Intergenic
1194137319 X:90162215-90162237 AAAGGCAAAGAGTGGCAAGCTGG + Intergenic
1195293337 X:103450151-103450173 CATTCTACAGAGGGGGAAGCTGG - Intergenic
1196130134 X:112146590-112146612 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196130138 X:112146609-112146631 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196130189 X:112147293-112147315 CAGGGCAGAGAAGGGGAAGAGGG - Intergenic
1199240959 X:145546711-145546733 CAGGGCCAAGAGGGGGAAAAGGG + Intergenic
1199690173 X:150303746-150303768 CATGGCAAAGATGGAGGAGGGGG - Intergenic
1199783695 X:151084865-151084887 CTTGGCTCAGAGGGGGAAGAGGG + Intergenic
1199852284 X:151733823-151733845 GATGGCACAGAGGGGAATGCAGG - Intergenic
1199991970 X:152992590-152992612 CCTGGCAAAGAGTGGGGAGAGGG - Intronic
1200483052 Y:3732155-3732177 AAAGGCAAAGAGTGGCAAGCTGG + Intergenic
1201567933 Y:15385920-15385942 CAGGAGAAAGAGGGGGAAGGGGG - Intergenic
1202372216 Y:24206089-24206111 CAAGGCGAGGAGGGGGCAGCCGG - Intergenic
1202498569 Y:25464027-25464049 CAAGGCGAGGAGGGGGCAGCCGG + Intergenic