ID: 1128300720

View in Genome Browser
Species Human (GRCh38)
Location 15:66564886-66564908
Sequence CAGCCCAGAGTCCTGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 398}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128300720_1128300724 -5 Left 1128300720 15:66564886-66564908 CCCAGAGCCAGGACTCTGGGCTG 0: 1
1: 0
2: 3
3: 28
4: 398
Right 1128300724 15:66564904-66564926 GGCTGTGCCTCCCAGGCCTCAGG 0: 1
1: 0
2: 5
3: 51
4: 456
1128300720_1128300725 -4 Left 1128300720 15:66564886-66564908 CCCAGAGCCAGGACTCTGGGCTG 0: 1
1: 0
2: 3
3: 28
4: 398
Right 1128300725 15:66564905-66564927 GCTGTGCCTCCCAGGCCTCAGGG 0: 1
1: 0
2: 10
3: 57
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128300720 Original CRISPR CAGCCCAGAGTCCTGGCTCT GGG (reversed) Intronic
900432575 1:2609886-2609908 CAGCCCAGAAGCCTGTCTCCCGG + Intronic
900525225 1:3125267-3125289 CAGCCCAGAGCCCAGGGGCTGGG - Intronic
900997114 1:6128675-6128697 CAGCCCAGGGTGGTGTCTCTGGG - Intronic
901084014 1:6599757-6599779 CAGACCAGAGCCCTGGGCCTTGG + Intronic
901205947 1:7496033-7496055 CAGCCCAGAGAGCTGGCCCTGGG - Intronic
901419077 1:9138006-9138028 CAGCCAAGATTCCTGTCTCCTGG + Intergenic
903226097 1:21894919-21894941 GAGCCCCAAGTCCAGGCTCTGGG + Intronic
903226305 1:21895848-21895870 CAGCCCAGGAGACTGGCTCTGGG + Intronic
903542899 1:24106959-24106981 CAGGGCAGAGTCCAGGCTTTGGG - Intronic
903650391 1:24918264-24918286 CAGCCTAGAATCTTGCCTCTGGG + Intronic
903814223 1:26052793-26052815 AGTCCCAGAGTGCTGGCTCTGGG - Intronic
903830266 1:26170263-26170285 CAGCGCAGAGTCTTCTCTCTTGG + Intronic
903858391 1:26350834-26350856 CTGCCCAGAGTCAGGTCTCTTGG - Intronic
904303027 1:29568288-29568310 CAGGTTAGAGTCCTGGCTTTGGG - Intergenic
904575757 1:31504096-31504118 CAGCCCCCAACCCTGGCTCTTGG + Intergenic
904766936 1:32856955-32856977 CCACCCAGAGTCTTGACTCTAGG + Exonic
905972536 1:42152993-42153015 CAGCCCATGGTCCTTTCTCTGGG - Intergenic
906246011 1:44274784-44274806 CAGCCCAGAGTGCTTGCTGCTGG - Intronic
906509974 1:46405367-46405389 CAGCGTGGAGTCCTGGCCCTGGG - Exonic
906543928 1:46608351-46608373 CATCCCAGAGTGGAGGCTCTGGG + Exonic
907336000 1:53700049-53700071 CAGCTCAGAGTCCTGGCTTTGGG - Intronic
908404131 1:63797316-63797338 AAACCCAGTGTCCTGGCTGTGGG + Intronic
909482349 1:76139669-76139691 GAGCCCAGAAACCTGGCACTAGG - Intronic
909843349 1:80358181-80358203 CAGCCCAGAATCCTGTTTCCAGG - Intergenic
909994121 1:82258370-82258392 CAGACAAGAGTCCTGTTTCTGGG + Intergenic
911071389 1:93834550-93834572 CAGAGCGCAGTCCTGGCTCTTGG - Intronic
911293081 1:96081312-96081334 CAGGCCTGACTCCTGGCTCATGG - Intergenic
914962730 1:152220582-152220604 CAGGCCAGACTTCTGGCTTTGGG - Exonic
915007031 1:152647877-152647899 CAGCCCAGTGACCAGGTTCTTGG + Intergenic
916175664 1:162036169-162036191 CAGCACAGTGTCCTAGCTCTAGG + Intergenic
918051321 1:180975240-180975262 CACCACCGAGTTCTGGCTCTGGG + Exonic
918340861 1:183567059-183567081 CAGCCCAGAGTCCTGGGGAAGGG + Intronic
919727825 1:200895322-200895344 CAGGCCTGAGACCTGGCTTTGGG + Intronic
920209435 1:204317252-204317274 CAGCCCTGGGTCCTAGCTCCAGG + Intronic
920299709 1:204981203-204981225 CAGACCAGGGTCCTGAATCTGGG - Intronic
920340786 1:205273975-205273997 CACCCCAGAGACCTGGGTCCTGG + Intergenic
920341198 1:205276179-205276201 CAGCCCATGGTCCTGGGTGTGGG + Intergenic
922203927 1:223430407-223430429 CTTCCCAGTGTGCTGGCTCTGGG + Intergenic
922570445 1:226631636-226631658 CAGCCCTGAGACCTGGCTGAGGG - Intergenic
922659333 1:227416041-227416063 TGGCCCAGAGTCCTGGCACCCGG + Intergenic
922729942 1:227944631-227944653 CAGCCCCGATGGCTGGCTCTGGG + Intronic
922808603 1:228403358-228403380 CAGCCCAGCTGCCTGGCTCCAGG + Intronic
923039534 1:230309779-230309801 CTGCCCAGAAACCTTGCTCTAGG + Intergenic
923558242 1:235018785-235018807 GAGCTCAGAGTCCTGTCTCCAGG - Intergenic
924164006 1:241263363-241263385 CAGCCAACAGCCCTGTCTCTGGG + Intronic
924739054 1:246784163-246784185 CAGCCCAGCATCCTGTCACTGGG - Intergenic
1063229660 10:4052017-4052039 CAGCCCAGAGTCCCACCTCAGGG - Intergenic
1063966815 10:11352435-11352457 CAGCCCACAGGTGTGGCTCTGGG - Intergenic
1065408990 10:25400506-25400528 CAGCCCAGAGACCTTGTTCCTGG + Intronic
1065490645 10:26278581-26278603 TAGCCCAGGGTCCTGACTCCAGG + Intronic
1067029830 10:42872584-42872606 CAGCCTAGAGCCCAGGCTCCAGG - Intergenic
1068917923 10:62452717-62452739 CACCCCAGGGTCCTAACTCTAGG + Intronic
1069611018 10:69772582-69772604 CAGCCCAGAGCCCAGGCTTCAGG - Intergenic
1070154587 10:73825525-73825547 GGGCCCAGAGACCTAGCTCTGGG + Intronic
1072238018 10:93469734-93469756 CAGCCCTGAGTGCTTGGTCTTGG - Intronic
1073366867 10:102950105-102950127 CGGCCCAAAGTCCTTCCTCTGGG - Intronic
1074313252 10:112340606-112340628 CAGGCCTGAGTTCTGGTTCTAGG - Intergenic
1074699840 10:116083267-116083289 CACACCAGACTCCTGGCTCCGGG - Intronic
1075087165 10:119421471-119421493 GAGCTCAGGCTCCTGGCTCTTGG + Intronic
1075344233 10:121670518-121670540 CAGCCCTGAATCCTGGTGCTCGG - Intergenic
1075827353 10:125370647-125370669 CAGCCAAGAGCCCTGGGGCTGGG + Intergenic
1077164570 11:1129295-1129317 CAGCCCCCAGTCCAGGCTCGAGG - Intergenic
1077359396 11:2134043-2134065 CAGGCCAGAGTCCAAGCTCAGGG - Intronic
1077997647 11:7467786-7467808 CAGCCCAGAGTCATAGCCTTGGG + Exonic
1078415172 11:11159004-11159026 GAGCCCAGAGACCTGGTTTTAGG + Intergenic
1078430385 11:11283604-11283626 CGGCCCAGTCTCATGGCTCTAGG + Intronic
1079103908 11:17558502-17558524 CAGCCCCTAGCCCTGGCTCCTGG + Intronic
1079665792 11:23104028-23104050 CAGCTAAGAGTCTTGGCTTTGGG - Intergenic
1079818523 11:25094415-25094437 CAGCACAGAGGCCGGGGTCTTGG - Intergenic
1081673691 11:44956083-44956105 CAGCCCAGAGTGGCTGCTCTGGG - Intergenic
1081993960 11:47352009-47352031 CAGCCCAGGGACCTGGGCCTGGG - Intronic
1082006801 11:47423817-47423839 GAGCCCAGGCTCCTGGTTCTTGG - Intronic
1082802963 11:57427614-57427636 AAGCCCTCAGTCCTGGTTCTTGG - Intergenic
1083100931 11:60305185-60305207 CTGCCCAGAGCACTGGCTTTAGG - Intronic
1084362747 11:68679642-68679664 CAGCCCAGGGACCAGGCTCAGGG + Intergenic
1084659560 11:70538847-70538869 CAGCCCTGAGTGCTGTCTCAGGG + Intronic
1084980527 11:72826341-72826363 GAGCCCAGGGGCCTGGTTCTAGG - Intronic
1085243056 11:75074537-75074559 CAACCCACAGTCCTGCCTCCTGG + Intergenic
1085246741 11:75108042-75108064 CAACCCACAGTCCTGCCTCCTGG + Intronic
1086242150 11:84707996-84708018 AAGCCCAAAGTCGTGGCACTTGG - Intronic
1087104873 11:94399067-94399089 CAGCCCTGTATCCTGGCTCTGGG + Intronic
1088510732 11:110571467-110571489 TAGCCCAGAGTACAGCCTCTTGG + Intergenic
1089012408 11:115141908-115141930 CTGCCAATAATCCTGGCTCTTGG - Intergenic
1089880281 11:121766675-121766697 CTCCCAGGAGTCCTGGCTCTTGG - Intergenic
1092350252 12:7750406-7750428 CAGCCCAAATTGCTGACTCTCGG - Intronic
1092479873 12:8850236-8850258 CTTCCCAGAGACCTGGCTCTGGG + Exonic
1093175749 12:15911489-15911511 CCGCCCAGTGCCCTGGCTGTGGG + Intronic
1093539978 12:20270166-20270188 CAGCCAAGAGGCCTTTCTCTGGG - Intergenic
1100452700 12:94722712-94722734 CTTCCCAGAGTCCTGGGACTCGG + Intergenic
1103274475 12:119700205-119700227 CAGCCCACAGTCCCAGCCCTGGG - Intronic
1103920628 12:124397361-124397383 CAGCACAGTGACCTGCCTCTGGG - Intronic
1104352497 12:128056989-128057011 GAGCCCAGGGTGCTGGCTCTAGG - Intergenic
1104393210 12:128408756-128408778 CAGCCCAGAGGCCTTGTTCTGGG - Intronic
1104963141 12:132497663-132497685 CAGGCTAGAATCCAGGCTCTGGG + Intronic
1105242392 13:18620031-18620053 CACCTCAGAGTCCTTGGTCTAGG - Intergenic
1105796249 13:23856441-23856463 CAGCCCACAAGCCTGGCTCTGGG - Intronic
1105805755 13:23950862-23950884 CAGCCCAGAGCCCTGGGACCTGG - Intergenic
1106036811 13:26051371-26051393 CTGCGCAGAGCCCTGGCTCCAGG - Intergenic
1107263076 13:38518775-38518797 CAGCCCATGGACCTGGCCCTGGG + Intergenic
1108279203 13:48844036-48844058 CAGCCCAGAAGGCTGGCTTTTGG + Intergenic
1111905960 13:94256467-94256489 CTGCCCAGTCTCCTTGCTCTTGG - Intronic
1112806412 13:103167826-103167848 CAGCCCTGTGTCCTGGTTGTAGG - Intergenic
1113200957 13:107867229-107867251 CAGCCCAGGCTCCGGACTCTGGG - Intergenic
1114346351 14:21799351-21799373 CAGCACAGAGTGCTGACTCCAGG - Intergenic
1118456420 14:65948880-65948902 CAGCTCAGAGACTGGGCTCTGGG + Intergenic
1119656337 14:76419905-76419927 AAGCCCAGAGCCCTGGATCCTGG + Intronic
1121338205 14:93089887-93089909 ATGCCCAGGGTCCTGGCTCTTGG - Intronic
1121897646 14:97663395-97663417 CAGTGCACAGTCCTGGCCCTGGG - Intergenic
1122691372 14:103533485-103533507 CAGCCCTGACTCCTGGGTCCTGG + Intronic
1122718458 14:103708871-103708893 GCGCCCTGAGTCCTGGCACTCGG + Intronic
1122976590 14:105173370-105173392 CATCCCAGAGTCCTGCCTACTGG - Intronic
1122977360 14:105176354-105176376 CAGGCCAGAATCTGGGCTCTTGG - Intronic
1123488906 15:20764561-20764583 CACCACAGAGTCCTTGGTCTAGG + Intergenic
1123545405 15:21333648-21333670 CACCACAGAGTCCTTGGTCTAGG + Intergenic
1124375005 15:29124207-29124229 CAGCCCAGTGTCCAGCCTGTGGG - Intronic
1124579821 15:30943681-30943703 CCGCCCAGAGTCCGGGCTAGAGG - Intronic
1124606610 15:31174250-31174272 CAGCCCAGGGTCCTGGCAGGAGG - Intergenic
1125716816 15:41824044-41824066 CACACCTGAGTCCTGGCTCAGGG - Exonic
1126110823 15:45173794-45173816 CTGTCCTGTGTCCTGGCTCTGGG - Intronic
1127626052 15:60781368-60781390 CAGCCCAGAGTCCTCGTGCTGGG + Intronic
1128300720 15:66564886-66564908 CAGCCCAGAGTCCTGGCTCTGGG - Intronic
1128308207 15:66613838-66613860 CAGCCCAGGGTTCTGGGCCTGGG + Intronic
1128519894 15:68368253-68368275 AGGCCCAGGGTCCTGGCCCTAGG + Intronic
1128664474 15:69528056-69528078 TAGCCCATATTCCTGGTTCTGGG + Intergenic
1129331206 15:74828304-74828326 CAGCACAAAGCCCTGGCCCTTGG - Intronic
1129470806 15:75752361-75752383 AAGCCCATCCTCCTGGCTCTGGG - Intergenic
1131027098 15:89152457-89152479 CAACCCAGAGGCCTGGTCCTGGG - Intronic
1202953750 15_KI270727v1_random:60919-60941 CACCACAGAGTCCTTGGTCTAGG + Intergenic
1132989731 16:2786585-2786607 CAGACCAGAGTCCAAGCCCTAGG - Exonic
1133314649 16:4875181-4875203 CAGTCCAGAGTTCTGTTTCTGGG + Exonic
1133592150 16:7256252-7256274 AACCCCAGAGGCCTGGCTTTTGG - Intronic
1134043308 16:11084063-11084085 CAGCCCCGCGGCCTGGCTCTGGG + Intronic
1135772659 16:25229051-25229073 CAGCTCAGAGTCCTGGGCCATGG + Intergenic
1135992490 16:27226631-27226653 CTTCCCGGAATCCTGGCTCTGGG - Intronic
1136362534 16:29790295-29790317 CTGCCCAGAGTCCAGCCCCTGGG + Intergenic
1136573360 16:31109436-31109458 CAGCCCAGGGTCCGGGATGTAGG + Intronic
1137270952 16:46901921-46901943 CAGCCCAGAGGCCCGGCTTCCGG + Intronic
1137390274 16:48075439-48075461 CTGCCCAGAGTCCCGGCTGCTGG - Intergenic
1137394103 16:48104919-48104941 CAGCCCTGAGTCTGGGCTATGGG - Intronic
1137555519 16:49468032-49468054 CAGCCCAGATGCTAGGCTCTAGG - Intergenic
1137612257 16:49826467-49826489 AACATCAGAGTCCTGGCTCTGGG - Intronic
1137668615 16:50266453-50266475 CAGCCCACAGCCCAGCCTCTCGG - Intronic
1138141802 16:54574951-54574973 TTGCCCAGAGTTCTGGATCTGGG - Intergenic
1139331530 16:66196071-66196093 CAGCCCAGAGCCTAGGTTCTTGG - Intergenic
1139336032 16:66231892-66231914 GGGTCCAGAGTCCTGGCTCCTGG - Intergenic
1140527178 16:75632609-75632631 CAGCTCATAATCCTGGCACTAGG - Intronic
1141799609 16:86297980-86298002 CAGCTCAGGGGCCTGGCTTTGGG - Intergenic
1141833644 16:86523888-86523910 CAGCCCACACTGCTGGCTTTTGG + Intergenic
1141989293 16:87601506-87601528 CTGCCCAGGGTCCTCGCTCCTGG - Intergenic
1142151103 16:88512885-88512907 AAACCCAGAGGCCTGGCTCCAGG - Intronic
1142229129 16:88891443-88891465 CACCCCAGGGTGCTGGCTCCAGG + Intronic
1142284013 16:89164333-89164355 CAGCCTGGAATCCTGGCCCTGGG + Intergenic
1142362928 16:89635827-89635849 CAGCCCAGAGGCCAGGAGCTCGG + Intronic
1143707244 17:8707173-8707195 CAGCCCAGAGTCCTAGAGCTTGG - Intergenic
1144227171 17:13160448-13160470 CAGCCATGGGACCTGGCTCTGGG + Intergenic
1144356920 17:14455128-14455150 CACCCCAGAGTGCTGGCTGGGGG + Intergenic
1144631313 17:16873894-16873916 CAGGCCAGAGTCCAGGATCGAGG + Intergenic
1146298745 17:31671920-31671942 TGGCCCAGAGTCCAGGCTTTTGG - Intergenic
1147325632 17:39668174-39668196 CCGCCCCGAGTCCCGCCTCTGGG - Exonic
1148744619 17:49911431-49911453 AAGCCCAGAGACCAGCCTCTAGG - Intergenic
1150651758 17:67015012-67015034 TATCCCAGATTCTTGGCTCTAGG + Intronic
1151147702 17:72056873-72056895 CAGCCCAGAGGCCTGGCCTGTGG + Intergenic
1151201550 17:72471431-72471453 CAGTCCAGAGGCCTGGGTATGGG - Intergenic
1152005176 17:77676050-77676072 CAGCCCAGGCTCCTGCCTTTTGG + Intergenic
1152098715 17:78288278-78288300 CAGCTCAGAGTCCTGGGGCCTGG + Intergenic
1152278676 17:79372599-79372621 CAGCCCAGTCTCCTGGCTGGAGG + Intronic
1152535092 17:80946007-80946029 CAGTCCAGAGTCCTGCCTGCAGG + Intronic
1152661554 17:81544661-81544683 AAGCCCGGCTTCCTGGCTCTTGG - Intronic
1152709856 17:81865966-81865988 CAGCCCAAAGTCCTGGCTGCTGG + Intergenic
1152760935 17:82106706-82106728 CAGTGCAGAGTCCTGGCCCAAGG - Intronic
1152901865 17:82947008-82947030 CAGTCCGGTCTCCTGGCTCTAGG + Intronic
1154009664 18:10564220-10564242 CTGCCCTGGGCCCTGGCTCTTGG + Intergenic
1154446557 18:14439847-14439869 CACCTCAGAGTCCTTGGTCTAGG + Intergenic
1154449141 18:14460330-14460352 GTCCCCAGTGTCCTGGCTCTTGG - Intergenic
1156500406 18:37554047-37554069 CAGCCACAAGGCCTGGCTCTAGG - Intronic
1158594496 18:58804353-58804375 CAGTCTAGAGTCTAGGCTCTAGG - Intergenic
1160386045 18:78497648-78497670 CCGTCCAGGGTCCTGGCACTGGG - Intergenic
1160534975 18:79586880-79586902 GAGGCCAGAGTCCTGGCACGGGG + Intergenic
1160677455 19:399009-399031 CTTGCCAGTGTCCTGGCTCTGGG + Intergenic
1160893918 19:1394107-1394129 CAGCCCTGAGTCCCGAGTCTGGG + Intronic
1161620647 19:5295263-5295285 CAGCATACAGGCCTGGCTCTGGG + Intronic
1161668209 19:5589785-5589807 CAGCCCTGAGTCCTGGGTGGAGG + Intronic
1161962540 19:7530518-7530540 CAGCCCTGAGCTCGGGCTCTGGG + Intronic
1161998475 19:7729188-7729210 CAGCCCAGTGCCTGGGCTCTGGG - Exonic
1162498203 19:11035199-11035221 CAGGCCTGAGTCCTGGCGGTGGG - Intronic
1162584879 19:11552514-11552536 GAGCCCAGAGTCCAGGCTGAGGG - Intronic
1162757816 19:12870847-12870869 CAGCACAGAGTCCTGCCTCCTGG - Exonic
1162760998 19:12887986-12888008 GAGACCAGTGCCCTGGCTCTGGG + Intergenic
1162880395 19:13654580-13654602 CTGCCCAGCATCCTGGCTATGGG - Intergenic
1163533494 19:17863969-17863991 CAGCCAAGAGCTCAGGCTCTGGG + Intronic
1163833667 19:19560355-19560377 GAGCCCAGGGCCCTGGTTCTTGG + Intergenic
1165758965 19:38309549-38309571 CAGCCCAGAGCCGGGGCTATGGG - Exonic
1166324557 19:42041351-42041373 CAGGGCACAGTCCTGCCTCTGGG + Intronic
1166561998 19:43739039-43739061 CAGAGCAGAGCCCTGGCTCTGGG - Intronic
1166918819 19:46214234-46214256 AAGCCCAGAGTCGGGGCTCTGGG + Intergenic
1166921806 19:46233389-46233411 AAGCCCAGAGTCGGGGCTCTGGG + Intergenic
1167498009 19:49830566-49830588 CAGCCCAGCCTTCTGGTTCTTGG - Exonic
1168104939 19:54160849-54160871 CGGCCCAGACTTCTGGGTCTGGG - Intronic
1168571746 19:57476480-57476502 AAGCCCAGGGTCCTGACTCCGGG - Intronic
925921878 2:8644075-8644097 CACCCCAGAACCCTGACTCTTGG - Intergenic
925930934 2:8707290-8707312 CAGCCTGGATTCCTGGCTGTTGG + Intergenic
925971293 2:9108321-9108343 GACCCCAGAGGCCTGGCTCCCGG + Intergenic
926028724 2:9567020-9567042 GAGCCCAGAGGGCAGGCTCTAGG + Intergenic
926059426 2:9795898-9795920 AAGCCTAAAGTCCGGGCTCTGGG + Intergenic
926059427 2:9795901-9795923 CAGCCCAGAGCCCGGACTTTAGG - Intergenic
927503683 2:23599170-23599192 CAGCCCAGAGTCCTTGCCGCAGG - Intronic
927701834 2:25274060-25274082 CAGCCCAGACTCCAGGCACCTGG + Intronic
927857311 2:26535716-26535738 GAGCCCAGGTTCCTGCCTCTGGG + Intronic
928307834 2:30185584-30185606 CAGCTCAGAGGCCTGACTCCCGG + Intergenic
929408733 2:41672501-41672523 CAGTCCAGAGTCTTTACTCTGGG - Intergenic
929461308 2:42103638-42103660 GAGCCCAGTCTCCTGGGTCTGGG + Intergenic
929601227 2:43206088-43206110 CAGCCCAGAGACTGTGCTCTGGG + Intergenic
929865167 2:45711335-45711357 CTGGCCTGAGTCCTCGCTCTTGG - Intronic
929904476 2:46034144-46034166 CAGACCGCAGTCTTGGCTCTTGG - Intronic
929920238 2:46166435-46166457 TGGATCAGAGTCCTGGCTCTTGG - Intronic
931134903 2:59387486-59387508 CAGCCCAAGGTTCTGGCCCTGGG - Intergenic
931711827 2:64994403-64994425 CAGACCAGAGCCCTGGGCCTAGG - Intronic
932337615 2:70939907-70939929 CAGCCTCCAGGCCTGGCTCTGGG - Exonic
933771342 2:85746353-85746375 CAGCCAAGTCTCCAGGCTCTCGG - Intergenic
934696800 2:96405903-96405925 CAGTCCAGCCTCCTGGGTCTCGG - Intergenic
935051824 2:99530813-99530835 CAGCCCAGAGTCCAGAGCCTGGG - Intergenic
935164200 2:100555458-100555480 CAGCCCAGCAACCTGCCTCTTGG - Intergenic
936350918 2:111711948-111711970 GAGCCAAGAGTCATGGGTCTGGG - Intergenic
937087689 2:119182188-119182210 GAGTCCAGAGCCCGGGCTCTGGG - Intergenic
938924369 2:136025476-136025498 AGGCCCAGAGTTCTGGCCCTGGG + Intergenic
941750462 2:169130087-169130109 CAGGTCAGAGCCCTGCCTCTGGG + Intronic
941921001 2:170850592-170850614 AAAGCCAGAGTCCTGGCTGTGGG - Intronic
945972254 2:216242410-216242432 CAGCTCAGCGCCCTGGCTCTGGG - Intergenic
947472055 2:230409712-230409734 CAGCCTGGAATCCAGGCTCTGGG + Intergenic
948287658 2:236799022-236799044 CAGCCCTGACCCCTGGCTGTGGG + Intergenic
949042315 2:241855087-241855109 GAGCCCAGGGTCCTGGCTTGAGG - Intronic
1169171569 20:3469962-3469984 CAGCCCAGATTCCAGGGTCAAGG + Intergenic
1170474448 20:16701050-16701072 CAGCCCAGACTTCTCTCTCTTGG + Intergenic
1170547717 20:17449270-17449292 CCACCCACAGTGCTGGCTCTTGG + Intronic
1170656057 20:18288669-18288691 CAGCCCATAGTCCAGCCTTTCGG - Intronic
1170969389 20:21103403-21103425 CAGCCCCGAGCCGTGGCTATTGG - Intergenic
1171136658 20:22700969-22700991 CAGCCCAGAATAATGGCACTAGG + Intergenic
1172891814 20:38271121-38271143 CCCCCCAGAGCCCTGGCTTTTGG - Intronic
1173900852 20:46588006-46588028 CAGCCCAGAATCCTCCCTGTTGG + Intronic
1174145084 20:48447779-48447801 CAGCCAACACTCCTGGCTCCTGG + Intergenic
1174648439 20:52104994-52105016 CGGCGCAGAGTCCTGGGACTCGG - Intronic
1174724241 20:52844692-52844714 CAGTCCAGACTCCTGGCTCATGG + Intergenic
1175282851 20:57815774-57815796 CATCCAAGAGTCTTGGCTTTTGG - Intergenic
1175495267 20:59410234-59410256 CACCCCAGTGTTCGGGCTCTGGG + Intergenic
1176239079 20:64067664-64067686 CAGCCCTTGGGCCTGGCTCTGGG + Intronic
1176277429 20:64280297-64280319 CAGCCCAGAGCCAGGGCTCCAGG - Intronic
1176300172 21:5095581-5095603 CAGCCTGGAGTCCTGGCCATGGG - Intergenic
1176385853 21:6138266-6138288 CAGCCCACAGGCCTGGCTGCTGG - Intergenic
1176449423 21:6849996-6850018 CACCACAGAGTCCTTGGTCTAGG - Intergenic
1176827593 21:13715020-13715042 CACCACAGAGTCCTTGGTCTAGG - Intergenic
1178436846 21:32567457-32567479 CACCCCAGGGTCCTGGCCCATGG - Intergenic
1178623837 21:34199338-34199360 CAGCCCAGGCGCCTGGCTCTTGG + Intergenic
1179036906 21:37766298-37766320 CACTCCAGAGTCCTGTCTCCAGG + Intronic
1179729454 21:43359538-43359560 CAGCCCTGACTCCTGGGTGTTGG - Intergenic
1179737620 21:43399986-43400008 CAGCCCACAGGCCTGGCTGCTGG + Intergenic
1179856850 21:44166330-44166352 CAGCCTGGAGTCCTGGCCATGGG + Intergenic
1179961039 21:44767093-44767115 CAGCCCAGGGTCCAGGCCCCAGG + Intergenic
1179995384 21:44971663-44971685 CTGCCCAGAGCCCTGGCACCAGG + Intronic
1180009911 21:45042805-45042827 CAGCGCAGGGTCCTGGCCTTGGG + Intergenic
1180701031 22:17781547-17781569 CAGGGCAGAGCCCTGGGTCTAGG - Intergenic
1180854079 22:19035510-19035532 GAGCCCCGAGCCCTGCCTCTGGG - Intergenic
1181307930 22:21927490-21927512 CTGCCCACATTCCTGCCTCTGGG - Intronic
1181435931 22:22910866-22910888 CAGGCCACTGTCATGGCTCTCGG - Intergenic
1181482895 22:23212223-23212245 CAGCTCAGATTCCGGGCTGTAGG - Intronic
1181587507 22:23861659-23861681 CAGCCCAGATTCCTGGAGCCTGG + Intronic
1181864445 22:25844296-25844318 CAGCCCAGAGTGCTGGCGTGAGG + Intronic
1182432125 22:30305543-30305565 CAGCACTGTGTGCTGGCTCTTGG - Intronic
1182459602 22:30474411-30474433 TATCCCATAGTCTTGGCTCTAGG + Intergenic
1182541372 22:31044527-31044549 CAGCCCAGATTCCTGCATCCAGG + Intergenic
1183489586 22:38109361-38109383 TCACCCAGAATCCTGGCTCTTGG + Intronic
1183931719 22:41239369-41239391 CAGCCCAGGCTCCTCCCTCTGGG + Intronic
1184105742 22:42366705-42366727 TGGCCCAGAGACCTGACTCTGGG + Intergenic
1184108706 22:42383179-42383201 CAGCCAAGGGTCCAGGGTCTAGG + Exonic
1184401448 22:44276936-44276958 CACCGCAGGGTCCTGGCTCCTGG - Intronic
1184448357 22:44567633-44567655 AAGCCCAGATTGCTAGCTCTGGG + Intergenic
1184451677 22:44586256-44586278 GAGCCCAGAGGCCAGGCTGTTGG - Intergenic
1184613828 22:45624340-45624362 CAGCCCAAAGAACTTGCTCTGGG + Intergenic
1185105809 22:48869226-48869248 CTGCCCGGCGTCCTGGCTGTGGG + Intergenic
1185334883 22:50267031-50267053 CAGCCCAAAATCCAGGATCTGGG + Exonic
950409485 3:12825989-12826011 CAACTCTGAGTCCTGGCACTTGG - Intronic
950536418 3:13581606-13581628 CAGCCCAGGGTCAAGGCTCCTGG + Intronic
950613452 3:14140551-14140573 CAGCTCAGAGCCCAGGCTCTGGG + Intronic
951402357 3:22249107-22249129 CAGCTGAGAGTCCAGACTCTTGG + Intronic
951566728 3:24019182-24019204 CAGGTCACAGTCCTGGCTCCGGG + Intergenic
952232339 3:31445095-31445117 CATCTCAGAGTCTTGCCTCTGGG + Intergenic
953006356 3:38982786-38982808 CAGCCCAGGATCCTGACCCTGGG - Intergenic
953708120 3:45246367-45246389 CAACCCAGAGGCCTGGATCCAGG - Intergenic
954004833 3:47582518-47582540 AAGACCAGACTCCTGGTTCTAGG + Intergenic
954100583 3:48369625-48369647 CAGCTAAGAGCACTGGCTCTGGG + Intergenic
958178538 3:90026949-90026971 CAGCACAGATTCCAGGGTCTAGG + Intergenic
958907756 3:99960664-99960686 GAGTCCAGAGTCCTGGTACTGGG + Intronic
959900009 3:111650404-111650426 CAGCCCAGACTCCTGCCACATGG + Exonic
959933575 3:112007717-112007739 CAGCCCAGAGCCCTGCAGCTTGG - Intronic
960964327 3:123094382-123094404 CAGCCCAGAGTTCTGAACCTTGG - Intronic
961642018 3:128370709-128370731 GAGCACAGAGGACTGGCTCTAGG + Intronic
962175756 3:133152915-133152937 CAGGCTAGAGTCCTACCTCTAGG + Intronic
965679012 3:171231134-171231156 CAGCCCATGGTACTGGCTCAAGG + Intronic
966308246 3:178562385-178562407 CTTCCCAGAATCCTGTCTCTGGG - Intronic
966936997 3:184717195-184717217 CAGACCAGGGCCCTGGCTCCTGG - Intergenic
967787140 3:193509399-193509421 CAGCCAACAGTGCTGGCTCATGG - Intronic
967814434 3:193787246-193787268 CACCAGAGAGGCCTGGCTCTGGG + Intergenic
967861229 3:194153392-194153414 CAGCCCGGACGCCTGGCACTCGG - Intergenic
970199927 4:13593834-13593856 CAGACCACAGTCTGGGCTCTTGG - Intronic
970227467 4:13874582-13874604 CTTCCCAGAGACCTGGTTCTTGG - Intergenic
972025945 4:34377843-34377865 AAGCCAATAGTCCTGGCTCAGGG + Intergenic
972644708 4:40956247-40956269 CAGCCCAGAGCCAGGACTCTGGG + Intronic
972644709 4:40956250-40956272 AAACCCAGAGTCCTGGCTCTGGG - Intronic
974962850 4:68725074-68725096 CAGAGCAGAGTCCTGCCTCTGGG - Intergenic
975339733 4:73225935-73225957 TATGCCAGAGTGCTGGCTCTAGG - Intronic
975722693 4:77263628-77263650 CAGACCAGATTTCTGGCCCTTGG - Intronic
977300137 4:95258255-95258277 CAGACCAGAGTACTGACTCCTGG - Intronic
980625650 4:135371776-135371798 AAGCCCAGATTGCAGGCTCTGGG - Intergenic
982213984 4:153064673-153064695 CAGCCCAGGGCCCTGGCTTCTGG + Intergenic
983999804 4:174226189-174226211 CACAGCAGAGCCCTGGCTCTGGG - Intergenic
984928206 4:184825479-184825501 CTGCCCAGAGGCCGGGCTCGCGG - Intronic
984973567 4:185210368-185210390 CAGCCCAGCCCCCTGGCTCCCGG - Intronic
985537342 5:472765-472787 GGGCCCTGAGTCCTGGCGCTCGG + Exonic
985727818 5:1524937-1524959 CCCCCCAGGGTCCTGGCTCCTGG + Intergenic
985865017 5:2507813-2507835 CTGACTACAGTCCTGGCTCTGGG + Intergenic
986486463 5:8243137-8243159 CATCCTAGATTCCTGGCCCTAGG - Intergenic
986710183 5:10482989-10483011 CTGCCCAGTGCCCTGACTCTGGG + Intergenic
986825028 5:11511344-11511366 TGATCCAGAGTCCTGGCTCTGGG + Intronic
987288603 5:16486597-16486619 AAACCCAGAGTCCTGGCCTTGGG - Intronic
993502450 5:88678667-88678689 CCGGCCAGAGTGGTGGCTCTTGG - Intergenic
996117507 5:119634385-119634407 CAGTCAGGAGTCTTGGCTCTGGG - Exonic
996781719 5:127193930-127193952 AAGTCCAGAGTACTGGCTCCTGG + Intergenic
997629290 5:135354612-135354634 CAGCTCAGAGCCCTGGCACCAGG + Intronic
997888944 5:137658086-137658108 CAGGGCACAGTCCTGACTCTTGG + Intronic
997931887 5:138079152-138079174 GAGCCCAGTGTCCTCCCTCTAGG - Intergenic
997951995 5:138249753-138249775 CGACCCAGGGTCTTGGCTCTGGG + Intergenic
998975999 5:147648716-147648738 CTGCCCTGAGTCCTGGATCCAGG - Intronic
1000716770 5:164653664-164653686 CTGCTCTGAGTCCTGGGTCTGGG + Intergenic
1001031431 5:168266155-168266177 CAGCCCAAACTCATGGCCCTGGG - Intergenic
1003068802 6:2928016-2928038 CAGCTCAGAGACCTACCTCTAGG - Intergenic
1003346311 6:5271201-5271223 CTGGCCAGAGTCCTCTCTCTCGG + Intronic
1003915086 6:10779204-10779226 ATGCCCAGAGTCCCGGCTCTAGG + Intronic
1003995732 6:11537976-11537998 CCGCCCCGAGTCCTCGCTCGGGG + Intergenic
1004576918 6:16905466-16905488 CAGCCCAGAGTAAGGACTCTGGG - Intergenic
1005016196 6:21377559-21377581 CAGCCCCGTGCCCTGGCTCCAGG - Intergenic
1006444390 6:34070652-34070674 CAGCCCTGGGTCCTGGGTCCTGG - Intronic
1006802096 6:36765852-36765874 GAGCCCAGGGCCCTGGCTCGGGG + Intronic
1007229385 6:40337859-40337881 GAGCCCTGTGTTCTGGCTCTTGG + Intergenic
1007655781 6:43450278-43450300 CAGAGCAGAGGCCTGGTTCTGGG - Exonic
1009846904 6:69146005-69146027 CAGCCCAGCCTCCAGGCTTTAGG + Intronic
1011494052 6:87921393-87921415 CAGCACAGAGTCTAGGCTCTGGG - Intergenic
1012164558 6:95932134-95932156 TACCCCAGAGTCCTTGCTCAGGG - Intergenic
1012525794 6:100176575-100176597 CACACAAGAGTCCTGGCCCTGGG + Intergenic
1012872445 6:104688050-104688072 CACCCCAGAGTCCTCCCTCTTGG + Intergenic
1012970449 6:105724284-105724306 CTCCCCAGAGCCCTGGCTCCCGG - Intergenic
1013013214 6:106138247-106138269 CAGCCCATGGTCTAGGCTCTAGG - Intergenic
1015213446 6:130722628-130722650 CATCCCCCAGTTCTGGCTCTGGG - Intergenic
1016053930 6:139558670-139558692 CTGCCCAGAGCACTGGCTATGGG - Intergenic
1018053914 6:160035506-160035528 CAGCCCAGGGTCTTGCCACTGGG + Intronic
1018942567 6:168319358-168319380 CAGCCCCGAGTCCCGGCGCCCGG + Intronic
1019129396 6:169862649-169862671 CAGCCCCAGGTCCTGGCTCCTGG + Intergenic
1019335543 7:480932-480954 CTGCCCAGACCCCTGGCTCCAGG + Intergenic
1019706326 7:2498855-2498877 CAGCCCCCACTCCGGGCTCTGGG - Intergenic
1020248246 7:6447439-6447461 CAGCGCCGAGACCTGGCCCTGGG - Intronic
1021738810 7:23664691-23664713 GAGCCAAGAGTCATGGGTCTCGG + Intergenic
1022797451 7:33743372-33743394 CAGTCCAGGGTCCTGGGTGTTGG + Intergenic
1022898464 7:34777104-34777126 CTCCCCAGTGTACTGGCTCTGGG + Intronic
1024059083 7:45685131-45685153 CAGCCCTGGGTCCTGGCTTCTGG - Intronic
1024984952 7:55186899-55186921 CAGCCAAGCCCCCTGGCTCTGGG + Intronic
1025202016 7:56968317-56968339 CAGCCCAGAGCCCAGACCCTAGG - Intergenic
1025669931 7:63608611-63608633 CAGCCCAGAGCCCAGACCCTAGG + Intergenic
1026260153 7:68748024-68748046 CAGGCCACAGTCCTTGCTCCGGG + Intergenic
1026514828 7:71059763-71059785 GAGTCCAGGGTCCTGTCTCTTGG + Intergenic
1026960525 7:74404658-74404680 CAGCTCAGAGTGGAGGCTCTAGG + Exonic
1028649787 7:93138732-93138754 AGGCCCAGTGCCCTGGCTCTGGG - Intronic
1029683427 7:102128467-102128489 CTTCCCAGAGACCTGGATCTCGG + Intronic
1031421904 7:121563456-121563478 CAGCCCAGACTCCTGGTTCCTGG - Intergenic
1031583547 7:123506064-123506086 CAGCACTGTGTCCTTGCTCTAGG - Intronic
1031866370 7:127041955-127041977 CAGCCAAGACTCCTGGTTTTGGG - Intronic
1032890045 7:136184206-136184228 CAGCCCAGTGTAATGGATCTGGG + Intergenic
1034222041 7:149454308-149454330 AGGCCCAAACTCCTGGCTCTGGG + Intronic
1034459816 7:151192128-151192150 CAGCCCAGTGGCCTGGGTCCTGG - Intronic
1035650495 8:1260571-1260593 CACCCCGGAGTCCTGGCTCAGGG + Intergenic
1035650518 8:1260702-1260724 CTCCCCGGAGTCCTGGCTCAGGG + Intergenic
1035700932 8:1638929-1638951 CAGCCCAGAGAGCTGGGTCATGG + Intronic
1036690542 8:10941903-10941925 CAGCCCACAGGCCTGGCTGCTGG - Intronic
1036709516 8:11069132-11069154 CAGCCCAGAAACATGGCCCTAGG + Intronic
1036884421 8:12540859-12540881 CTGCCCAGAGCCTTGGCTCATGG - Intergenic
1037129733 8:15393212-15393234 CAGCCCTGTCTCTTGGCTCTTGG - Intergenic
1037585153 8:20270943-20270965 CAGCTCAGATTCCTGACTTTGGG + Intronic
1038403532 8:27304946-27304968 CAGCCAAGAGTTCTGGCACCTGG + Intronic
1039417500 8:37408335-37408357 CAGCCCAGGGTCTTTGCACTTGG - Intergenic
1039905168 8:41781315-41781337 CAGCAGGGAGTCCTGGCTGTTGG - Intronic
1040942458 8:52846600-52846622 CTGACCTGAGTCCTGACTCTCGG + Intergenic
1041782293 8:61590279-61590301 GAGTCCAGAGTGCTTGCTCTGGG + Intronic
1044486971 8:92765753-92765775 GAGCCGTGAGTCCTGGCTATGGG + Intergenic
1045511648 8:102816282-102816304 GAGCCCAGGGTCCAGGCTCCTGG - Intergenic
1047421341 8:124710531-124710553 CTGCCATGGGTCCTGGCTCTAGG - Intronic
1047510442 8:125511706-125511728 CAGCCCAGTGTGCCAGCTCTTGG - Intergenic
1047510447 8:125511731-125511753 CAGCCCAGTGTGCCAGCTCTTGG - Intergenic
1047510452 8:125511756-125511778 CAGCCCAGTGTGCCAGCTCTTGG - Intergenic
1048965158 8:139609564-139609586 CAGCCCACAGGCCTGGCCCCTGG - Intronic
1055351031 9:75388632-75388654 GAGTCCAGAATCCAGGCTCTTGG + Intergenic
1056318533 9:85415019-85415041 AAGCCCAGAGTCCTGGCCCTTGG + Intergenic
1057869240 9:98706372-98706394 TACCCCAAAGCCCTGGCTCTGGG + Intronic
1060481821 9:124020865-124020887 CAGCACTGAATCCCGGCTCTGGG - Intronic
1060521663 9:124297540-124297562 CAGCTCAGGTTCCTGGCTTTAGG - Intronic
1060936549 9:127519504-127519526 CAGCCCATAGTCATGGCAGTGGG - Intronic
1060978080 9:127777031-127777053 AGGCCCAGAGTCCAGGGTCTGGG + Intronic
1061973220 9:134055745-134055767 CAGCCCCATTTCCTGGCTCTGGG - Intronic
1062364555 9:136202656-136202678 CAGCCCAGGGAGCTGGCTCCGGG + Intronic
1203519764 Un_GL000213v1:34521-34543 CACCACAGAGTCCTTGGTCTAGG + Intergenic
1203444909 Un_GL000219v1:45570-45592 CAGACCAGCGTCTTGGCTCCTGG + Intergenic
1185456007 X:311260-311282 CAGCCCAGGGGCCAGGCCCTCGG - Intronic
1185456019 X:311292-311314 CAGCCCAGGGGCCGGGCCCTCGG - Intronic
1186441521 X:9591056-9591078 CAACCCTCATTCCTGGCTCTGGG - Intronic
1189145385 X:38650121-38650143 CATCCCAGAGCCCTGACTATAGG + Intronic
1189297855 X:39931269-39931291 CAGCCTAGTGGCCTGGCTTTGGG - Intergenic
1190243555 X:48676382-48676404 CAGTCCAGAGCCCGGGCTCCGGG - Intergenic
1191703678 X:64070489-64070511 CAGCCCAGTCCACTGGCTCTTGG - Intergenic
1192263482 X:69523302-69523324 TGGCCCTGAGTCCTGGCTTTGGG + Intronic
1194016188 X:88624583-88624605 CACCCCAGTTTACTGGCTCTGGG - Intergenic
1194726459 X:97403741-97403763 CAGCCCAGTTCCCTGCCTCTAGG + Intronic
1195538756 X:106038588-106038610 CAAACCAAATTCCTGGCTCTAGG - Intronic
1196282405 X:113837517-113837539 AAGACCAAAGTCCTGGCTCAAGG - Intergenic
1197102454 X:122672529-122672551 AAGCCCAGATTCCTGTTTCTAGG + Intergenic
1197391985 X:125878409-125878431 CATCCCAGTCTTCTGGCTCTTGG + Intergenic
1197663012 X:129194077-129194099 AGGCCCAGAGGACTGGCTCTTGG - Intergenic
1197981219 X:132219113-132219135 CAGCCTAGACTCCTGGCCCTGGG - Intronic
1199569642 X:149254638-149254660 CAGCCAGGAGTCTTGGCTCCAGG - Intergenic
1199569644 X:149254642-149254664 GAGCCAAGACTCCTGGCTGTGGG + Intergenic
1199596934 X:149513408-149513430 CAGCCCAGAGCCCTGGCCCGTGG - Intronic
1200009799 X:153112355-153112377 CATCCCAGAGGCGAGGCTCTCGG - Intergenic
1200029801 X:153287567-153287589 CATCCCAGAGGCGAGGCTCTCGG + Intergenic
1200225055 X:154412584-154412606 AAGCCCAGTGTCCTGGCTTCAGG + Intronic
1200239946 X:154488171-154488193 CTGCCCAAGGCCCTGGCTCTGGG - Exonic