ID: 1128304201

View in Genome Browser
Species Human (GRCh38)
Location 15:66587181-66587203
Sequence AAGGAGAAGCAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6152
Summary {0: 1, 1: 13, 2: 227, 3: 1312, 4: 4599}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128304201 Original CRISPR AAGGAGAAGCAGGAGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr