ID: 1128306177

View in Genome Browser
Species Human (GRCh38)
Location 15:66600317-66600339
Sequence CATTGTGACAGGTGTGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128306174_1128306177 -4 Left 1128306174 15:66600298-66600320 CCTGGTATAAAGGGTCATTCATT 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1128306177 15:66600317-66600339 CATTGTGACAGGTGTGCAGTGGG 0: 1
1: 0
2: 2
3: 19
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128306177 Original CRISPR CATTGTGACAGGTGTGCAGT GGG Intronic
901353340 1:8619024-8619046 CATTGTCAAATGTGAGCAGTTGG - Intronic
902595258 1:17505256-17505278 CCTTGTTACATGTCTGCAGTAGG + Intergenic
903170022 1:21546994-21547016 CATTGTGCCAGGTGCCCTGTGGG - Intronic
903301566 1:22382543-22382565 CATTTTAACAGGTGTGTAATAGG - Intergenic
903317200 1:22517445-22517467 TACTGTGAAAGGTGTGCAGATGG - Exonic
903646265 1:24897994-24898016 CCGTGTGCCAGGTGTGGAGTAGG - Intergenic
912682180 1:111736334-111736356 CATTGTAACAGGTGAGCGCTGGG - Intronic
915669109 1:157472592-157472614 CATTCTGACAGGTATGTAGGTGG + Intergenic
915674638 1:157518739-157518761 CATTGTGATAGGTGGGCTCTTGG + Exonic
920256559 1:204659232-204659254 CATAGTGACAGAGGTACAGTAGG - Intronic
921818805 1:219593611-219593633 CATTGTCTCAGGTCTGCTGTTGG - Intergenic
924052149 1:240090118-240090140 CACAGTGACAGTTGTGCAGCAGG - Intronic
924247913 1:242103012-242103034 CCTAGTGGCAGGTGTGCTGTGGG + Intronic
924369861 1:243336312-243336334 CATTCTGACTGGTGTGAAATGGG + Intronic
1063651062 10:7937373-7937395 CATTCTAATAGGTGTGTAGTGGG + Intronic
1069369395 10:67730587-67730609 CAGGATGACAGGTGAGCAGTAGG + Intergenic
1075107692 10:119552624-119552646 CAGGGTAACAGGAGTGCAGTGGG + Intergenic
1076171068 10:128320346-128320368 CATTGTGAGAGGTAACCAGTTGG - Intergenic
1076487636 10:130835112-130835134 CGTTGTGCCAGGTGTGCCATGGG + Intergenic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1078360455 11:10663790-10663812 CATTGTGCTGGGTGTGTAGTAGG - Intronic
1078507812 11:11965495-11965517 CATTGTGACAGGTCTGGGGAGGG + Intronic
1079034002 11:17006877-17006899 AAATGTGACAGATGTTCAGTTGG - Intronic
1079505563 11:21148658-21148680 CAGTGTGAAAGGTGTGCAGGGGG - Intronic
1083174507 11:60941110-60941132 CATTGTGGCAGGTGTGCAGAGGG - Exonic
1084190334 11:67495758-67495780 CATTCTGGCAGGAGTGCAGCTGG - Intronic
1084412189 11:69011480-69011502 CATTGTGATGTGTGTGCAGTGGG + Intronic
1084456769 11:69272393-69272415 CAGTGGGACAGGTGGGCAGATGG - Intergenic
1086499596 11:87438466-87438488 CAAGATGACAGCTGTGCAGTGGG - Intergenic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1090145560 11:124318396-124318418 AATAGTGACAGGTATGTAGTGGG + Intergenic
1090469711 11:126969365-126969387 CAGTGTGGCAGGTGTGAAGGTGG + Intronic
1090562657 11:127949193-127949215 CATAGAAACAGGTGTGTAGTTGG - Intergenic
1091333915 11:134752728-134752750 CATACAGACAGGTGTCCAGTAGG - Intergenic
1092902349 12:13071726-13071748 CATTATGACTGGTCTGAAGTGGG + Intronic
1094343549 12:29440599-29440621 CATGGTAACAGGTGTTCTGTAGG + Intronic
1094490702 12:30958837-30958859 CATTGTAGCAGGTGCACAGTGGG + Intronic
1097631197 12:62064768-62064790 ATTTGTGACAGGTTTGCAGATGG - Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1103057505 12:117833335-117833357 CCTTGGGACAGGAGTGCATTTGG + Intronic
1104084119 12:125458711-125458733 CAGTGTGACAGCAGTGCAGGCGG - Intronic
1104286649 12:127430534-127430556 CAGTGTGACAGCAGTGCAGGCGG + Intergenic
1107356768 13:39575707-39575729 CATGGGGACAGCTGTGGAGTGGG + Intronic
1109864687 13:68247259-68247281 CATTCTGACTGGTGTGAAGTGGG + Intergenic
1110148327 13:72221171-72221193 CACAGTGACAGTTGTGCTGTGGG + Intergenic
1112895380 13:104293144-104293166 CATTGCAATAGGTGTGCAGTAGG + Intergenic
1118293639 14:64548959-64548981 CATTCTGGCAGCTGTTCAGTTGG - Intergenic
1120207969 14:81606785-81606807 ATTTGTTACAGATGTGCAGTTGG - Intergenic
1121220612 14:92282285-92282307 CCTTGTGCTAGGTGTGGAGTAGG - Intergenic
1121530524 14:94649575-94649597 TATTGGGGCAGGTGGGCAGTAGG + Intergenic
1122013321 14:98771991-98772013 CATTCTGACAGGTTTCCAGGAGG + Intergenic
1123787759 15:23689817-23689839 CATTTTAGCAGGTGTACAGTTGG - Intergenic
1127537151 15:59900649-59900671 CCTGGTGGCTGGTGTGCAGTTGG - Intergenic
1128013924 15:64325696-64325718 CATAGTGCCTGGTATGCAGTAGG - Intronic
1128306177 15:66600317-66600339 CATTGTGACAGGTGTGCAGTGGG + Intronic
1129887989 15:79052094-79052116 CATGGAGCCAGGTGTGGAGTCGG - Intronic
1130701440 15:86186562-86186584 CATTTTGACAGGCCTGCAGCAGG - Intronic
1130914147 15:88291467-88291489 CATTGTGACAGGTGTGAGAAGGG - Intergenic
1132810073 16:1793166-1793188 CATCGTGACAGAAGGGCAGTCGG - Intronic
1133226492 16:4343249-4343271 CATTGTGATGGGCGTGCAGGTGG - Exonic
1141954962 16:87364581-87364603 CAGTCTGACGGGTGGGCAGTTGG - Intronic
1143527566 17:7481432-7481454 CATTGTGACATGGTTGGAGTGGG - Exonic
1147320524 17:39643139-39643161 CATAGTGGTAGGTGAGCAGTGGG + Intronic
1152279971 17:79379467-79379489 CATTGAGAAAGGTGTGAAGATGG - Intronic
1152533460 17:80936160-80936182 CATTCTAACAGGTGTGTAGTGGG - Intronic
1153626028 18:7023202-7023224 CACTGTGAAAGGTGTGCTGACGG - Exonic
1153954460 18:10084448-10084470 CATTCTAATAGGTGTGCAGTGGG + Intergenic
1155056515 18:22188501-22188523 CATTGTGACTGGAGTGTAGGGGG + Intronic
1156011722 18:32504369-32504391 CATTGTGTCAGTAGGGCAGTAGG - Intergenic
1156896826 18:42256093-42256115 CATGGTAACAGCAGTGCAGTGGG + Intergenic
1157736758 18:50056419-50056441 TGTTCTGACAGCTGTGCAGTAGG - Intronic
1157852299 18:51067025-51067047 CATAGGCAAAGGTGTGCAGTTGG + Exonic
1159016654 18:63106357-63106379 CATTGTGCCAGGCCTGCAGGCGG + Intergenic
1160418972 18:78731408-78731430 CCTTGTGACAGGCGCTCAGTGGG + Intergenic
1162294414 19:9803263-9803285 CAAGGTGACTGGGGTGCAGTTGG - Intergenic
1162794193 19:13078248-13078270 CATTGGGAAAGGAGTGCAGGAGG - Intronic
1165394151 19:35555166-35555188 CATTGTGACAGGCGTGGAGCAGG - Exonic
1166933468 19:46316383-46316405 CATTCTAATAGATGTGCAGTGGG + Intronic
927903659 2:26841861-26841883 CTTTCTCACAGGTGTGCTGTGGG + Intergenic
928684534 2:33734720-33734742 CTGTGTAACAAGTGTGCAGTGGG - Intergenic
932470787 2:71954284-71954306 CGTTCTAAGAGGTGTGCAGTGGG + Intergenic
933892086 2:86781400-86781422 CTTGGTGGCAGGTGTGGAGTAGG + Intergenic
938073725 2:128321158-128321180 CAGTGTGGCAGGTATGAAGTTGG - Intergenic
938612196 2:132959507-132959529 CTTTTAGTCAGGTGTGCAGTTGG + Intronic
939771458 2:146324959-146324981 AATTCTGACATGTGGGCAGTAGG - Intergenic
939878843 2:147607167-147607189 CATGGTGCCAGGAGTGCTGTAGG - Intergenic
940282352 2:152000999-152001021 CATGGTGTCTGGTATGCAGTAGG - Intronic
942494262 2:176522460-176522482 CTTTGTGATAGGTGCTCAGTGGG + Intergenic
944980755 2:205117311-205117333 CATAGGCACAAGTGTGCAGTGGG - Intronic
946215509 2:218180493-218180515 CTTTGTGACTGGTATGAAGTGGG - Intergenic
946277194 2:218640482-218640504 GATTCTGACAGGTCTTCAGTGGG + Intronic
946604737 2:221391114-221391136 CCTTGTGAAAGGGCTGCAGTTGG + Intergenic
947925101 2:233914429-233914451 CATTGTGCAAAGGGTGCAGTGGG - Intergenic
948458940 2:238119897-238119919 CAGTGTGACAAGTGTCCAGCAGG - Intronic
1169282810 20:4281346-4281368 CATTGTGTCAGGTCTGAATTAGG + Intergenic
1171399046 20:24859877-24859899 GATTGTGGCAGGTGGACAGTGGG - Intergenic
1172073369 20:32275586-32275608 CAGTATGACAGCTGTGCAGTAGG + Intergenic
1173361230 20:42346369-42346391 CAGTGTGACAGGTGGGGCGTGGG + Intronic
1179174560 21:38998521-38998543 CATTCTGACTGGTGTGAAATGGG + Intergenic
1181775730 22:25158951-25158973 CATGGTGCCAGGCATGCAGTTGG + Intronic
1183829078 22:40408541-40408563 CGTGGTGACAGGTGCCCAGTCGG + Intronic
1185093509 22:48791327-48791349 CATTCTAATAGGTGTGCAGTGGG + Intronic
949797775 3:7869588-7869610 CCATGTGGCTGGTGTGCAGTGGG - Intergenic
950113548 3:10435643-10435665 CAGGGTGACAGGTGGGCAGGAGG + Intronic
950376892 3:12579719-12579741 CATTGAAACAGGTGTGTAGAAGG + Intronic
951591754 3:24273349-24273371 CATTCTAACAGGTGTCCATTTGG + Intronic
952585075 3:34882695-34882717 CAGTGTGAAAGGGGTACAGTAGG - Intergenic
953437190 3:42887432-42887454 CCTTGTGACAGTTGTGCAGTAGG + Intronic
954666889 3:52259237-52259259 CAGTGTGACAGCTTTGCTGTTGG + Exonic
954977897 3:54714015-54714037 GATTGTGACAAGTGAGCAGAGGG + Intronic
956245084 3:67173951-67173973 CCTGGTGGCAGGAGTGCAGTGGG + Intergenic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
958502907 3:94937296-94937318 CAGTGTGACAGCTTTGCTGTTGG + Intergenic
961686521 3:128636418-128636440 CATTCAGACTGGAGTGCAGTGGG - Intronic
964661589 3:159125860-159125882 CAGAGTCACAGGTGTGCTGTGGG + Intronic
966891429 3:184410147-184410169 CACTGTGGCTGGAGTGCAGTGGG - Intronic
968073731 3:195804372-195804394 CGAGGTGACAGGTGTGCTGTTGG + Intronic
969641853 4:8403501-8403523 CAGGGTGACAGGGATGCAGTGGG - Intronic
970456494 4:16227731-16227753 CATTCTGACAGCTGAGCAGGAGG + Intergenic
971812828 4:31449417-31449439 CATTCTGGTAGGTGTGAAGTAGG + Intergenic
971989715 4:33876428-33876450 CATTCTGACTGGTGTGAAATGGG + Intergenic
972808855 4:42561218-42561240 CACTGGGACAGGTGCGCACTGGG + Intronic
973803958 4:54506872-54506894 CATCGTGAGAGGTGGGGAGTGGG - Intergenic
975233511 4:71963012-71963034 CAATGTTACAAATGTGCAGTTGG - Intergenic
975528693 4:75378338-75378360 CATTGGGACTGGTTGGCAGTGGG + Intergenic
976437636 4:85036180-85036202 CTTTTTGCCAGGTTTGCAGTAGG - Intergenic
977128327 4:93199490-93199512 TATTGTTACTGCTGTGCAGTGGG - Intronic
977519397 4:98061748-98061770 CATTCTGACAGGTGTGAGATTGG - Intronic
979006039 4:115298423-115298445 CATTGATACAGATGTGAAGTAGG - Intergenic
983087373 4:163463809-163463831 CATTGTGTGTGGTGTGAAGTTGG - Intergenic
983843322 4:172483346-172483368 CATTGTGAAGGGAGTGCAGAGGG + Intronic
987147918 5:15010895-15010917 CATTTTGAAAGGTGCTCAGTGGG - Intergenic
987232129 5:15905874-15905896 CATTGTGACATGGGTGGGGTTGG - Intronic
989474268 5:41856571-41856593 CATTGTGTCAGGAGTGCCGGGGG - Intronic
989814882 5:45723773-45723795 AATTGTGACATGGTTGCAGTGGG + Intergenic
990089679 5:52026710-52026732 CATTCTGACAGGTGTGAGATGGG - Intronic
994081149 5:95710113-95710135 CATGGAGACAGATGTGCCGTGGG - Intergenic
995198288 5:109398105-109398127 CATTCTGACTGGTGTGGAGATGG - Intronic
995793240 5:115915904-115915926 CATTGTGAGAGGTGGACAATAGG - Intergenic
995941324 5:117588372-117588394 CCTTGTTACAGGTGTGATGTAGG + Intergenic
996180354 5:120411009-120411031 CATTGTGACAGGGCAGCACTGGG - Intergenic
997881917 5:137599369-137599391 CATAGAGACTGGTGTACAGTAGG - Intergenic
998712720 5:144845423-144845445 CATTCTAACAGGTGTGTACTGGG + Intergenic
998983634 5:147730924-147730946 CACTGTGACAGTCTTGCAGTGGG - Intronic
999641157 5:153674544-153674566 CAATGTGACAGGTTTCCAGCTGG + Exonic
1000644854 5:163748953-163748975 TATTGTGACACGTCTGCAGAAGG + Intergenic
1001154512 5:169261604-169261626 CATAGTGCCAGGTCTGGAGTAGG - Intronic
1002601183 5:180354612-180354634 CACCCTGACAGGTGTGAAGTGGG - Intergenic
1002916615 6:1533940-1533962 CATAGTGTGAGCTGTGCAGTGGG + Intergenic
1002952150 6:1824519-1824541 CATTGTGAGAGGTGGGCATTTGG - Intronic
1007503277 6:42315072-42315094 GCATGTGGCAGGTGTGCAGTGGG + Intronic
1009566876 6:65321047-65321069 CATTGTCTCAGGTCTGCTGTTGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1018049949 6:160000327-160000349 CATGGTGACAGGAGAGGAGTGGG + Intronic
1018059458 6:160079119-160079141 CCTCCCGACAGGTGTGCAGTAGG + Intronic
1020492453 7:8804659-8804681 CATTCTAACATGTGTACAGTGGG - Intergenic
1022982495 7:35617700-35617722 CTTTCTGACAGGTGTCTAGTAGG - Intergenic
1024630213 7:51240967-51240989 GATGGTGACTGGTGAGCAGTGGG + Intronic
1024905895 7:54379095-54379117 CATTCCCACAGGTGTGTAGTGGG + Intergenic
1024906302 7:54385729-54385751 CATTCTGATAGGTGTGTAGTGGG + Intergenic
1025251096 7:57352161-57352183 CATTGGCACAGGTGAGCTGTGGG - Intergenic
1027655800 7:80929766-80929788 CTGTGTGACAGGAGTGAAGTGGG - Intergenic
1028696539 7:93719699-93719721 CATTGTTACTGGTCTGCAGTTGG - Intronic
1028971335 7:96861705-96861727 TATTGTGCCATGTGTGCAGTGGG + Intergenic
1030936631 7:115593078-115593100 CATTGTGCCAGGTATGAACTAGG - Intergenic
1030977394 7:116143759-116143781 CATTGTGATATGTTTGCAGAAGG - Intronic
1032361624 7:131261447-131261469 CATTGTGACTGGTGTGAGATGGG - Intronic
1035642402 8:1194055-1194077 CAACGTGACAGGTGTGAACTGGG + Intergenic
1036209707 8:6832363-6832385 TAAGGTGACAGGTGTGCAGATGG + Intronic
1036613558 8:10371073-10371095 GATTGCGGCAGGGGTGCAGTGGG - Intronic
1036622806 8:10436770-10436792 TATTCCAACAGGTGTGCAGTGGG + Intergenic
1037699380 8:21260782-21260804 CATTGTAATAAGTGTGTAGTGGG - Intergenic
1040489512 8:47906590-47906612 CACTGTGTCTGGAGTGCAGTGGG - Intronic
1042074545 8:64976824-64976846 ATTTGTGACAGCTGTGAAGTAGG - Intergenic
1042201338 8:66281824-66281846 CATTGTAACAGCTGTGCCCTGGG + Intergenic
1043023751 8:75040587-75040609 CATTCTAATAGGTGTGCAGTGGG + Intergenic
1048028269 8:130606699-130606721 CCTTATGAGAGGGGTGCAGTGGG + Intergenic
1048619137 8:136112463-136112485 CATTCTGATGGGTGTGCTGTTGG + Intergenic
1049174125 8:141181004-141181026 CTGAGTGACAGGTGTGCAGCTGG + Intronic
1049500114 8:142958300-142958322 CATTCTGATAGGTGTGTAGTAGG - Intergenic
1049635928 8:143689420-143689442 CACTGTGGCAGGAGGGCAGTGGG + Intronic
1050045779 9:1543580-1543602 CCTTGTCAAAGGTCTGCAGTTGG + Intergenic
1051342147 9:16121425-16121447 CAGAGTCGCAGGTGTGCAGTAGG - Intergenic
1051719244 9:20018676-20018698 CATAGTGCCTGGTGTGTAGTGGG - Intergenic
1052715464 9:32111029-32111051 CATTCTAATAGGTGTGTAGTAGG - Intergenic
1056752691 9:89363588-89363610 CATTGAGAAAGGTGGCCAGTGGG - Intronic
1056797449 9:89668456-89668478 CCTCATGGCAGGTGTGCAGTGGG + Intergenic
1056850894 9:90082640-90082662 CAGGGTGACAGGTGGGCAGGTGG + Intergenic
1057209883 9:93194509-93194531 CATTCTAGTAGGTGTGCAGTGGG - Intronic
1059893045 9:118826519-118826541 CAAAGTGACAGGTGTGCAATGGG + Intergenic
1060463666 9:123883000-123883022 CATTGTGGCTGGAGTTCAGTGGG - Intronic
1061585899 9:131568158-131568180 CGAAGTGACAGGTGTGCGGTAGG + Intergenic
1186895166 X:13998114-13998136 CATTCTGACTGGAGTGCAGTGGG + Intergenic
1187869045 X:23749306-23749328 CCTTGTGGCAGGTCTGCTGTAGG + Intronic
1189367401 X:40399424-40399446 CATTGTGAGGTCTGTGCAGTGGG + Intergenic
1192747974 X:73958562-73958584 CATTCTAATAGGTGTGCAATGGG + Intergenic
1193264245 X:79449631-79449653 CAGTGTCACAGGTGAGAAGTAGG - Intergenic
1196094397 X:111783460-111783482 CATTCTAACAGGTATGTAGTGGG + Intronic
1199411090 X:147523967-147523989 CATTGTAACGGGTGTGTAGATGG + Intergenic