ID: 1128307653

View in Genome Browser
Species Human (GRCh38)
Location 15:66610573-66610595
Sequence TTTCAATTGTCAACAGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128307653_1128307656 17 Left 1128307653 15:66610573-66610595 CCTGGGTCTGTTGACAATTGAAA 0: 1
1: 0
2: 0
3: 23
4: 127
Right 1128307656 15:66610613-66610635 TCAGTTTTCTCATCTGTATGAGG 0: 1
1: 8
2: 119
3: 599
4: 1784
1128307653_1128307657 20 Left 1128307653 15:66610573-66610595 CCTGGGTCTGTTGACAATTGAAA 0: 1
1: 0
2: 0
3: 23
4: 127
Right 1128307657 15:66610616-66610638 GTTTTCTCATCTGTATGAGGTGG 0: 1
1: 1
2: 49
3: 628
4: 2850

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128307653 Original CRISPR TTTCAATTGTCAACAGACCC AGG (reversed) Intronic
905445688 1:38027284-38027306 TTTCAAGTCCCAACAGGCCCTGG - Intergenic
908690884 1:66779125-66779147 TTTCGATTCTCAACACAGCCTGG - Intergenic
910626691 1:89314827-89314849 TGTCAATTTCTAACAGACCCAGG - Intergenic
910753336 1:90658342-90658364 TTTCACTTTTCAGCATACCCTGG - Intergenic
911656351 1:100448378-100448400 TTTTAAATGTGAACAAACCCAGG + Intronic
912003781 1:104868001-104868023 TTTTCATATTCAACAGACCCAGG + Intergenic
913399521 1:118414059-118414081 TTTCAAATCTCAAGAGACCCTGG - Intergenic
914223145 1:145698285-145698307 TTTCAATTTTCAAGAGACTCTGG + Intronic
918949168 1:191113149-191113171 CTTAAATTGTCAACAGACTTAGG - Intergenic
921726169 1:218526021-218526043 TTTCAATTGTAAACACACAAAGG - Intergenic
922763392 1:228145820-228145842 TATCAGTACTCAACAGACCCAGG - Intronic
1064175356 10:13070559-13070581 TGTCACTTTCCAACAGACCCAGG + Intronic
1064213010 10:13376608-13376630 TTTAAATTGTTAACAGACTTTGG - Intergenic
1065714146 10:28548228-28548250 TTTTAATTTTCTAAAGACCCTGG + Intronic
1072207347 10:93215925-93215947 TTTGAAATGTCAAGAGACACGGG + Intergenic
1077637396 11:3853008-3853030 TGTAAATTGGTAACAGACCCTGG + Intergenic
1078850561 11:15159136-15159158 TTTCAGTTGTAGGCAGACCCAGG - Intronic
1078952630 11:16152297-16152319 TTTCAATGGTCAAAAGTCACAGG + Intronic
1080404029 11:31962639-31962661 TTTCCACTGTCCTCAGACCCTGG + Intronic
1087555020 11:99707554-99707576 ATTCAATTAACAACAGAGCCTGG - Intronic
1088065044 11:105707145-105707167 TTTCTATTGTCATCAAAGCCAGG - Intronic
1091614476 12:2038872-2038894 TTTCACCTGTCAACATACCTGGG - Intronic
1094012471 12:25823972-25823994 TTTCAATTTACAACAGCCGCTGG + Intergenic
1096121935 12:49094075-49094097 TTTCCCTTGTCACCAGCCCCAGG - Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1099408569 12:82294508-82294530 TTTCATTGGTCAACATAGCCTGG + Intronic
1100526594 12:95425383-95425405 ATTCAACTGTCAATGGACCCTGG + Intergenic
1105681385 13:22731337-22731359 TTTGAATTTTCAGCAGACACAGG - Intergenic
1109461485 13:62664635-62664657 TTTAAACTGTCAACAGTCACAGG - Intergenic
1110808231 13:79783017-79783039 TTTCAAGTGTCAACACTCCCAGG - Intergenic
1118197848 14:63644633-63644655 TTTCTATTTTCAGCAGACACTGG + Intergenic
1119037013 14:71238939-71238961 ATTCATCTGTCAACAGACACTGG - Intergenic
1122171506 14:99879644-99879666 TTTAAATTGTTAATAGACCGTGG - Intronic
1122832651 14:104408112-104408134 TTGCATTTGTCAAAAGACCTGGG + Intergenic
1126164228 15:45640413-45640435 TATCAAGAGTCAAGAGACCCAGG - Intronic
1128307653 15:66610573-66610595 TTTCAATTGTCAACAGACCCAGG - Intronic
1131295366 15:91143349-91143371 TTTCAATGGTCCCCAGACCTGGG - Intronic
1131375085 15:91916491-91916513 TATCCATGGTCAACACACCCTGG - Intronic
1131499134 15:92944448-92944470 TTTCAATTGCCAACAGGAGCTGG + Exonic
1137566681 16:49537774-49537796 TTTCTCTCTTCAACAGACCCAGG + Intronic
1142441204 16:90098605-90098627 TTTCAAATGTGAATATACCCAGG + Intergenic
1143107727 17:4537865-4537887 TTTGAAGACTCAACAGACCCTGG + Exonic
1143698719 17:8640865-8640887 TATCTATTTTCAACAAACCCAGG - Intergenic
1146429221 17:32774500-32774522 TTTGAAATGCCAGCAGACCCTGG - Intronic
1150589568 17:66550317-66550339 TTTCAATTGTCAAGAGACAAGGG - Intronic
1153520653 18:5950300-5950322 TCCCAAATGCCAACAGACCCTGG + Intergenic
1155917963 18:31574385-31574407 TTTCAAATGTCAAAAAATCCTGG - Intergenic
1156098314 18:33562897-33562919 TGTCACTTTTCAACAGGCCCAGG - Intergenic
1156732980 18:40217791-40217813 TGTCACTTTTCAACAGGCCCAGG - Intergenic
1156972086 18:43169152-43169174 TTTCACTTTCTAACAGACCCAGG + Intergenic
1158638316 18:59180528-59180550 TTTCTATTGGCACCAGCCCCAGG + Intergenic
1161375996 19:3939159-3939181 TTTTAATAGTCAGGAGACCCAGG + Intronic
1168606258 19:57762433-57762455 TGTCAATTGTCTACAGACTTAGG + Intergenic
925550032 2:5063641-5063663 TTTCAATGCTGAACAGACACAGG + Intergenic
926879600 2:17528977-17528999 TTACAATTGGCAACAGACACTGG - Intergenic
927494011 2:23540343-23540365 TGTCAAGTGCCAACAGCCCCAGG + Intronic
930686806 2:54318215-54318237 TTTCAAATGTCAGCAAACCCTGG + Intergenic
931257487 2:60585836-60585858 ATTCAAATGTCAAGTGACCCTGG - Intergenic
931814280 2:65885425-65885447 TGTCAATTGCCAACAGTCCCAGG - Intergenic
932969672 2:76525270-76525292 TTTCTATTGTCATAATACCCAGG - Intergenic
933974357 2:87496617-87496639 GTTCAAATGGCAACAGTCCCGGG - Intergenic
935213053 2:100954762-100954784 TTTCAACTGTCACCACACCTGGG - Intronic
936094238 2:109519586-109519608 TTTCAAGTCACAACTGACCCTGG - Intergenic
936319467 2:111454202-111454224 GTTCAAATGGCAACAGTCCCGGG + Intergenic
937779588 2:125822188-125822210 CTCCAATTGTAACCAGACCCAGG + Intergenic
938214565 2:129500202-129500224 TTTTAATTGTGCTCAGACCCTGG + Intergenic
939227145 2:139378451-139378473 TATCTATTTTCAACAGACTCTGG + Intergenic
939716146 2:145586584-145586606 TTTCACTTGTCAAGAGACGATGG - Intergenic
939997208 2:148931035-148931057 TTTCAAGTGTCATCTGACCTAGG - Intronic
941025823 2:160455156-160455178 TTTCAATTGACATCAGATACCGG - Intronic
941343488 2:164337808-164337830 TTTCAATTGTGAACTTACCTAGG + Intergenic
941544848 2:166836120-166836142 TTGAAATTGACAACAGCCCCTGG - Intergenic
942995175 2:182251886-182251908 AGTCAATTTTCAACAGACCATGG + Intronic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
946128530 2:217586025-217586047 TTTGTATGGTCAACAGAACCAGG - Intronic
947429403 2:230012520-230012542 CTTTAATTGTCAAGAGACCCAGG + Exonic
1170462514 20:16590507-16590529 TTTCAAAAGTCGACATACCCGGG - Intergenic
1170797260 20:19559611-19559633 TTTCAAGTGGCAACAGCTCCTGG + Intronic
1171116367 20:22528129-22528151 TTTGAACTGTCCACAGAGCCAGG + Intergenic
1172058155 20:32168565-32168587 TCTCAATTGTGAGCATACCCAGG + Intergenic
1173404236 20:42751352-42751374 TTTCCTTTGTCCCCAGACCCGGG + Intronic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1179144643 21:38757122-38757144 TCTCCATTGTCACCAGCCCCTGG + Intergenic
1182043230 22:27254567-27254589 TATCAATTGTCATCACACACGGG - Intergenic
1182748001 22:32620619-32620641 TCTCAATTTTCAAGAGAACCCGG + Intronic
949180155 3:1119491-1119513 TTTCAAATTTCCTCAGACCCTGG - Intronic
959947294 3:112138992-112139014 ATTCAAGGGTCAACAGACCAAGG + Intergenic
963617095 3:147554868-147554890 TGTGACTTGTCAACAGATCCTGG + Intergenic
964656895 3:159077144-159077166 TATCAATTTTCAGCAGACACTGG - Intronic
965454773 3:168884896-168884918 TTTAAAGTGACCACAGACCCTGG + Intergenic
968361466 3:198149577-198149599 TTTCAAATGTGAATATACCCAGG + Intergenic
971273300 4:25171782-25171804 TTTCAAGTGGCAAAAGCCCCAGG - Intronic
977163590 4:93667569-93667591 CTTCAGTTGTCAAGAGTCCCAGG + Intronic
978858598 4:113422673-113422695 TTTCAAGAGTCCACAGGCCCAGG + Intergenic
979474256 4:121136080-121136102 TTTCAAATGACAACATATCCTGG + Intronic
980876091 4:138663777-138663799 TGTCAATTGGCAGCAGATCCAGG + Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
982914862 4:161194753-161194775 ATCCATTTGTCAACAGACACAGG + Intergenic
983127983 4:163978638-163978660 TTTCAATTGGCAACAGAGTAAGG - Intronic
984315841 4:178130069-178130091 TTTAAATGGTGAACAGATCCAGG - Intergenic
984775130 4:183474914-183474936 TATCAATTGTCAACATTCCCTGG + Intergenic
987523541 5:19019023-19019045 TTTCAGTTATCAACAGCCGCAGG + Intergenic
987539348 5:19234251-19234273 TTTCAATTGTCACCAAAACCTGG - Intergenic
987632652 5:20494877-20494899 TTTTAATTGTCCACAGCCCTGGG + Intronic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
992847005 5:80760700-80760722 GTTCAATTGGTAACAGATCCGGG + Intronic
995703425 5:114960819-114960841 TTTTAATTAACAACATACCCTGG + Intergenic
996649168 5:125852579-125852601 TTTCTATTCTTAACATACCCTGG + Intergenic
1012818041 6:104049348-104049370 CTTCAATTGTCCAAAGGCCCTGG + Intergenic
1013287481 6:108693688-108693710 TGTAAATTGTAAACAGTCCCAGG + Intergenic
1019254224 7:39143-39165 TTTCAAATGTGAATATACCCAGG - Intergenic
1019843100 7:3469085-3469107 TTTCAAATCACAACAGACTCTGG - Intronic
1020579307 7:9974412-9974434 CTTTAATTGTCAACAGAATCAGG + Intergenic
1021026787 7:15677695-15677717 TTCCAACTGTGGACAGACCCTGG + Intronic
1021371672 7:19856768-19856790 CTTCAATAGTCAACAAATCCAGG + Intergenic
1027235376 7:76294767-76294789 TTTCAATTCCCAGCAGGCCCGGG + Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1039338476 8:36621102-36621124 ATTCAATTGTCAAGTCACCCGGG + Intergenic
1041572579 8:59353878-59353900 ATACAATTGTTAAGAGACCCTGG - Intergenic
1044592248 8:93925234-93925256 TTTCAATTGAAAATAGACTCAGG + Exonic
1048065877 8:130968120-130968142 TTTAAATTCTCTACAGACCACGG - Intronic
1049925875 9:406675-406697 ATTCATTTTTCAACAGACCCGGG + Intronic
1051103813 9:13553900-13553922 TTTTTATTGTAAACATACCCAGG - Intergenic
1051580560 9:18669165-18669187 TTTGAATTGACCACATACCCAGG + Intronic
1057304388 9:93903884-93903906 CTTCAAATGTCACCAGGCCCAGG - Intergenic
1057465129 9:95306677-95306699 TTTCAATAATCAAAAGAGCCGGG - Intronic
1058235268 9:102482375-102482397 ATTCAATTGTTAACAGATACAGG - Intergenic
1062746178 9:138213398-138213420 TTTCAAATGTGAATATACCCAGG + Intergenic
1185989669 X:4879276-4879298 ATTGAACTGTCAAGAGACCCAGG + Intergenic
1187691486 X:21872852-21872874 TCTTAAATGTCCACAGACCCAGG - Intronic
1188688474 X:33099370-33099392 TTTCTATTGTCCCCAGAGCCAGG + Intronic
1189720628 X:43912600-43912622 TTTCAAGTGCCAAAAGACCATGG + Intergenic
1190175634 X:48146783-48146805 TTTTAATTCTCTACAGACCCAGG + Intergenic
1190186401 X:48238326-48238348 TTTTAATTCTCTGCAGACCCAGG + Intronic
1190195799 X:48317277-48317299 TTTTAATTCTCTGCAGACCCAGG + Intergenic
1190201677 X:48367224-48367246 TTTAAATTCTCTACAGACCCAGG - Intergenic
1190208863 X:48428177-48428199 TTTCAGTTCTCTACAGACGCAGG + Intergenic
1190627851 X:52353907-52353929 TGTCAATGGTTAACAGAACCTGG + Intergenic
1190662502 X:52667639-52667661 TTTTAATTATCTACAGAACCAGG + Intronic
1190668515 X:52717736-52717758 TTTTAATTCTCTACAGACCCAGG - Intergenic
1190670902 X:52740668-52740690 TTTTAATTCTCTACAGACCCAGG + Intergenic
1190700139 X:52981625-52981647 TGTCAATGGTTAACAGAACCTGG - Intronic
1191109824 X:56795740-56795762 TTTTAATTGTCAACAAATGCAGG + Intergenic
1191598765 X:62978153-62978175 TTTCAATGATTAACAGACTCAGG - Intergenic
1192091552 X:68163480-68163502 ATTCATTTGTCAACAGACACTGG + Intronic
1192863418 X:75104232-75104254 TTTTATTTGTCAATAGACACAGG - Intronic
1194858509 X:98964289-98964311 TTTTAATTGCCAACAGAGGCCGG - Intergenic
1195069682 X:101267110-101267132 TGTCAATTGGGATCAGACCCGGG + Intergenic
1195864942 X:109421569-109421591 TTTCTATTTCCAACAGCCCCTGG - Intronic
1198405876 X:136311866-136311888 TTTAAATTGTAAATAGACACAGG + Intronic