ID: 1128308243

View in Genome Browser
Species Human (GRCh38)
Location 15:66614031-66614053
Sequence TTGCTGTTCTAGGGGACAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128308243 Original CRISPR TTGCTGTTCTAGGGGACAAT GGG (reversed) Intronic
901285882 1:8078528-8078550 TTGCTGTTCTGGAGAATAATTGG + Intergenic
902043662 1:13510106-13510128 TTGCTTCTCTGGGGGACAAGGGG + Intronic
907704960 1:56825013-56825035 CTTCTGCTCTAGGAGACAATGGG - Intergenic
908063995 1:60382842-60382864 TTGCTGTTCTATTGTACAGTAGG - Intergenic
909126329 1:71675368-71675390 TTGCTGATCTAGTGGTGAATGGG - Intronic
915254620 1:154616920-154616942 CTGGAGTTCTAGTGGACAATGGG + Intronic
916330980 1:163616594-163616616 TTGCTGTTCTATTGCACAGTAGG + Intergenic
921724572 1:218509187-218509209 CTGCTGATCTATGGGACTATTGG + Intergenic
1065347368 10:24761420-24761442 TAGCTATTTTAGTGGACAATTGG + Intergenic
1066132915 10:32411947-32411969 TTGCTTATCAAGGGCACAATGGG - Intergenic
1067722387 10:48738552-48738574 CTGCTGCTCTAGGGGGCACTTGG + Intronic
1067820473 10:49524390-49524412 TTGCAGTTCCAGGGGAAAGTGGG - Exonic
1071498380 10:86186519-86186541 CTGCTTCTCTAAGGGACAATGGG + Intronic
1071619630 10:87107447-87107469 GTGCTGTGCTATGGGATAATGGG + Intronic
1073903959 10:108255240-108255262 ATCTTGTTATAGGGGACAATTGG - Intergenic
1075344860 10:121674548-121674570 TGGCTGTTCTAAGGAAGAATAGG - Intergenic
1075581965 10:123625645-123625667 TTGCTGTTTTAGGGAGCAGTGGG + Intergenic
1079240682 11:18720366-18720388 TTTTTTTTTTAGGGGACAATAGG + Intronic
1080168700 11:29272309-29272331 TTGCTGCCCTAGGAGACATTAGG - Intergenic
1080621715 11:33992338-33992360 TTGCAGTTCTAGAGGATAAATGG + Intergenic
1080659604 11:34285208-34285230 TTGCTGTACAAGTGGACAGTGGG + Intronic
1083919083 11:65771180-65771202 TTGTTTTTCTAGGCGACACTGGG + Intergenic
1086524999 11:87714624-87714646 TAGCTGCTTTAGGGGAGAATGGG + Intergenic
1087144851 11:94801069-94801091 GTGCTGTTCTAGGAGAGAAATGG + Intronic
1088389486 11:109298389-109298411 TGGCTGGTCAAGGGGGCAATCGG + Intergenic
1088476824 11:110249422-110249444 TTTCTGTTTTAGGGGCAAATGGG - Intronic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1093119905 12:15256629-15256651 TTGATGTTCTCAGTGACAATTGG - Intronic
1094724009 12:33093729-33093751 CTGCTGTTCTATTGCACAATAGG - Intergenic
1098228423 12:68348463-68348485 CTGCTGTTTTGGGGGATAATTGG - Intergenic
1100205137 12:92340262-92340284 TTACAGTTGTAGTGGACAATGGG - Intergenic
1101890467 12:108710103-108710125 TTGCTGTTGTATTGGAAAATAGG - Intronic
1102902885 12:116652168-116652190 TTGCTGCCCCAGGGGACACTTGG + Intergenic
1104009151 12:124916882-124916904 TTGCTCTTTCAGGGGACATTTGG + Intronic
1104163599 12:126204801-126204823 TGGCAGCTCTAGGGGATAATTGG + Intergenic
1104228124 12:126857045-126857067 TTCCTGTTGTATGAGACAATGGG + Intergenic
1104960375 12:132485867-132485889 TTCCTTTTCTAGGGGAGCATGGG + Intergenic
1105853253 13:24354415-24354437 TTGCTGTTCTTGGGGAGCAATGG - Intergenic
1106134752 13:26965758-26965780 TTGCTTTTCTAGATGAGAATGGG + Intergenic
1107274582 13:38663669-38663691 TAGCTGTTCTAGGTGGGAATGGG + Intergenic
1107524342 13:41214917-41214939 TTGCTGCATTGGGGGACAATTGG + Intergenic
1109198570 13:59406390-59406412 TGGGAGTTCTAAGGGACAATTGG + Intergenic
1111426328 13:88088947-88088969 TTGCTACTGTAGGGGATAATGGG + Intergenic
1111525782 13:89467150-89467172 CGGCAGTTCTATGGGACAATTGG + Intergenic
1116238684 14:42313301-42313323 TTTCTTTTCCAGAGGACAATGGG - Intergenic
1119873958 14:78040935-78040957 TGCCTGTTCTAGAGGACACTGGG + Intergenic
1123777923 15:23598851-23598873 TATCAGTTCTATGGGACAATTGG + Intronic
1126209855 15:46089534-46089556 ATGCTGCTCTAGCAGACAATAGG - Intergenic
1128308243 15:66614031-66614053 TTGCTGTTCTAGGGGACAATGGG - Intronic
1130257627 15:82333111-82333133 TTGCTGGTCTGTGGGACAGTTGG + Intergenic
1130597313 15:85256853-85256875 TTGCTGGTCTGTGGGACAGTTGG - Intergenic
1131038185 15:89239412-89239434 TTTCTTTTCTAGAGGACACTGGG - Intergenic
1131872248 15:96775174-96775196 TTGTTCTTCCTGGGGACAATAGG + Intergenic
1134297377 16:12958965-12958987 TGGCTGGTATAGGGGGCAATGGG + Intronic
1135495946 16:22951278-22951300 GTCCTGCTCCAGGGGACAATGGG - Intergenic
1137543334 16:49379469-49379491 TTGCTGTTGTTGGGTACAATGGG - Intronic
1137911723 16:52384533-52384555 TTGATGTTCCATGGGTCAATAGG - Intergenic
1144817052 17:18041709-18041731 CTGATGTAGTAGGGGACAATTGG + Intronic
1149270890 17:54976327-54976349 TATCAGTTCTATGGGACAATTGG - Intronic
1150227542 17:63532040-63532062 TTGCAGCTCTGGGGGACACTGGG + Intronic
1152794870 17:82301909-82301931 TTGCCGGGCTAGGGGACCATGGG - Intergenic
1155671411 18:28376539-28376561 TTGGACTTCTAGGGGACACTGGG - Intergenic
1156396189 18:36702145-36702167 TTGCTCTCCTGGGGGACATTTGG + Intronic
1157533709 18:48443103-48443125 TTGCTGTTCCAGGAGATCATGGG - Intergenic
1157711096 18:49850171-49850193 TTGCTGTTCTAGGTCTCAGTGGG - Intronic
1159565358 18:70041933-70041955 TTGCTGTCCAAGGGGACCAATGG - Intronic
1160092883 18:75843626-75843648 TTGCTGCTCTAGGGGACTTTGGG + Intergenic
1164553492 19:29232315-29232337 TTCGTGTTCTAGAAGACAATGGG - Intergenic
925787950 2:7451506-7451528 TTGCTCTTCCAGGGGACATTTGG + Intergenic
930161863 2:48166800-48166822 TTGCTGCTCTGGGTGGCAATAGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932101253 2:68901065-68901087 GTGCTGTTCTAGGAGAAAGTGGG + Intergenic
932557867 2:72841634-72841656 TTGCTGTTCCAGGTGTCACTGGG + Intergenic
933792811 2:85896716-85896738 TATCAGTTCTATGGGACAATTGG + Intergenic
938550707 2:132379551-132379573 TTGCTGTTGAATGGGAAAATAGG - Intergenic
939731595 2:145791319-145791341 TTGCTGTTCTAGAAAACAAGGGG - Intergenic
939987667 2:148847503-148847525 TTGGTGTTCTAGGTGACATTAGG - Intergenic
940484580 2:154281365-154281387 TTGTTGATCTAAAGGACAATTGG + Intronic
943341507 2:186687732-186687754 TATCAGTTCTATGGGACAATTGG - Intergenic
946543543 2:220712351-220712373 GTGCTGTGCTAGAGGACAACTGG + Intergenic
948446235 2:238035301-238035323 GTGCTTTTCCAGGGGAGAATGGG + Intronic
1172966960 20:38842912-38842934 TTGCTGTTCAGGGGGAATATGGG - Intronic
1174514828 20:51083676-51083698 TTGCTGTTCTTCGGCACATTGGG - Intergenic
1176732787 21:10517585-10517607 TTGCTGTTCTTTGAGACACTGGG + Intergenic
1178108293 21:29346567-29346589 TTGCTTGCCTAGGGGACACTTGG + Intronic
1181146156 22:20849067-20849089 TGGCTGTTCTAGGATAGAATAGG + Intronic
1182477933 22:30586629-30586651 TTGCTTTTCCAGTGGACATTTGG - Intronic
950717796 3:14862103-14862125 TGGCTGTGCTAGGAGACACTCGG + Intronic
959197926 3:103209811-103209833 TTTCTTTTCCAGGGGACACTGGG + Intergenic
960875141 3:122288288-122288310 TGGATGTTTTAGGGGAGAATCGG - Intergenic
961922271 3:130439833-130439855 TAGCATTTCTTGGGGACAATTGG + Intronic
963607944 3:147428530-147428552 TTGCTGTTCTTTGGTTCAATTGG + Intronic
964246169 3:154656458-154656480 GTGCTGTGATAGGGGACAACTGG + Intergenic
967162178 3:186748601-186748623 TATCAGTTCTATGGGACAATTGG + Intergenic
968999969 4:3972690-3972712 TTACTCATCTAGGGAACAATTGG + Intergenic
974200048 4:58625274-58625296 TAGCTGTTCTAAGGCACATTTGG - Intergenic
975351231 4:73349703-73349725 TTGCTATTCTAGGGGAAAAGAGG + Intergenic
978015080 4:103734175-103734197 TGTCAATTCTAGGGGACAATTGG - Intergenic
981251474 4:142607906-142607928 TTCCTGTTCTATGGGGCAAATGG + Intronic
988699590 5:33660301-33660323 TTGCTGTTAACGGGTACAATTGG - Intronic
991035738 5:62125539-62125561 TTGCTTTTCAAGGGGAAAATGGG + Intergenic
992225035 5:74611960-74611982 TTGCTGTCCTAAGGGACAGTAGG + Intergenic
993627923 5:90248098-90248120 TTGATGTTCTATAGAACAATTGG - Intergenic
994781053 5:104090149-104090171 TTTCAGTTCTATGGGAAAATTGG + Intergenic
999845280 5:155472527-155472549 TTGCTGTTCAAGGAGAAAAAGGG + Intergenic
1003195576 6:3911286-3911308 TTGTTTTCCTAGTGGACAATAGG - Intergenic
1005636296 6:27756776-27756798 TTACTGATCTGAGGGACAATGGG - Intergenic
1009719152 6:67442607-67442629 TTCCTGTTCTATGTGACAACGGG - Intergenic
1009761415 6:68011818-68011840 TTGGTGTTCCAGGGGACTACCGG - Intergenic
1009848730 6:69167836-69167858 TTGCTAGTGTAGGGGACAAGGGG + Intronic
1011117500 6:83909777-83909799 TTGCTCTTCAGGGGGACATTTGG + Intronic
1013576799 6:111491520-111491542 TTGCCGCCCTAGGGGACATTTGG + Intergenic
1014268699 6:119312111-119312133 CTGCTGTTCTTGGGGACACAAGG + Intronic
1015553731 6:134439482-134439504 TTGTTGTTCAAGGGGAAAAGTGG - Intergenic
1018905732 6:168074328-168074350 GTGCTGTTCTGGGGGGCAGTTGG - Intronic
1020005198 7:4780107-4780129 TTGCTGTGCCAGGGGACTCTGGG - Intronic
1021273856 7:18625555-18625577 TTTCTCTTCCAGGGGACATTTGG - Intronic
1022513763 7:30962371-30962393 TTGCTTCCCTAGGGGACATTTGG - Intronic
1024407550 7:48999861-48999883 TTGCAGGTGTAGGGGACAAGTGG - Intergenic
1024580498 7:50796795-50796817 TTGATGTTCTAGGGTGCCATGGG - Intergenic
1028645580 7:93093169-93093191 GTGCTGGTCTGGGAGACAATGGG - Intergenic
1030518482 7:110566938-110566960 ATGGTGTTTTAGGGGAGAATGGG + Intergenic
1031327934 7:120425642-120425664 TTGCTGTGCTAAGAGGCAATGGG - Intronic
1032872814 7:136004380-136004402 TGGCTGTTCTAAGGGCCACTTGG + Intergenic
1033363159 7:140652172-140652194 TTGCTTCTCCAGGGGACATTTGG + Intronic
1034343703 7:150373029-150373051 GTGCTGGAGTAGGGGACAATGGG + Intronic
1036117419 8:5972995-5973017 TTGGTGTTTTAGGGGAAAAGAGG - Intergenic
1036377260 8:8211262-8211284 TTACTCATCTAGGGAACAATTGG - Intergenic
1036852288 8:12211889-12211911 TTACTCATCTAGGGAACAATTGG + Intergenic
1036873656 8:12454410-12454432 TTACTCATCTAGGGAACAATTGG + Intergenic
1039290343 8:36087976-36087998 CTTCAGTTCTATGGGACAATTGG + Intergenic
1043242117 8:77947048-77947070 CTGCTGTTTTAAGGGTCAATAGG - Intergenic
1044203966 8:89470003-89470025 CTGCTGGTCTGGGGGCCAATTGG - Intergenic
1045499889 8:102737161-102737183 TTACTGTTCTGGAGGACAAAAGG + Intergenic
1046383489 8:113479888-113479910 TTGCTGTTGAATGGGAAAATGGG - Intergenic
1047307896 8:123668017-123668039 CATCAGTTCTAGGGGACAATTGG + Intergenic
1048154769 8:131936151-131936173 TTCCTCTTCTAGAGGTCAATTGG + Intronic
1048429393 8:134355085-134355107 TTGCTGCTCTATGGAACATTGGG + Intergenic
1054985155 9:71253340-71253362 TTGCTTTCCTGGGGGACATTTGG + Intronic
1058252033 9:102711113-102711135 TTGCTGCTCTAAGGGAGATTTGG + Intergenic
1058456663 9:105143887-105143909 TTGCTTCTCTAGGGAACAAAGGG - Intergenic
1186505353 X:10087088-10087110 ATGCTGTGCTAGAGGACAGTTGG - Intronic
1188908184 X:35813209-35813231 TATCAGTTCTATGGGACAATTGG + Intergenic
1194567832 X:95515715-95515737 TTGTTGTTCAAGGAGAAAATTGG - Intergenic
1194885783 X:99314540-99314562 TTGCTGTGCTGGGGGTCACTGGG + Intergenic
1195237057 X:102911123-102911145 GTGCTGTTGTAGGGCACAGTGGG + Intergenic
1197004309 X:121477873-121477895 ATACAGTTCTAGGGGACAACAGG + Intergenic