ID: 1128308585

View in Genome Browser
Species Human (GRCh38)
Location 15:66616298-66616320
Sequence CTTGATCAGGACCACACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 255}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128308585 Original CRISPR CTTGATCAGGACCACACAGT TGG (reversed) Intronic
900297093 1:1957343-1957365 CTGGAGCAGGAGCACAGAGTGGG - Intronic
901740833 1:11340598-11340620 CTTGCTCAGGATCACACAGCAGG - Intergenic
901883877 1:12209409-12209431 CCTGCTCGGGACCACACAGCTGG + Intergenic
902253624 1:15172593-15172615 CTTGCTCAGGATCACAAAGCTGG - Intronic
902887747 1:19418381-19418403 CCTGATCCTGAGCACACAGTGGG + Intronic
902981179 1:20124527-20124549 CTTGACCAGGGTCACACAGCAGG + Intergenic
903133672 1:21295086-21295108 CTTGCTCAGGGTCACAGAGTTGG - Intronic
903351212 1:22717519-22717541 CTTGGTCAAGGCCACACAGCAGG - Intronic
903814548 1:26055219-26055241 CTTGTTCAAGGCCACACAGCTGG - Intronic
903828763 1:26162457-26162479 CTTGCCCAGGATCACACAGCCGG - Exonic
905241608 1:36585072-36585094 CTTGCCCAAGACCACACAGCTGG - Intergenic
905514570 1:38552756-38552778 CTTGACCAAGGCCACACAGCTGG - Intergenic
905876045 1:41432721-41432743 CCTGTTCATGACCCCACAGTGGG + Intergenic
905895183 1:41541133-41541155 CTTGCTCAGGATCACACAGCTGG - Intronic
906749673 1:48247739-48247761 TTTGTTCAGGACCACCCAGAAGG + Exonic
906940829 1:50253654-50253676 CATGTACAAGACCACACAGTGGG + Intergenic
908029869 1:59987750-59987772 CTTGTTCAGGGCCACACAGCTGG + Intronic
908524869 1:64977847-64977869 CTTGCTCAAGATCCCACAGTAGG - Intergenic
909686621 1:78355810-78355832 CTTCATCAGCACCACACAAAAGG + Intronic
909893252 1:81034617-81034639 CCTTATCAGGAACACACAGGTGG + Intergenic
911145908 1:94552361-94552383 CTTGCTCAAGATCACACACTGGG + Intergenic
912868110 1:113277371-113277393 CTTGCTCAGCATCACACAGCTGG + Intergenic
914344974 1:146791081-146791103 CTTTGGTAGGACCACACAGTGGG + Intergenic
914975492 1:152357090-152357112 CTGGATCTGGATCAAACAGTTGG - Exonic
916279261 1:163030640-163030662 CTTGAGTATGACCACACGGTTGG - Intergenic
918217837 1:182408560-182408582 CTTCATCAGGAACTCACAGGTGG + Intergenic
919841675 1:201613967-201613989 TTTGCTCAGGACCACAAAGCAGG + Intergenic
919845310 1:201638706-201638728 CTTGCCCAAGACCACACAGCAGG - Intronic
921892648 1:220368565-220368587 CTTGATCTGGACACCACACTGGG + Intergenic
922474613 1:225898648-225898670 CTTGTCCAGGGCCACACAGCTGG + Intronic
923015463 1:230123196-230123218 CTTGGTCAGAAACTCACAGTGGG - Intronic
924197667 1:241624865-241624887 CTTGACCAAGATCACACAGCTGG - Intronic
1063636379 10:7787228-7787250 CTTGCCCAAGACCACACGGTTGG + Intronic
1063734434 10:8736431-8736453 CTTGCTCAAGACCAAACAGTTGG - Intergenic
1064508960 10:16067994-16068016 TTTGATGAGGACCACCCAATTGG - Intergenic
1069783591 10:70973951-70973973 CTTTCTCAGGAGCACACAGCTGG + Intergenic
1070933546 10:80277024-80277046 CTTGGTCAAGATCACACAGTCGG + Intronic
1072531599 10:96324544-96324566 CTTGCTCAAGATCACACAGCTGG - Intronic
1072818385 10:98531820-98531842 CTTGCTAAGGGTCACACAGTTGG - Intronic
1073463310 10:103678943-103678965 CTGAAACAGAACCACACAGTAGG + Intronic
1073479226 10:103775717-103775739 CTTGAGGATGACCACACAGCTGG + Intronic
1073802612 10:107058604-107058626 CTTGCTCAGGACCATACAGATGG - Intronic
1074189468 10:111123481-111123503 CTTGCCCAGGGTCACACAGTTGG + Intergenic
1074191111 10:111138530-111138552 CTTGAACAAGAACACACAGCTGG + Intergenic
1074746708 10:116541722-116541744 CCTGCCCAGGAACACACAGTTGG - Intergenic
1075539176 10:123297971-123297993 CTTGGTCAAGTTCACACAGTTGG + Intergenic
1077968292 11:7159670-7159692 CTGGATCAGGAGCAGACACTTGG + Intergenic
1078747624 11:14130237-14130259 CTGTATCATGACCTCACAGTGGG - Intronic
1078747700 11:14131179-14131201 CTGTATCATGACCTCACAGTGGG + Intronic
1079041548 11:17064473-17064495 CTTGCTCAGGGTCACACAGTGGG - Intergenic
1079590929 11:22181706-22181728 CTTGCTGAAGATCACACAGTTGG - Intergenic
1080746426 11:35112284-35112306 CTTGCTCAAGATCCCACAGTAGG + Intergenic
1081645124 11:44784827-44784849 CTTGTTCAGGGTCTCACAGTTGG + Intronic
1081787511 11:45757703-45757725 CTTGCCCAGGGCCACTCAGTAGG + Intergenic
1083702687 11:64490174-64490196 CAAGAACAGGACCACGCAGTGGG + Intergenic
1084237300 11:67796433-67796455 CTTGCTCTGAAGCACACAGTAGG + Intergenic
1084898850 11:72294794-72294816 CTTGACCAGGACCACACAGATGG - Intronic
1086335324 11:85795017-85795039 CTTGCCCAAGGCCACACAGTGGG - Intronic
1087922802 11:103886166-103886188 CTTGATCAGGAGCACTCTGGAGG - Intergenic
1087989775 11:104734441-104734463 CTTAATAAGTACAACACAGTAGG + Intergenic
1089015281 11:115160268-115160290 TTTGTTCAGGACCACACAACTGG - Intergenic
1089158818 11:116422562-116422584 CTTGCTCAAGGCCACACAGCTGG - Intergenic
1089344001 11:117778457-117778479 CTTGTCCAGGATCACACAGTGGG - Intronic
1090429120 11:126631308-126631330 CTTGATGAGGGCCACACAGCTGG + Intronic
1092525224 12:9305767-9305789 CTTGTTCAGGACCACAAGATGGG - Intergenic
1092542047 12:9426050-9426072 CTTGTTCAGGACCACAAGATGGG + Intergenic
1092652581 12:10650500-10650522 CTTGATCAGGAGCACAAAGTTGG - Intronic
1092937336 12:13376321-13376343 CTTCATCAGGAACACACAGAAGG + Exonic
1094510961 12:31096389-31096411 CTTGTTCAGGACCACAAGATGGG - Intronic
1095375916 12:41528510-41528532 TTTGCTGATGACCACACAGTGGG - Intronic
1095821766 12:46486465-46486487 CTTGTTTAGGACCCCCCAGTGGG + Intergenic
1096593863 12:52681537-52681559 CGTGATCAAGTCTACACAGTTGG + Intergenic
1097607788 12:61777235-61777257 CTTGCTCAAAGCCACACAGTTGG - Intronic
1098411368 12:70187789-70187811 CTTGATCAAGACTACACAGCTGG + Intergenic
1100012104 12:89966044-89966066 CTTGTCCAATACCACACAGTGGG + Intergenic
1100572560 12:95857213-95857235 CTTGCTCAGGACCACATACCTGG - Intergenic
1102557974 12:113741383-113741405 GTTGATCAAGGTCACACAGTTGG - Intergenic
1102622434 12:114206850-114206872 TTTGTTCAGGACCACACTTTGGG + Intergenic
1103009895 12:117449998-117450020 CTTGCTCAGCATCACACAGTGGG - Intronic
1103038946 12:117678827-117678849 CTTGTCCAAGACCACACAGCTGG - Intronic
1103165195 12:118764505-118764527 CTTGCTCATGGCCACACAGCTGG - Intergenic
1103407195 12:120684677-120684699 CTTGCCCAAGGCCACACAGTGGG + Intergenic
1104214475 12:126722743-126722765 CTTGCTCAAGGCCACACAGTTGG - Intergenic
1104404151 12:128503746-128503768 CTTGCTCAAGATCACACAGCTGG + Intronic
1104424065 12:128660224-128660246 CTTGCCCAGGGCCACACAGCTGG - Intronic
1107521928 13:41192098-41192120 GTTGATTAGGACCACAGATTTGG - Exonic
1107805175 13:44146909-44146931 CGTGATCAGGACCAGAGAGGAGG + Intronic
1108521491 13:51250801-51250823 CTTGGCCAGGACCCCACAATAGG + Intronic
1111979234 13:94999847-94999869 CTTGTTCAGAGCCACAAAGTTGG - Intergenic
1114727693 14:24955948-24955970 CTTGCTCAAGATCACACAGCTGG + Intronic
1116945636 14:50832177-50832199 CTTCCTCAGGATCACACAGCAGG + Intergenic
1117095355 14:52291682-52291704 CTTGAATAGCACCACACTGTTGG + Intergenic
1118302827 14:64630560-64630582 CTTGCCCAAGACCACATAGTTGG + Intergenic
1118617331 14:67583311-67583333 CTTGATCAGGGACACAAAGCTGG + Intronic
1118914732 14:70093389-70093411 CTTTCCCAGGACCACACAGCTGG - Intronic
1119439486 14:74618742-74618764 CTTGCTCAAGGCCACACAGCTGG + Intergenic
1119543180 14:75453676-75453698 CTTGCCCAGGAGCACACAGCTGG + Intronic
1121947899 14:98140697-98140719 CTTGTTCAGGATCATACAGGTGG + Intergenic
1122000869 14:98651410-98651432 CTTGACCAAGGCCACACAGCTGG + Intergenic
1122344674 14:101051169-101051191 CATGACAAAGACCACACAGTTGG + Intergenic
1122370333 14:101225900-101225922 CTGGATCAGGAGCACCCACTTGG - Intergenic
1125584088 15:40807964-40807986 CTTCATCAAAACCACACAGCTGG - Intronic
1126870472 15:52981660-52981682 CTTGTTCAAGGTCACACAGTGGG - Intergenic
1128308585 15:66616298-66616320 CTTGATCAGGACCACACAGTTGG - Intronic
1128512019 15:68319209-68319231 CCTGCCCAGGACCACACAGCTGG - Intronic
1128651463 15:69417400-69417422 CTTGATCAGGAAAGCCCAGTGGG - Exonic
1128770069 15:70275477-70275499 CTTGTTCAGTACCACAGAGCTGG + Intergenic
1130107709 15:80941471-80941493 CTCGCCCAGGACCACACAGCTGG - Intronic
1131059132 15:89393659-89393681 CTTGCCCAAGACCACTCAGTGGG - Intergenic
1131093996 15:89644847-89644869 CTTGCTCAGGGTCACACAGCTGG + Intronic
1133321363 16:4915562-4915584 CTTGCTCAGGGTCACACAGCTGG + Intronic
1133698660 16:8288678-8288700 CTTGCTCTGGGTCACACAGTTGG + Intergenic
1133769990 16:8862203-8862225 CTTGTACAAGACCACACAGCAGG - Intronic
1134321555 16:13168797-13168819 CTTGGCCAAGGCCACACAGTTGG - Intronic
1134601979 16:15540778-15540800 TTTGCTCAAGACCACACAGCCGG - Intronic
1135154686 16:20042081-20042103 CTTGTTCACCATCACACAGTTGG - Intronic
1135956511 16:26960628-26960650 ATTGATGAAGACTACACAGTTGG - Intergenic
1136175509 16:28513641-28513663 CTTGATCAAGGTCACACACTGGG - Intergenic
1137506302 16:49056818-49056840 CTTGCCCAGGACCCCACAGGCGG + Intergenic
1139046205 16:63062599-63062621 CTTGCTCAAGGCCACACAGGTGG - Intergenic
1139239143 16:65372653-65372675 TTTGTTCAAGATCACACAGTTGG + Intergenic
1139829003 16:69781456-69781478 GCTAATCAGGACCACAGAGTTGG - Intronic
1139989018 16:70924223-70924245 CTTTGGTAGGACCACACAGTGGG - Intronic
1140875180 16:79144256-79144278 GTTGACCAGGCCCACACAGCTGG - Intronic
1143272897 17:5688925-5688947 CTCTCTCAGGACCACCCAGTTGG - Intergenic
1143916628 17:10298526-10298548 CTTGCCCATGACCACACAGTTGG + Intronic
1145875596 17:28316771-28316793 CTTGCCCAGGACCACAGAGCCGG - Intergenic
1146247179 17:31297304-31297326 CCTGATCAGTACCACATAGGAGG + Exonic
1146662759 17:34675526-34675548 CTTGTTCAAGATCACACAGCAGG + Intergenic
1147252571 17:39161999-39162021 CTTGCTCTTGACCACACAGCTGG + Intronic
1147557473 17:41488623-41488645 CCTGATCAGGCCCACTCACTTGG + Exonic
1149680773 17:58505552-58505574 CATGAACACGACCTCACAGTTGG + Exonic
1150632956 17:66893116-66893138 CTTGCTCATGACCGCACAGCTGG + Intergenic
1151008810 17:70469738-70469760 ATTGGTCAAGACCCCACAGTTGG - Intergenic
1151360397 17:73585183-73585205 CTTGCCCAGGGCCACACAGCTGG + Intronic
1152722796 17:81931122-81931144 CTTAATCAGGAACCCACAGTGGG + Intergenic
1152941674 17:83176030-83176052 CTTGGACAGGGCCACACACTAGG - Intergenic
1157339695 18:46768379-46768401 CTTGCCCAGCATCACACAGTGGG + Intergenic
1157674337 18:49557702-49557724 CTTGCTCAAGGTCACACAGTTGG - Intergenic
1158482550 18:57834896-57834918 GATCACCAGGACCACACAGTAGG - Intergenic
1161275480 19:3414164-3414186 CTTGCCCAGGGCCACACAGCCGG + Intronic
1161454042 19:4361436-4361458 CCTGAGCAGGACCCCACACTTGG - Exonic
1161587331 19:5112815-5112837 CTTCATGAGGAGCACACAGGAGG - Intronic
1163491549 19:17619876-17619898 CTTGCCCAGGGCCACACAGCAGG - Intronic
1163597889 19:18231103-18231125 CTTGCTCAATACCACACAGCAGG + Intronic
1168540496 19:57205789-57205811 CTTCATCAGGGCCACACAGCAGG - Intronic
926306144 2:11638563-11638585 CTTGAGCTGGACCAAGCAGTTGG + Intronic
926315852 2:11708997-11709019 ATTGCTCAAGACCACACAGATGG + Intronic
930024094 2:47020020-47020042 CTATGTCAGCACCACACAGTGGG + Intronic
930156052 2:48108654-48108676 ATTACCCAGGACCACACAGTAGG + Intergenic
930702636 2:54474418-54474440 CTTGCTCAGGGTCACAAAGTGGG - Intronic
931761250 2:65419045-65419067 CTTGCTCAAGGCCACACAGCAGG + Intronic
935087522 2:99862564-99862586 CAACATCAGGACCACACCGTGGG - Intronic
935546188 2:104402136-104402158 CTTGTTCAGGACCACATTCTGGG - Intergenic
935826715 2:106959301-106959323 CTTGCTCAGGGTCACACATTTGG + Intergenic
935974669 2:108566465-108566487 ATTGCCCAGGGCCACACAGTAGG + Intronic
936610852 2:114000731-114000753 CTTGCTCAAGGCCACACAGCTGG - Intergenic
937323646 2:120975845-120975867 CTTGCTCAGAACCACTCAGCTGG - Intronic
939114247 2:138042203-138042225 TTTGACCAATACCACACAGTTGG - Intergenic
942069509 2:172303736-172303758 CTTTATCAAGATCACACAGCTGG + Intergenic
942379393 2:175372648-175372670 CCTGGTGAGGAGCACACAGTAGG - Intergenic
944872630 2:203929926-203929948 CTTTCTCAAGACCACACAGTTGG + Intergenic
945658343 2:212653532-212653554 CTTGATCAAAATCAAACAGTTGG - Intergenic
948682045 2:239641836-239641858 CTTTCTGAGGCCCACACAGTGGG + Intergenic
1168964492 20:1891058-1891080 CTTGACCAGGGCCACCCTGTGGG - Intergenic
1172453837 20:35050346-35050368 TTTGCTCAGGATCACACAGCTGG - Intronic
1173103209 20:40106991-40107013 CTTGATCAAGATCACACAAGTGG - Intergenic
1174315402 20:49696117-49696139 ATTGAGCAGGACCAAAGAGTTGG - Intronic
1174483573 20:50847606-50847628 CTTACCCAGGATCACACAGTTGG + Intronic
1175264020 20:57691838-57691860 GTTGTTCAAGACCACACAGCGGG - Intronic
1175329835 20:58155938-58155960 CTTGCCCAAGACCACACAGAAGG - Intronic
1179709462 21:43204778-43204800 TTTGATCAGGACCTGCCAGTGGG + Intergenic
1181085053 22:20436135-20436157 CTTGCCCAGGTCCACACAGCTGG + Intronic
1181963344 22:26638827-26638849 CTTGTTCAAGACCACACAGTAGG + Intergenic
1183265653 22:36823648-36823670 CTGGCTCAGGATCACACAGTGGG - Intergenic
1184472564 22:44704011-44704033 CTTGCTCAAGACCACAGAGTAGG - Intronic
1184637738 22:45848513-45848535 CTTGCTCAAGGCCACACAGCTGG - Intergenic
1185186844 22:49406316-49406338 CTTGCTCAAGGGCACACAGTTGG + Intergenic
949144250 3:676930-676952 CTTGATCAAGAGTACACTGTGGG + Intergenic
950143453 3:10631441-10631463 CTTGCTCAAGGTCACACAGTTGG + Intronic
951166097 3:19486542-19486564 CTTGGCCAGGGCCCCACAGTCGG + Intronic
952140493 3:30473537-30473559 CTTGTGCAAGATCACACAGTTGG - Intergenic
952213609 3:31253819-31253841 CTTGATCAAGATCACAGAGTAGG + Intergenic
953059614 3:39416293-39416315 CTTGCCCAGAACCACACACTAGG - Intergenic
953137165 3:40190889-40190911 CTTGCCCAAGGCCACACAGTTGG - Intronic
955105268 3:55891730-55891752 CTTGATAAGAATCAGACAGTTGG - Intronic
956327997 3:68074300-68074322 CAGGAACTGGACCACACAGTAGG - Intronic
956674678 3:71722983-71723005 CTTGCTCATCAGCACACAGTAGG + Intronic
960505357 3:118487130-118487152 CTTGCTCAGAGTCACACAGTTGG + Intergenic
961448988 3:126993962-126993984 CTTGCTCAAGGCCACACAATGGG - Intronic
961670475 3:128524636-128524658 CTTGTGCAGGGCCACACAGAGGG - Intergenic
961827018 3:129604412-129604434 CTTGCTGAGGATCACACAGTTGG - Intronic
961835122 3:129651598-129651620 CATGAGGGGGACCACACAGTTGG + Exonic
963153553 3:142072300-142072322 CTTGCTCAAGATCACACATTTGG + Intronic
965630890 3:170731421-170731443 CTTGTTTATGGCCACACAGTAGG + Intronic
966238743 3:177731121-177731143 CTTGACCAAGGCCACACAGATGG + Intergenic
967245875 3:187485973-187485995 CTGGCTCAGGATCACACAATTGG + Intergenic
969296977 4:6275995-6276017 GCTGCTCAGGACCACACAGCTGG + Intronic
970479877 4:16462129-16462151 CTTGACAAGAACCACACAGATGG - Intergenic
973858207 4:55034514-55034536 CTTGCTCAGAATCACACAGTTGG - Intergenic
976353418 4:84086123-84086145 CATGGTCAGGATCTCACAGTTGG - Intergenic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
981170060 4:141612624-141612646 CTTGTTAAAGATCACACAGTTGG + Intergenic
981287315 4:143033651-143033673 CTTGATCCAGACCACACAGTTGG + Intergenic
986061242 5:4193196-4193218 CTTGCACAGAACCACACAGCGGG + Intergenic
986621706 5:9682514-9682536 CTTCATCAGGGTCACACAGAAGG - Intronic
987032142 5:13986051-13986073 CTGGATCATGACCACACCGAAGG + Intergenic
988959892 5:36359258-36359280 CTTGCTCAAGCCCACACAGCTGG + Intergenic
990458385 5:56010953-56010975 CTTGCTCAAGGTCACACAGTGGG + Intergenic
991612120 5:68460203-68460225 CTTGCTCAGAATCACACAGTTGG - Intergenic
992774587 5:80078205-80078227 CTGGTTCAGGACCACCCAGTTGG - Exonic
994717951 5:103346527-103346549 CTTGAGCAGGTTCTCACAGTAGG - Intergenic
995010534 5:107252827-107252849 CCTGATCTGGTCCACAAAGTGGG - Intergenic
997212173 5:132083269-132083291 CTTCCTCAGGACCACACAGGAGG + Intergenic
998475930 5:142421832-142421854 CTTGCTCAAGGCCACACAGCTGG - Intergenic
998782057 5:145668736-145668758 CTTTCTCAGGTCCACACAGCTGG + Intronic
999198307 5:149798114-149798136 CTTGGCCAGGGCCACACAGCTGG + Intronic
999276372 5:150333187-150333209 CTTGCTCAAGGTCACACAGTGGG - Intronic
999676807 5:154012397-154012419 CTTGGGCTGGACCACAAAGTGGG - Intronic
999737770 5:154525550-154525572 CTTGACCAGGATCACACAGCTGG - Intergenic
1000387245 5:160686343-160686365 ATTGATCAAGGCCAAACAGTAGG - Intronic
1001042910 5:168349574-168349596 CTTGCTCAAGGGCACACAGTCGG + Intronic
1001221895 5:169907665-169907687 CTTGCTCAAGATCACACAGCTGG + Intronic
1001757330 5:174180713-174180735 CTTGTTCAAGATCACACAGCTGG + Intronic
1001910603 5:175514212-175514234 CTGGACCAGGGCCATACAGTGGG + Intronic
1002409674 5:179063735-179063757 CTTGATCAAGGTCACACAGCTGG + Intronic
1004278052 6:14255475-14255497 CTTGCCCAGGATCACACAGCTGG - Intergenic
1006679801 6:35788615-35788637 CTTGTTCAAGGTCACACAGTTGG + Intronic
1006908501 6:37548788-37548810 CTTGCCCAGGACCACATAGCAGG - Intergenic
1007930300 6:45684978-45685000 TTTTCTCAAGACCACACAGTTGG + Intergenic
1013122203 6:107150845-107150867 CTAGATCAGCACCACACTTTAGG - Intergenic
1013759416 6:113499496-113499518 CTTGACTAGGGTCACACAGTTGG - Intergenic
1014130789 6:117829862-117829884 CTTCAGCAGCACCACACAGTAGG + Intergenic
1015690111 6:135912869-135912891 CTTGCCCAAGATCACACAGTCGG + Intronic
1016546187 6:145227326-145227348 TTTGCCCAAGACCACACAGTTGG + Intergenic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1018975109 6:168558514-168558536 ATTGATCAGGATCACACAGGGGG - Intronic
1019152439 6:170017765-170017787 CTTGCTCAAGGCCACACAGTTGG - Intergenic
1019710388 7:2515750-2515772 CTGGCCCAAGACCACACAGTGGG + Intronic
1020320321 7:6934927-6934949 CTTGCTCTGAAGCACACAGTAGG + Intergenic
1021633225 7:22666199-22666221 CTTGATTAAGATCTCACAGTGGG - Intergenic
1022335055 7:29414503-29414525 CTTCTTCATGACCACCCAGTGGG + Intronic
1023517151 7:41012391-41012413 CTTGACCAGGATCACAGAGCAGG - Intergenic
1025312488 7:57965695-57965717 TTTGCTGAGGACCACATAGTTGG + Intergenic
1027355348 7:77348810-77348832 GTTGATGAAGACCACATAGTGGG + Intronic
1027422124 7:78027038-78027060 CTTGTTCAAGGCCACACAGCTGG + Intronic
1027777161 7:82480964-82480986 CTTAAGCAGAACCACACACTTGG - Intergenic
1029195526 7:98802712-98802734 CTTGGTCAGGGTCACACAGTGGG + Intergenic
1031075000 7:117203263-117203285 CTTGTTCAGGGTTACACAGTTGG - Intronic
1032341467 7:131077783-131077805 CTTGTGCAAGACCACACAGCTGG - Intergenic
1032488276 7:132304912-132304934 CTTGATGGGGACCATACAGCTGG - Intronic
1032688330 7:134257853-134257875 CCTGATCTGGACCTCACACTGGG - Intronic
1034150408 7:148910655-148910677 CCTCCTCAGGCCCACACAGTGGG + Intergenic
1035692044 8:1566581-1566603 CTTGCCCAGGACCTCACAGCCGG - Intronic
1035786773 8:2267405-2267427 CTTGATCAGAGCCACACATAGGG + Intergenic
1035806034 8:2454311-2454333 CTTGATCAGAGCCACACATAGGG - Intergenic
1037210615 8:16382431-16382453 CTTGGTCAGGACAGCACAGCAGG + Intronic
1037486793 8:19355611-19355633 CTTGCTCAGCACCAGACAGCTGG - Intronic
1037517645 8:19649207-19649229 CTTGCCCAGGATCACAAAGTTGG + Intronic
1038260318 8:25987371-25987393 CTTGCTCAAGTTCACACAGTTGG + Intronic
1038336632 8:26650858-26650880 ATTGTTCTGGACCACACAGGCGG - Intronic
1043297784 8:78686545-78686567 CTTGATCAGGCCCTCAAAGAGGG + Exonic
1044758160 8:95488811-95488833 ATTGATCAAGGCCACACAGCTGG - Intergenic
1046630861 8:116621962-116621984 CTGGAACAGGAGCGCACAGTAGG - Intergenic
1047752980 8:127896544-127896566 CTTGAGCAAGATCACACAGCAGG - Intergenic
1048216989 8:132505424-132505446 CTTGCCCAAGACCACACAGCTGG + Intergenic
1048536015 8:135295334-135295356 CTTGGCCAAGACCACACAGCTGG - Intergenic
1049146809 8:141006488-141006510 CTAGAGCAGGACCTCACCGTGGG + Intergenic
1049180198 8:141218290-141218312 CTTGATCAGCACCACGGCGTTGG + Exonic
1049267760 8:141678268-141678290 CCTGGTCAGGAACACACAGATGG + Intergenic
1050821687 9:9887468-9887490 CTTGTGTAGGACCACACATTTGG + Intronic
1051718107 9:20006819-20006841 CTTACACAGGAACACACAGTTGG - Intergenic
1052685001 9:31744471-31744493 CTTGTTCATGGCCATACAGTTGG - Intergenic
1058281934 9:103127056-103127078 CTTCAACTGGCCCACACAGTGGG - Intergenic
1059669817 9:116481430-116481452 CTTGCCCAAGGCCACACAGTGGG + Intronic
1060475324 9:123982674-123982696 CTTGCCCAGGCCCACACAGCAGG + Intergenic
1060491014 9:124084243-124084265 CTTGTTCAAGGACACACAGTCGG - Intergenic
1060507540 9:124209407-124209429 ACTGATCAGGAACACACAATAGG - Intergenic
1060806950 9:126583722-126583744 CTTATTCAAGACCACACAGCTGG + Intergenic
1060926950 9:127461716-127461738 CTTGCTCAAGACCACCCCGTGGG + Intronic
1061045873 9:128164576-128164598 CTTGCTGAAGACCACGCAGTTGG - Intergenic
1062528285 9:136987388-136987410 CCTGCTCAGCACCCCACAGTGGG + Intergenic
1186313580 X:8345624-8345646 CTTTCTTAGGATCACACAGTTGG - Intergenic
1190498193 X:51047997-51048019 GTTTAACAGCACCACACAGTGGG + Intergenic
1190508151 X:51149158-51149180 GTTTAGCAGCACCACACAGTAGG - Intergenic
1191953116 X:66615945-66615967 CCTGTCCAGGACCACACCGTTGG + Exonic
1192196300 X:69031062-69031084 CTTGCTCAACATCACACAGTTGG + Intergenic
1193810567 X:86046294-86046316 TTTGCTCAGGATCACACAGCTGG - Intronic
1196406768 X:115371322-115371344 CTTGACTAGGATCACACAGCTGG - Intergenic
1200310081 X:155069593-155069615 CTTGCTCAAGGTCACACAGTGGG + Intronic