ID: 1128313567

View in Genome Browser
Species Human (GRCh38)
Location 15:66646438-66646460
Sequence ACGCACTGACCACTATCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128313567_1128313580 28 Left 1128313567 15:66646438-66646460 CCCTGGGATAGTGGTCAGTGCGT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1128313580 15:66646489-66646511 CAGGCTGAAGCCAGCTGGGTGGG 0: 1
1: 0
2: 7
3: 41
4: 331
1128313567_1128313574 9 Left 1128313567 15:66646438-66646460 CCCTGGGATAGTGGTCAGTGCGT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1128313574 15:66646470-66646492 CCGGCATGCCTGGAAACCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 136
1128313567_1128313572 -1 Left 1128313567 15:66646438-66646460 CCCTGGGATAGTGGTCAGTGCGT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1128313572 15:66646460-66646482 TGGGCTGCAGCCGGCATGCCTGG 0: 1
1: 0
2: 5
3: 29
4: 308
1128313567_1128313579 27 Left 1128313567 15:66646438-66646460 CCCTGGGATAGTGGTCAGTGCGT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1128313579 15:66646488-66646510 TCAGGCTGAAGCCAGCTGGGTGG 0: 1
1: 0
2: 1
3: 36
4: 328
1128313567_1128313576 23 Left 1128313567 15:66646438-66646460 CCCTGGGATAGTGGTCAGTGCGT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1128313576 15:66646484-66646506 AACCTCAGGCTGAAGCCAGCTGG 0: 1
1: 0
2: 4
3: 41
4: 1199
1128313567_1128313577 24 Left 1128313567 15:66646438-66646460 CCCTGGGATAGTGGTCAGTGCGT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1128313577 15:66646485-66646507 ACCTCAGGCTGAAGCCAGCTGGG 0: 1
1: 0
2: 0
3: 38
4: 1205
1128313567_1128313571 -10 Left 1128313567 15:66646438-66646460 CCCTGGGATAGTGGTCAGTGCGT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1128313571 15:66646451-66646473 GTCAGTGCGTGGGCTGCAGCCGG 0: 1
1: 0
2: 1
3: 17
4: 233
1128313567_1128313581 29 Left 1128313567 15:66646438-66646460 CCCTGGGATAGTGGTCAGTGCGT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1128313581 15:66646490-66646512 AGGCTGAAGCCAGCTGGGTGGGG 0: 1
1: 0
2: 9
3: 72
4: 550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128313567 Original CRISPR ACGCACTGACCACTATCCCA GGG (reversed) Intronic
904869427 1:33607460-33607482 AAGCTCTGACCACTCTCCCCAGG - Intronic
910062761 1:83113529-83113551 ACGCACTTAGCACTGACCCATGG + Intergenic
910065357 1:83144296-83144318 ACTCACTGACCATTTTCCCGAGG + Intergenic
921646124 1:217620293-217620315 AAGCAGTGACCAGTCTCCCACGG + Exonic
921719598 1:218455735-218455757 ACTCACTGACTATGATCCCAAGG - Intergenic
922871043 1:228902200-228902222 AGACACTGGCCACAATCCCAGGG - Intergenic
1071426199 10:85555880-85555902 ATGCAGTGACCACCATGCCAAGG - Intergenic
1074309947 10:112313511-112313533 CAGCACTGACCACAATCCCAGGG - Intergenic
1082150530 11:48733721-48733743 AAGCACTCACAAATATCCCATGG - Intergenic
1082599514 11:55132448-55132470 AAGCACTCACAAATATCCCATGG - Intergenic
1093607952 12:21117182-21117204 ACTCAATGAACACTACCCCAAGG - Intronic
1099285585 12:80710675-80710697 ACGCAGTGACTACTATCGCCAGG - Intergenic
1101583264 12:106062883-106062905 AGGCACTCCCCTCTATCCCAAGG - Intergenic
1102629276 12:114263172-114263194 TGGCTCTGACCACCATCCCAAGG - Intergenic
1105889368 13:24671181-24671203 ACGCTCTGCCCACTCTCCCAAGG - Intergenic
1111822776 13:93233772-93233794 ACTCACTGACCAGTCTCCCCAGG - Intronic
1119159527 14:72441540-72441562 AGGCACTGAGCGCCATCCCAGGG + Intronic
1124833910 15:33177019-33177041 ACGTACTGGCCACTCTTCCAAGG + Intronic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1128565649 15:68699156-68699178 TCTCACTGACCACCACCCCAGGG - Intronic
1128772495 15:70292608-70292630 ACGGACTGGCCAGGATCCCAGGG + Intergenic
1131234407 15:90683543-90683565 ACGCACTCACCCCTCCCCCATGG + Intergenic
1133257249 16:4524653-4524675 AGGCACTGGCCTCCATCCCAAGG - Intronic
1138867755 16:60844313-60844335 ACTCGCTCACCTCTATCCCAGGG + Intergenic
1144953227 17:19004895-19004917 ACGCACTGCCCACGGTCCCCTGG + Intronic
1157096374 18:44688976-44688998 ATACACTGCCCACTCTCCCAGGG - Intronic
1166254823 19:41596035-41596057 ACCCTCTGATCACTTTCCCATGG + Intronic
1166396659 19:42446177-42446199 ACCCACTGCTCACTTTCCCACGG - Intergenic
1167271724 19:48509990-48510012 ACGCCATGACCAGCATCCCATGG - Intronic
925410045 2:3634790-3634812 ACGCACTGAGCACTCTGGCAGGG + Intronic
947335859 2:229082363-229082385 ACTCACTGACCTTTACCCCATGG + Intronic
1171240900 20:23566317-23566339 ATGCACTTCCCACTCTCCCATGG + Intronic
949841216 3:8322134-8322156 ATGCACTGTCCACCTTCCCAGGG - Intergenic
953388913 3:42523278-42523300 AGGCCTTGACCACAATCCCAGGG + Intronic
955350317 3:58188796-58188818 ACGCACTCAGCTCTTTCCCAGGG - Intergenic
958660845 3:97064732-97064754 AAGCACTGACCAGTATCACTTGG - Intronic
962417578 3:135197152-135197174 AAGCTGTGACCAGTATCCCATGG + Intronic
963095934 3:141540421-141540443 ATCCACTGACCACTAGCACATGG - Intronic
968378940 4:71959-71981 ACTCAATGACCACCCTCCCAAGG - Intronic
969226014 4:5798795-5798817 ATGCACTGACCTCTGTCCCTGGG + Intronic
969630813 4:8334928-8334950 GAGCACTGACCACTCACCCAAGG - Intergenic
977084921 4:92582356-92582378 ACTCACTTAACACTATTCCAAGG + Intronic
979552048 4:122002344-122002366 ACTCACTGTCCACTGTCCCTTGG + Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
994631212 5:102290387-102290409 ACTCACTGACCCCATTCCCAGGG + Intronic
999490383 5:152044436-152044458 AGGCACTGAGCACTATTCCAAGG + Intergenic
1007173449 6:39880257-39880279 CCACACTGACCTTTATCCCATGG + Intronic
1011160948 6:84389877-84389899 AAGCACTCCCCAATATCCCAAGG + Intergenic
1024081990 7:45863771-45863793 AGACACTGACCACTGACCCATGG - Intergenic
1036628999 8:10497191-10497213 AGGAACTGACCACAATGCCAGGG + Intergenic
1037593521 8:20333979-20334001 ACGCACTCACCACTCACTCATGG + Intergenic
1051357754 9:16255117-16255139 ACTCCCTGACCAGTCTCCCAGGG + Intronic
1191270633 X:58463042-58463064 AAGCACTCACAAATATCCCATGG + Intergenic
1193440882 X:81538102-81538124 TCTCACTCACCACTTTCCCAAGG + Intergenic