ID: 1128313571

View in Genome Browser
Species Human (GRCh38)
Location 15:66646451-66646473
Sequence GTCAGTGCGTGGGCTGCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 233}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128313567_1128313571 -10 Left 1128313567 15:66646438-66646460 CCCTGGGATAGTGGTCAGTGCGT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1128313571 15:66646451-66646473 GTCAGTGCGTGGGCTGCAGCCGG 0: 1
1: 0
2: 1
3: 17
4: 233
1128313562_1128313571 10 Left 1128313562 15:66646418-66646440 CCGAGACTTTGAGGAAGGTCCCC 0: 1
1: 0
2: 1
3: 14
4: 137
Right 1128313571 15:66646451-66646473 GTCAGTGCGTGGGCTGCAGCCGG 0: 1
1: 0
2: 1
3: 17
4: 233
1128313566_1128313571 -9 Left 1128313566 15:66646437-66646459 CCCCTGGGATAGTGGTCAGTGCG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1128313571 15:66646451-66646473 GTCAGTGCGTGGGCTGCAGCCGG 0: 1
1: 0
2: 1
3: 17
4: 233
1128313561_1128313571 11 Left 1128313561 15:66646417-66646439 CCCGAGACTTTGAGGAAGGTCCC 0: 1
1: 0
2: 2
3: 29
4: 1302
Right 1128313571 15:66646451-66646473 GTCAGTGCGTGGGCTGCAGCCGG 0: 1
1: 0
2: 1
3: 17
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128313571 Original CRISPR GTCAGTGCGTGGGCTGCAGC CGG Intronic
900225047 1:1529050-1529072 GTCCGGGCCTGGCCTGCAGCAGG + Intronic
900298480 1:1964807-1964829 GTCAGGGGTTGGGCTGCGGCAGG + Intronic
901449544 1:9327566-9327588 GTCTGTGCTTGGGGAGCAGCTGG + Intronic
901664541 1:10818898-10818920 GCCCGGGCTTGGGCTGCAGCAGG + Intergenic
903345463 1:22681515-22681537 GTCAGTGCTTGGTATGCAGTAGG - Intergenic
903468324 1:23568025-23568047 GTCAGGGCGCGGGGTGCAGGAGG - Intergenic
904117602 1:28174149-28174171 GTCAGAGAGGGGGCTGCAGCAGG + Intronic
904218028 1:28939978-28940000 AACAGTGGGTGGGCTGGAGCTGG + Intronic
904476581 1:30769018-30769040 GTCAGGGTGTGGGCAGCAGTTGG + Intergenic
904576442 1:31507970-31507992 ATCAGAGCGTGTGCAGCAGCTGG + Intergenic
904593869 1:31630766-31630788 GGCAGAGCGTGGGCAGTAGCGGG + Exonic
905663280 1:39745001-39745023 GACAGTGGGTGGGCTGGAACTGG + Intronic
905916417 1:41687601-41687623 GTGTGTGCGTTTGCTGCAGCTGG - Intronic
907710695 1:56877772-56877794 GTCCTTGGGTGGGCTGCAACAGG - Intronic
912384123 1:109262880-109262902 GGCAGTTCGTGGGCTGCATGCGG + Exonic
913158271 1:116121628-116121650 GTCAGTCTGTGGGTTGCAGATGG + Intronic
915489390 1:156242879-156242901 GTCTGTGGGGGAGCTGCAGCAGG + Intronic
918799378 1:188953252-188953274 GACAGAGAGGGGGCTGCAGCAGG + Intergenic
920238840 1:204528995-204529017 GACAGAGCGTGGGCAGTAGCTGG + Intronic
922305610 1:224341268-224341290 GCCACTGCGCGAGCTGCAGCAGG - Intergenic
924362166 1:243254136-243254158 GGCAGTGCTTGGACTCCAGCAGG + Intronic
1063148493 10:3317828-3317850 GCCTCTGCGTGGGCAGCAGCGGG + Intergenic
1063148511 10:3317896-3317918 GCCTCTGCGTGGGCAGCAGCGGG + Intergenic
1063148529 10:3317964-3317986 GCCTCTGCGTGGGCAGCAGCGGG + Intergenic
1063258267 10:4353282-4353304 GACAGTGTGAGCGCTGCAGCAGG - Intergenic
1063579402 10:7291962-7291984 ATTAGTGTGGGGGCTGCAGCTGG - Intronic
1064101349 10:12467063-12467085 GTCAGTACGTGGCCCGCAGAAGG + Intronic
1064553267 10:16522827-16522849 CTCAGTGGGTGAGCTGCAGAAGG + Intergenic
1066342431 10:34548985-34549007 TCCAGAGAGTGGGCTGCAGCAGG + Intronic
1067210179 10:44253968-44253990 GCCAGTGCGTGTGCTGATGCTGG - Intergenic
1068351069 10:55845914-55845936 GGCAGTGTGTGGGGGGCAGCAGG - Intergenic
1070584694 10:77754902-77754924 GTCAGGGCGTGGGCAGCAGGAGG - Intergenic
1071123860 10:82312070-82312092 GTGAGTGCCTGGCCTGCACCAGG - Intronic
1071255383 10:83867643-83867665 GTAAGTGCATGGGCTGGAGATGG + Intergenic
1071334707 10:84591161-84591183 GACAGTGCAGGGTCTGCAGCTGG - Intergenic
1073001964 10:100292524-100292546 CTCAGTGCCTGATCTGCAGCTGG + Intronic
1073540581 10:104313927-104313949 GTTAGTGCTTTGGCTGCAGATGG + Exonic
1074445943 10:113520907-113520929 GCCAGTGCGGGGGCTGGGGCAGG - Intergenic
1075807414 10:125200025-125200047 GTCAGTGCCCATGCTGCAGCTGG - Intergenic
1076051072 10:127333590-127333612 TGCAGTGCGTGGGCTCCAGAGGG - Intronic
1076218612 10:128715685-128715707 TCCCGTGCGTGGGCTGGAGCTGG - Intergenic
1076351128 10:129815971-129815993 GTCAGGGAGTGGGCAGGAGCCGG - Intergenic
1076539389 10:131204574-131204596 GTCACTGTGTGGGCTCCAGTGGG + Intronic
1076775999 10:132698676-132698698 CTCAGTGCCTGGGCTGCTTCTGG - Intronic
1076922971 10:133465211-133465233 GTCACTGCGGGGGCTGGACCGGG - Intergenic
1077240905 11:1510063-1510085 GTCAGAGCCAGGGCTGCGGCGGG + Intergenic
1077240972 11:1510226-1510248 GTCAGAGCCAGGGCTGCAGGGGG + Intergenic
1081470163 11:43362546-43362568 GTCAGAGCTGGGGCTGCTGCAGG + Intronic
1081777759 11:45687750-45687772 GTCACTGCCTGTGTTGCAGCTGG + Intergenic
1081983426 11:47284525-47284547 GACAGTGCTGGGGCTGCTGCTGG - Exonic
1083339810 11:61951783-61951805 GCCAGGCAGTGGGCTGCAGCAGG - Intronic
1083691262 11:64410209-64410231 CCCAGGACGTGGGCTGCAGCTGG - Intergenic
1084104214 11:66970340-66970362 GTCATTGGGTGGGCTGGAGAGGG + Intergenic
1084172947 11:67409424-67409446 GTCAGAGCGGGACCTGCAGCGGG + Exonic
1084189301 11:67491759-67491781 GTGAGTGGGTGGGGTGCAGGTGG + Exonic
1084238743 11:67805097-67805119 GTGAGTGCCTGGGCTCCCGCCGG - Intergenic
1085270843 11:75269031-75269053 GTCAGTCCGAGGACTGCAGAGGG + Intronic
1085622321 11:78046574-78046596 GTCAGCGCGGGGGCTGAGGCTGG + Intronic
1088579103 11:111299204-111299226 GTCACTGCGGGGACCGCAGCTGG - Intronic
1088883486 11:113989565-113989587 GGCGGTGTGTGGGCTGCTGCAGG + Exonic
1101876343 12:108598892-108598914 CACAGTGCGTGGCCTGCTGCAGG - Intergenic
1104019214 12:124980548-124980570 GGCAGTGGTGGGGCTGCAGCTGG + Exonic
1104425379 12:128672794-128672816 ATCAGTGCCTAGTCTGCAGCAGG + Intronic
1107986393 13:45780217-45780239 GGAAGTGGGTGGGCTGCAGATGG - Exonic
1112359952 13:98708500-98708522 TACAGTGGGTGGGCTTCAGCAGG - Intronic
1112762905 13:102710775-102710797 GTCAGGCTGTGGGCGGCAGCAGG - Intergenic
1113991664 14:16032456-16032478 GTCAGTGTGGGGGCTGCTGAAGG - Intergenic
1119430487 14:74565143-74565165 GTCAGTGCATGGCCTGTAACAGG - Intronic
1119632983 14:76250154-76250176 GTCAGTCTGTGGGGTGCAGTTGG - Intronic
1121583295 14:95046341-95046363 CTCAGTCTGTGGGATGCAGCTGG - Intergenic
1122357920 14:101135118-101135140 GTCAGTGACAGGGCTGGAGCAGG - Intergenic
1126454507 15:48846698-48846720 TTCAGTGCTTGGGATGAAGCAGG + Intronic
1128313571 15:66646451-66646473 GTCAGTGCGTGGGCTGCAGCCGG + Intronic
1129457214 15:75682401-75682423 GTCAGTGCCTGCGCTGGAGCTGG + Exonic
1129726570 15:77904540-77904562 GTCGGTGCCTGCGCTGGAGCTGG - Intergenic
1132415305 15:101615001-101615023 GTCAGTGTGGGGGCCTCAGCTGG - Intergenic
1132855072 16:2041073-2041095 GGCAGGGCTGGGGCTGCAGCTGG - Intronic
1133152961 16:3850640-3850662 TTCAGTGCTTGGGAGGCAGCGGG + Exonic
1134690589 16:16188775-16188797 GAGAGTGCGTGGGCTACACCTGG - Intronic
1135942054 16:26830489-26830511 GTCTGTGAGAGGGCTGCAGAGGG - Intergenic
1136061363 16:27728861-27728883 GCAAGTGGGCGGGCTGCAGCTGG + Intronic
1136136495 16:28259520-28259542 GCCAGTGGGTGGGCAGCAGGTGG + Intergenic
1136406919 16:30053454-30053476 GTCAGTCCGGGAGCTGCAGAAGG - Exonic
1137587661 16:49673508-49673530 GGCAGTGTGGGAGCTGCAGCTGG - Intronic
1137668096 16:50263365-50263387 GGCAGTGCTGAGGCTGCAGCAGG + Intronic
1137686414 16:50390120-50390142 GTCAGAGCCAGTGCTGCAGCTGG - Intergenic
1138504729 16:57472540-57472562 GTCAGTGAGAGGGGGGCAGCAGG + Exonic
1144620977 17:16818373-16818395 ATCAGTGCTTGGGCAACAGCAGG - Intergenic
1145234666 17:21200141-21200163 GTCACTGCTGGGGCTGCAGCCGG - Intronic
1145398623 17:22514469-22514491 GTGAGGGGGTGGGCTGCAGGGGG - Intergenic
1147572957 17:41582666-41582688 ATCAGTGCTTGGGCAACAGCAGG - Intronic
1148162026 17:45455711-45455733 GACAGTGGGTGGGGTGCAGCTGG - Intronic
1148190141 17:45672545-45672567 GGCACTGCGTAGGCTGCAGGTGG + Intergenic
1150007578 17:61479286-61479308 GTCAGTGACTGGGATGCAGTGGG - Intronic
1150393257 17:64802360-64802382 GACAGTGGGTGGGGTGCGGCTGG - Intergenic
1151340770 17:73469388-73469410 GTCTGTGCCTGGGCAGAAGCAGG + Intronic
1151716496 17:75833860-75833882 GTCAATGAGGGGGCTGCAGTTGG - Intronic
1152087962 17:78231871-78231893 GCCAGTGCGCGGGCAGGAGCGGG + Exonic
1152769400 17:82157983-82158005 GGCAGTGGCTGGGCTGGAGCAGG + Intronic
1152785401 17:82245355-82245377 GGGAGTGAGTGGGCTGCGGCTGG + Intronic
1152828754 17:82484243-82484265 CCCAGTGCCTGGGGTGCAGCAGG - Intronic
1156470693 18:37375738-37375760 CTGAGTGTGTGGGATGCAGCCGG + Intronic
1156500369 18:37553830-37553852 GGCAGGGCCTGGGCTGCTGCAGG + Intronic
1156501109 18:37558969-37558991 GTCAGTGGGTGAGCAGAAGCAGG + Intronic
1157424601 18:47573972-47573994 GTCAGAGCCTGGACTGCACCTGG + Intergenic
1157772768 18:50364317-50364339 CTCAATGAGTGAGCTGCAGCAGG + Intergenic
1160620017 18:80164122-80164144 CTCTGTGTGTGGGGTGCAGCAGG - Intronic
1162626309 19:11887829-11887851 GTCCCTGCGCGGGCTGCGGCTGG + Intronic
1165771711 19:38384301-38384323 GGCAGTGGGTAGGGTGCAGCAGG - Exonic
1166217923 19:41348248-41348270 GTCAGGGCATGGGCTGGAGAGGG - Intronic
1166309992 19:41957412-41957434 GTCTGCGCGAGGGTTGCAGCAGG - Intronic
1166975944 19:46605099-46605121 GTCAGGGAGAGGGCTGCAGCGGG - Intronic
1166997296 19:46725767-46725789 CTCAGAGCCTGGGCTCCAGCCGG + Intronic
1167306701 19:48713933-48713955 GTCAGGGCTGGAGCTGCAGCAGG + Exonic
1167442159 19:49514578-49514600 GGCAGAGCGTGGGCTGCAGTGGG - Intronic
1167574310 19:50310408-50310430 GGCAGAGCATGGGCAGCAGCAGG - Exonic
925743906 2:7029020-7029042 GACAGTTTGGGGGCTGCAGCCGG - Intronic
928086998 2:28352238-28352260 GTGAGTTCCTGGGCTGCTGCTGG - Intergenic
931268985 2:60685496-60685518 GGCAGAGCGGAGGCTGCAGCAGG - Intergenic
932567385 2:72918269-72918291 AGGAGTGCGGGGGCTGCAGCGGG - Exonic
937359414 2:121218615-121218637 GTCAGTGCTTGGGCCCCAGCTGG - Exonic
937974425 2:127573663-127573685 GTCAGAGTGTGGGATGCAGGAGG - Intronic
938308065 2:130267982-130268004 GTCGGCAGGTGGGCTGCAGCTGG + Intergenic
938447266 2:131388854-131388876 GTCGGCAGGTGGGCTGCAGCTGG - Intergenic
944916393 2:204364939-204364961 GTCAGAGTGTGGGCAGCTGCAGG - Intergenic
946193473 2:218019943-218019965 GGCAGTGGGGAGGCTGCAGCCGG - Intergenic
948002420 2:234579432-234579454 GTCAGAGCTTGGGCTGCTGCTGG + Intergenic
948654338 2:239467125-239467147 GTCAGGGCGTGGGGGGAAGCTGG + Intergenic
948716292 2:239865565-239865587 GACCGTGCGTGGGCAGCAGGCGG - Intergenic
1169800960 20:9511068-9511090 GTCTGTGTGTGGGTTGCAGAGGG + Intergenic
1170598410 20:17822651-17822673 GTCTGTGCGGTGGCTGCAGGGGG - Intergenic
1170828859 20:19821973-19821995 TTCAGTGCTTAGGCTGCAGAAGG + Intergenic
1173249558 20:41357448-41357470 GTGAGTGCCTGGGCTGGGGCTGG + Intronic
1174575518 20:51534227-51534249 TTCAGGGTGGGGGCTGCAGCGGG + Intronic
1175092188 20:56513577-56513599 GGCAGTGCCTGGGCCTCAGCTGG - Intronic
1175264171 20:57692542-57692564 GTCTGTACCTGGCCTGCAGCTGG + Intronic
1176338896 21:5624510-5624532 GGCTGTGCGTGAGGTGCAGCAGG - Intergenic
1176340304 21:5687583-5687605 GGCTGTGCGTGAGGTGCAGCAGG - Intergenic
1176472558 21:7119736-7119758 GGCTGTGCGTGAGGTGCAGCAGG - Intergenic
1176504523 21:7636873-7636895 GGCTGTGCGTGAGGTGCAGCAGG + Intergenic
1178191146 21:30282564-30282586 CTGGGTGCTTGGGCTGCAGCTGG + Exonic
1179780374 21:43696388-43696410 GTCAGTTTCTGGGCTGCAGTGGG - Intergenic
1179877769 21:44279882-44279904 GTCGGTGCGCGGTCAGCAGCAGG - Intergenic
1180141134 21:45893854-45893876 GTCCGAGCATGGGCTGCTGCAGG + Intronic
1180315606 22:11275071-11275093 GTCAGTGTGGGGGCTGCTGAAGG + Intergenic
1180666723 22:17519168-17519190 GCCAGTGAGTGGGCTGAGGCTGG + Intronic
1181544109 22:23591304-23591326 GTAAGTGTGTGACCTGCAGCGGG - Intergenic
1182087456 22:27571116-27571138 CTCAGTGCCTGGCATGCAGCAGG + Intergenic
1182730312 22:32484505-32484527 GTCAGTGCATGGCATGCTGCAGG - Intronic
1183251659 22:36734437-36734459 GCCTGTGCTGGGGCTGCAGCAGG + Intergenic
1184738011 22:46410465-46410487 GGCAGTTCGTGGGCTGCATGCGG - Exonic
1185224216 22:49643888-49643910 GCAGGTGTGTGGGCTGCAGCAGG - Intronic
1203239569 22_KI270733v1_random:2041-2063 GGCTGTGCGTGAGGTGCAGCAGG - Intergenic
950105319 3:10384875-10384897 ATCAGGGCTTGGGCTGAAGCTGG - Intronic
950330081 3:12149227-12149249 GCCAGAGCGTGGGCTGCAGCAGG + Intronic
950456328 3:13094914-13094936 CTCAGCGTGTGGCCTGCAGCTGG - Intergenic
950681113 3:14585723-14585745 GTCAGTGCCTGGTATGCAGTGGG - Intergenic
953705165 3:45225584-45225606 GCCTCTGCGTGGGCTGCGGCTGG - Exonic
953996088 3:47521151-47521173 GTGGGTGACTGGGCTGCAGCAGG + Intergenic
960577125 3:119240742-119240764 GTCAGTCCCAGGGCTGTAGCGGG - Intronic
961635540 3:128330559-128330581 CTCAGTGAGTGGGATTCAGCTGG + Intronic
967231281 3:187339531-187339553 ATCGGTGTGTGGGCGGCAGCAGG + Intergenic
968293135 3:197554592-197554614 GTCAGCGCGAGGCCTGCAGGCGG + Exonic
968704712 4:2072557-2072579 GCCAGTGGGTAGGCTGCGGCCGG + Intronic
968960252 4:3739739-3739761 GCGAGGGCGTGGCCTGCAGCTGG + Intergenic
968997504 4:3955203-3955225 GTGAGTGCCTGGGCTCCCGCCGG - Intergenic
969015245 4:4099511-4099533 GTCTGGGCTTGGGTTGCAGCAGG - Intergenic
969185139 4:5469100-5469122 GTCAGAGCTGGGGCTCCAGCAGG + Intronic
969486072 4:7473229-7473251 GTAAGGGCTCGGGCTGCAGCCGG + Intronic
969498874 4:7541174-7541196 GTCTGGGCCTGGGCTGCTGCAGG + Intronic
976061352 4:81131285-81131307 GACAGTGGGTGAGCTGAAGCAGG - Intronic
978283915 4:107052068-107052090 GTCAGTGCCTGGCATGCAGAAGG + Intronic
980541997 4:134207929-134207951 CACAGTGCGTGAGCTGAAGCAGG + Intergenic
981000250 4:139822333-139822355 CTCAGTGACTGGGCTGCTGCTGG + Intronic
985537085 5:471561-471583 GTCAGGACGGTGGCTGCAGCAGG + Exonic
985578911 5:686488-686510 GGCAGTGAGTGGGCTGGGGCGGG - Intronic
985593757 5:778551-778573 GGCAGTGAGTGGGCTGGGGCGGG - Intergenic
985892111 5:2724185-2724207 GTCAGTCCCTGGGGTTCAGCTGG + Intergenic
987401927 5:17486736-17486758 TTAAATGCTTGGGCTGCAGCGGG - Intergenic
987405355 5:17518870-17518892 TTAAATGCTTGGGCTGCAGCGGG - Intergenic
987405802 5:17522304-17522326 TTAAATGCTTGGGCTGCAGCGGG - Intergenic
987406249 5:17525738-17525760 TTAAATGCTTGGGCTGCAGCGGG - Intergenic
987406695 5:17529172-17529194 TTAAATGCTTGGGCTGCAGCGGG - Intergenic
987407450 5:17585233-17585255 TTAAATGCTTGGGCTGCAGCGGG + Intergenic
987408151 5:17590435-17590457 TTAAATGCTTGGGCTGCAGCGGG + Intergenic
987408596 5:17593869-17593891 TTAAATGCTTGGGCTGCAGCGGG + Intergenic
987409052 5:17597303-17597325 TTAAATGCTTGGGCTGCAGCGGG + Intergenic
987410015 5:17605284-17605306 GTAAATGCTTGGGCTGCAGCGGG - Intergenic
987410658 5:17611490-17611512 TTAAATGCTTGGGCTGCAGCGGG - Intergenic
987412943 5:17632591-17632613 TTAAATGCTTGGGCTGCAGCGGG - Intergenic
987416625 5:17669354-17669376 TCCAATGCTTGGGCTGCAGCGGG + Intergenic
996599791 5:125249545-125249567 CTCTGTGCCTGGACTGCAGCAGG - Intergenic
996766785 5:127042256-127042278 CTCAAGACGTGGGCTGCAGCAGG - Intergenic
996858333 5:128035793-128035815 CTCAGTGCCTGGTCAGCAGCTGG + Intergenic
996879751 5:128282757-128282779 GACAATTTGTGGGCTGCAGCAGG + Intronic
1001717704 5:173830029-173830051 GTGAGAGTGTGGGCTCCAGCGGG + Intergenic
1002578891 5:180195221-180195243 GTCTGTGTGAGGGCTGCAGTGGG - Intronic
1002603959 5:180371010-180371032 GTCAGTGGGGGTTCTGCAGCGGG + Intergenic
1003331211 6:5130183-5130205 GCCTGGGCGTGGGCTGCAGGGGG + Intronic
1003822735 6:9918075-9918097 GTCAGTGCCAGAGCTGCTGCTGG + Intronic
1006447191 6:34086248-34086270 GACAGTGCTTGGGCAGCAGGAGG - Intronic
1007437108 6:41822192-41822214 TTCACTGCTTGAGCTGCAGCTGG - Intronic
1011108978 6:83815050-83815072 GACAGTGAGTGAGCTGGAGCAGG - Intergenic
1011550963 6:88530754-88530776 GTCAGTGCCTGAGCTGGAGAAGG - Intergenic
1011751702 6:90460843-90460865 GTGGGTGCTTGGGCTGCATCAGG - Intergenic
1012342704 6:98147585-98147607 GTCAGGGGGTGGGGTGCAGTGGG - Intergenic
1017561886 6:155636848-155636870 GTCAGGGTGTGGGCGGCAGGGGG - Intergenic
1018079690 6:160248102-160248124 ATCAGTGCATGCGCTTCAGCGGG - Intronic
1019346405 7:532963-532985 GACAGTGCGGGAGCTGCAGTTGG - Intergenic
1019500149 7:1360647-1360669 GTGAGTGGGGAGGCTGCAGCAGG + Intergenic
1019750465 7:2725916-2725938 GTCGGTGGGGGGACTGCAGCGGG - Intronic
1023214169 7:37843804-37843826 ATCAGTGCCTGGACTGCAGAGGG + Intronic
1024182223 7:46908016-46908038 GTCAGCGCGGGGGCTGCAGGGGG + Intergenic
1024288120 7:47777954-47777976 GTCAGTGCCTGGGCAGTAGCTGG + Intronic
1025211265 7:57020601-57020623 GTCGGGGGGTGGGATGCAGCTGG - Intergenic
1025660689 7:63556246-63556268 GTCGGGGGGTGGGATGCAGCTGG + Intergenic
1026598697 7:71755066-71755088 TTCATTGCCTGGGCTGAAGCCGG + Intergenic
1026771924 7:73207587-73207609 GTCAGTGTGTGGGCTCAGGCAGG - Intergenic
1027012792 7:74760983-74761005 GTCAGTGTGTGGGCTCAGGCAGG - Intergenic
1027075248 7:75185070-75185092 GTCAGTGTGTGGGCTCAGGCAGG + Intergenic
1031127458 7:117791256-117791278 TTCAGTCCGGGGGTTGCAGCAGG + Exonic
1031519963 7:122751877-122751899 GTCAGTAGGTGGGCAGCAGATGG - Intronic
1033468415 7:141620177-141620199 GGCAGTGGGTTGGCTGCAGAGGG + Intronic
1035202023 7:157273715-157273737 GGCAGTGCGTGGGCTCCATCTGG + Intergenic
1035599948 8:891498-891520 GTGTGTGCGTGGGCAGCTGCTGG + Intergenic
1037566652 8:20123709-20123731 GGCAGTGCGAGGGTTGCATCGGG + Intergenic
1041360044 8:57043230-57043252 GTCAGCTGATGGGCTGCAGCTGG + Intergenic
1045508445 8:102794883-102794905 GGCAGAGGGTGGGCTACAGCGGG + Intergenic
1049149046 8:141022604-141022626 GTCAGTGTGAAGGGTGCAGCTGG + Intergenic
1049276864 8:141724359-141724381 GCCAGTGACTGGGCAGCAGCGGG - Intergenic
1049415441 8:142492825-142492847 GGCAGTGCGGGGGCTGCAGGTGG + Intronic
1049790591 8:144470713-144470735 GTCTGTGCCTGGGCTCCAGCAGG + Intronic
1049796175 8:144498229-144498251 GACGGTGCCTGGGGTGCAGCAGG - Intronic
1050090753 9:2015455-2015477 GTCTGAGCGGCGGCTGCAGCGGG - Intronic
1053072705 9:35110612-35110634 TTCAGGGGGTGGGCAGCAGCTGG + Exonic
1058995131 9:110292191-110292213 GACAGTGCGTGGGCAGCCGGGGG - Intergenic
1060221014 9:121764137-121764159 GTGGGTGCTTGGGCTGCAGCGGG + Intronic
1060530029 9:124342563-124342585 GCCCGTGCTTGGCCTGCAGCTGG - Intronic
1061215461 9:129219167-129219189 GTCACTGCGGGGGCTTGAGCAGG + Intergenic
1061477520 9:130878289-130878311 GTCAGAGCCTGGGCTGCTGCTGG + Intronic
1061503228 9:131015502-131015524 GTCAGGGCGAGGGGTGCAGGTGG - Intronic
1061870550 9:133518037-133518059 GGCGGTGCCTGGGCTGCTGCAGG + Intronic
1062042809 9:134411924-134411946 GCGAGTGCCTGGGCTGCACCAGG - Intronic
1062381792 9:136290363-136290385 GGCCGGGCGAGGGCTGCAGCTGG - Intronic
1203422763 Un_GL000195v1:10410-10432 GGCTGTGCGTGAGGTGCAGCAGG + Intergenic
1185431560 X:14462-14484 ATTAGCGGGTGGGCTGCAGCCGG + Intergenic
1185432824 X:19477-19499 ATTAGCGGGTGGGCTGCAGCCGG + Intergenic
1185440885 X:227181-227203 ATTAGCGGGTGGGCTGCAGCCGG + Intergenic
1185442176 X:232299-232321 ATTAGCGGGTGGGCTGCAGCCGG + Intergenic
1186962425 X:14750937-14750959 CTCATTGCTTGGGCTGGAGCAGG - Intergenic
1190301029 X:49057724-49057746 GTCATGGTGTGGGCTGCTGCAGG + Intronic
1198579442 X:138047793-138047815 GCCAGTGCGTTGGCAGCTGCTGG - Intergenic