ID: 1128313572

View in Genome Browser
Species Human (GRCh38)
Location 15:66646460-66646482
Sequence TGGGCTGCAGCCGGCATGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 308}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128313566_1128313572 0 Left 1128313566 15:66646437-66646459 CCCCTGGGATAGTGGTCAGTGCG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1128313572 15:66646460-66646482 TGGGCTGCAGCCGGCATGCCTGG 0: 1
1: 0
2: 5
3: 29
4: 308
1128313568_1128313572 -2 Left 1128313568 15:66646439-66646461 CCTGGGATAGTGGTCAGTGCGTG 0: 1
1: 0
2: 0
3: 31
4: 850
Right 1128313572 15:66646460-66646482 TGGGCTGCAGCCGGCATGCCTGG 0: 1
1: 0
2: 5
3: 29
4: 308
1128313562_1128313572 19 Left 1128313562 15:66646418-66646440 CCGAGACTTTGAGGAAGGTCCCC 0: 1
1: 0
2: 1
3: 14
4: 137
Right 1128313572 15:66646460-66646482 TGGGCTGCAGCCGGCATGCCTGG 0: 1
1: 0
2: 5
3: 29
4: 308
1128313561_1128313572 20 Left 1128313561 15:66646417-66646439 CCCGAGACTTTGAGGAAGGTCCC 0: 1
1: 0
2: 2
3: 29
4: 1302
Right 1128313572 15:66646460-66646482 TGGGCTGCAGCCGGCATGCCTGG 0: 1
1: 0
2: 5
3: 29
4: 308
1128313567_1128313572 -1 Left 1128313567 15:66646438-66646460 CCCTGGGATAGTGGTCAGTGCGT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1128313572 15:66646460-66646482 TGGGCTGCAGCCGGCATGCCTGG 0: 1
1: 0
2: 5
3: 29
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128313572 Original CRISPR TGGGCTGCAGCCGGCATGCC TGG Intronic
900240862 1:1616549-1616571 TGGGCTGCAGCCCTGATGCCTGG - Exonic
900294358 1:1941454-1941476 GGGGATGCAGCCAGCAGGCCTGG + Intronic
900591925 1:3463982-3464004 TGGACAGGAGCCGGCCTGCCTGG + Intronic
900982007 1:6051214-6051236 TGGGGTGCAGCTGTCCTGCCTGG + Intronic
900992929 1:6106324-6106346 TTGGCAGCAGCAGGCAGGCCGGG + Intronic
901476705 1:9495035-9495057 TGGGCTGCTGTGGGCATTCCGGG + Intergenic
901697822 1:11022367-11022389 TGGGCGGCAGCCATCATGGCTGG - Exonic
901779735 1:11585948-11585970 TGGGCAGCAGCTGAAATGCCTGG + Intergenic
902081616 1:13824816-13824838 TGGGCTGCAGGTGACTTGCCAGG - Exonic
902374335 1:16023225-16023247 TGGGCTGCAGCCAGCGGGCCAGG + Intronic
902490790 1:16779260-16779282 TTGGCTGCAGCCCACCTGCCCGG - Intronic
903023570 1:20411343-20411365 TGGAGTGCAGCAGGGATGCCTGG - Intergenic
903809942 1:26029592-26029614 TGGGATGCAGCCGGCCTGGGGGG - Exonic
904496648 1:30891054-30891076 AGGGCTGCAGCTGGAATGCTGGG - Intronic
905055250 1:35087916-35087938 TAGGCACCAGCCAGCATGCCTGG - Intronic
905906626 1:41622759-41622781 TGTGCTGGAGCAGGCAAGCCAGG + Intronic
906196229 1:43932233-43932255 GGGGCTGCTGCAGGCGTGCCAGG - Intergenic
906458384 1:46018189-46018211 AGGGCACCATCCGGCATGCCTGG + Intronic
907901978 1:58749354-58749376 TCGGCTGCAGCAGAAATGCCAGG - Intergenic
909133453 1:71768035-71768057 TGGGCTTCTGCCTGGATGCCTGG - Intronic
910981181 1:92961357-92961379 TGGGCGGCCGCCGGCCTACCTGG + Exonic
911025650 1:93433772-93433794 CCCACTGCAGCCGGCATGCCTGG - Intergenic
911098203 1:94073011-94073033 TGGGCTGCTGAAGGCCTGCCTGG - Intronic
912500915 1:110121401-110121423 CGGGCCGCAGCAGGCAGGCCTGG - Intergenic
912757033 1:112333211-112333233 TGGGCTGCCCCTGGGATGCCTGG - Intergenic
913332325 1:117677775-117677797 TGGGCGCCAGCCACCATGCCTGG - Intergenic
914453214 1:147811576-147811598 TTGTCTGCAGACGGCATGCTTGG - Intergenic
914740298 1:150458918-150458940 TGGGCTTGAGCCACCATGCCCGG + Intronic
915380919 1:155439555-155439577 TAGGTTTCAGCCAGCATGCCTGG - Intronic
915409369 1:155688621-155688643 TGCGCTGGAGCCGGCTTGACAGG - Exonic
916022192 1:160802346-160802368 GGGGCCGCAGCCAGCAGGCCCGG - Intronic
918756208 1:188341668-188341690 TGGGCTCCAGCCACCACGCCCGG - Intergenic
919454054 1:197801839-197801861 GCTGCTGCAGCTGGCATGCCTGG + Intergenic
919730909 1:200913118-200913140 TGGACTGCAGCTGGCATCCTGGG + Intronic
919748546 1:201023232-201023254 TGGGCTGGAGCCTGCACTCCCGG - Intronic
920824939 1:209416288-209416310 TGATTTGCAGCCGGCATGCTGGG + Intergenic
921120292 1:212130475-212130497 TGGCCTTCAGCCTGAATGCCTGG + Intergenic
921179317 1:212619273-212619295 TGGGCTGCTGCCTGGATGCAGGG - Intronic
921185965 1:212669785-212669807 CAGGCTGCAGCTGGCAGGCCTGG + Intergenic
922507676 1:226135947-226135969 AGGGCTGCAGCCGGAATCCCAGG + Intergenic
922780688 1:228250152-228250174 GGTGGTGCAGCAGGCATGCCAGG + Exonic
923529654 1:234803275-234803297 TTGGCTGCAGCCCACCTGCCCGG + Intergenic
924365741 1:243291528-243291550 TGACATGCAGCCTGCATGCCAGG - Intronic
1067525082 10:47033674-47033696 TGGGGTGCAGGCGCCATGCGGGG + Intergenic
1067684480 10:48458358-48458380 GGGGCTTCAGCAGGCAGGCCAGG + Intronic
1068130617 10:52890442-52890464 TCCGCAGCAGCCGGCATACCTGG + Intergenic
1068513252 10:57993236-57993258 TGGGTTGTTGCTGGCATGCCAGG - Intergenic
1070096088 10:73339648-73339670 TCTGCTGCAGCCAGCATGCCTGG - Intronic
1071546781 10:86535624-86535646 TGCGCCGCAGCCGCCCTGCCCGG + Intergenic
1074819104 10:117165908-117165930 CGGGCTCCAGCCGGCAGCCCGGG - Intergenic
1075551948 10:123399570-123399592 TGGGTTGCAGAGGGCTTGCCTGG - Intergenic
1075731240 10:124637983-124638005 TGGGCTGCAACCCTGATGCCTGG + Intronic
1076556911 10:131330502-131330524 TGGGCGTCCGCCGCCATGCCCGG + Intergenic
1076614419 10:131746564-131746586 GGGGCTGCAGCAGGGTTGCCCGG + Intergenic
1076692153 10:132229330-132229352 TGGGCTCCTGGCTGCATGCCCGG + Intronic
1076785747 10:132749069-132749091 AGGGCTGCAGGCGGCTTGACCGG - Intronic
1076852652 10:133100550-133100572 GGGGCTGCAGCAGGCAGGTCTGG + Intronic
1077179850 11:1207392-1207414 TGAGCTGGAGCCAGCCTGCCAGG - Intergenic
1077533377 11:3107653-3107675 TGGGCTGCAGGCTGCACGCAGGG - Intronic
1077844820 11:6013138-6013160 TGGGCAGCTGCAGCCATGCCTGG + Intergenic
1081099007 11:38978468-38978490 TGGGCAGCATCCAGCATGGCTGG - Intergenic
1081163817 11:39785071-39785093 ATGGCAGCAGCTGGCATGCCTGG - Intergenic
1081767253 11:45620337-45620359 CCCGCTGCAGCCAGCATGCCTGG - Intergenic
1083265688 11:61545936-61545958 GGGGCAGCAGCGGGCATGCCAGG + Intronic
1083682725 11:64358848-64358870 CTGGCTGCAGCCGGCATTCCCGG + Intergenic
1083765448 11:64839324-64839346 TGGGCAGCAGCAGGCCAGCCTGG - Intronic
1083821017 11:65171416-65171438 GGGGCTGCAGCCGGCAAGGTGGG + Exonic
1084949215 11:72655374-72655396 TGGGCTGCAGAGGGCATGAGGGG - Intronic
1087873376 11:103326541-103326563 TGAGCTGCAGACCGCATTCCGGG + Intronic
1089099108 11:115945948-115945970 TGTGCTGCAGTGGACATGCCAGG - Intergenic
1090042039 11:123299858-123299880 CCTGCTGCAGCTGGCATGCCTGG + Intergenic
1090068728 11:123525767-123525789 TGGGGGGCAGCCGGCCAGCCTGG + Exonic
1090652937 11:128823291-128823313 AGGGGTGGAGCCGGCAGGCCAGG - Intergenic
1090989140 11:131800580-131800602 TGTGCTGCAGAAAGCATGCCAGG - Intronic
1095447072 12:42293211-42293233 AGGCATGCAGCCGCCATGCCCGG - Intronic
1097078469 12:56412416-56412438 TCTGCTGCAGCCGGCATGCCTGG - Intergenic
1097218630 12:57433594-57433616 TAGGCTTGAGCCGCCATGCCTGG + Intergenic
1097450588 12:59733353-59733375 CCTGCTGCAGCCGGCATGCCTGG - Intronic
1098525299 12:71480396-71480418 TGGGATGAAGCAGGCAGGCCGGG + Intronic
1099738687 12:86602087-86602109 GAGGCAGCAGCCAGCATGCCTGG + Intronic
1103401047 12:120642724-120642746 TGGGTTGCAGCAGGAATGCTGGG + Intronic
1103553806 12:121753969-121753991 TGGGCTGCTGCTGCCCTGCCTGG + Intronic
1104051097 12:125194433-125194455 GTGGCTGCAGCCGGCACTCCTGG + Intronic
1104720508 12:131042730-131042752 TGTGTTGCAGACGCCATGCCGGG - Intronic
1106488764 13:30196218-30196240 TGAGCAGCAGCAGCCATGCCTGG - Intergenic
1109273096 13:60275724-60275746 TGGGCTGCAGCCATCATGGTTGG - Intergenic
1110190997 13:72728197-72728219 TGAGATGCAGCCGGCTTCCCTGG - Intronic
1111304107 13:86383271-86383293 CCTGCTGCAGCTGGCATGCCTGG + Intergenic
1111414907 13:87927318-87927340 TGGGCTCAAGCCACCATGCCTGG + Intergenic
1112254768 13:97819771-97819793 TGGGCTGCAGCCGGTCTGTGAGG - Intergenic
1112344265 13:98577054-98577076 TGGGCTGGAGCCGGGCGGCCTGG + Intronic
1114529709 14:23388118-23388140 GGGGCCGCAGCCAGCATGCAGGG - Intronic
1114535061 14:23417466-23417488 GGGGCCGCAGCCAGCATGCAGGG - Intronic
1115851353 14:37592524-37592546 GGCGCAGTAGCCGGCATGCCGGG - Exonic
1116221581 14:42095325-42095347 TCCACTGCAGCTGGCATGCCTGG - Intergenic
1118711251 14:68521329-68521351 TGGCCTGCAGACAGCCTGCCTGG - Intronic
1118880001 14:69817859-69817881 TGGGCTCCCGCCAACATGCCCGG + Intergenic
1118902425 14:69997849-69997871 TGTGCTTCAGCCTGCATCCCCGG + Intronic
1119084770 14:71729843-71729865 TAGACTGCAGGCAGCATGCCAGG + Intronic
1119257041 14:73207860-73207882 CCTGCTGCAGCCAGCATGCCTGG - Intronic
1119468944 14:74881792-74881814 TGCGCTGCAGCCGGGATACTGGG + Intergenic
1121857553 14:97283953-97283975 TGGGCTGGAGGCAGCATGTCAGG - Intergenic
1121911332 14:97795037-97795059 TTTGCTGCAGCCAGCATGGCTGG - Intergenic
1122290663 14:100678754-100678776 TGGGCTGGAGCAGGAAAGCCAGG + Intergenic
1122974113 14:105164074-105164096 TGGGGAGCAGGCGGCAGGCCTGG - Intronic
1124820991 15:33045223-33045245 CCCGCTGCAGCCAGCATGCCTGG + Intronic
1125113945 15:36067044-36067066 AGCGCAGCAGCCGGCATGCCTGG - Intergenic
1126215330 15:46147108-46147130 TCCACTGCAGCAGGCATGCCTGG + Intergenic
1128313572 15:66646460-66646482 TGGGCTGCAGCCGGCATGCCTGG + Intronic
1129122059 15:73404642-73404664 TGGGCTGCAGCCTGCTTCCTGGG - Intergenic
1129272738 15:74428007-74428029 TGGGGTGCAGAAGGCATGGCAGG + Intronic
1129740146 15:77986114-77986136 TGGGAAGCAGCCGGCCTGGCTGG - Intronic
1129869847 15:78933183-78933205 GGGGCTGCAGCCTGCCTGCCTGG + Intronic
1131096084 15:89655167-89655189 GGGGCTGAGGCCGGCATCCCGGG - Intronic
1131437988 15:92438248-92438270 TGGGCTGCAGCCACCGTGCAGGG + Intronic
1132176568 15:99720627-99720649 AGGGAGGAAGCCGGCATGCCAGG - Intronic
1132694567 16:1196134-1196156 TGGGCTGGGGCCGGAGTGCCTGG - Intronic
1132973071 16:2698350-2698372 GGGCCTGCAGCCAGCATGGCTGG + Intronic
1134604460 16:15559370-15559392 TGAGTTGCAGCGGGCATGACTGG - Intronic
1134849778 16:17470564-17470586 CGGGCTGCAGCCGGCTCGGCGGG + Exonic
1135116335 16:19726854-19726876 CAGGCTTCAGCCAGCATGCCCGG - Intronic
1135585697 16:23669292-23669314 TGGGCTTCAGGCTGCATCCCAGG + Exonic
1136297690 16:29313011-29313033 TGGGCCTCAGCAGCCATGCCAGG + Intergenic
1138411182 16:56841611-56841633 TGGGCTGCTCCAGGCAGGCCTGG - Intronic
1140491072 16:75336330-75336352 TGGGCTGCAGCTAGAGTGCCTGG + Intronic
1141629229 16:85277642-85277664 TGGGCTGCAGCTGGGCAGCCTGG + Intergenic
1142757626 17:2025199-2025221 GGGGCTGCGGCCGGCCGGCCAGG - Exonic
1143453932 17:7053666-7053688 AGGGCTGCAGCAGCCCTGCCTGG + Intergenic
1143944122 17:10574805-10574827 TAGGCAGCAGCCCCCATGCCGGG - Intergenic
1144047668 17:11468405-11468427 TGGGGTGCAGCCTGCATTCTAGG + Intronic
1144639757 17:16930915-16930937 GGGTCTGCAGCCGGGATGCAGGG - Intronic
1144739804 17:17575555-17575577 AGGGCTGCAGCCGAAGTGCCTGG - Intronic
1145982780 17:29023874-29023896 TGGGCTGCTGCCAGCATCCTAGG - Intronic
1146369509 17:32256651-32256673 TGGGCTGCAGCTCACATGCCTGG - Intergenic
1146543577 17:33718889-33718911 TGGGCTGCTGGTAGCATGCCTGG - Intronic
1146935934 17:36812809-36812831 TGGGCTGCACCTTGCATTCCTGG - Intergenic
1146955091 17:36932749-36932771 AGGGCAGCATCCGGCAGGCCGGG - Intergenic
1147249627 17:39145258-39145280 TGGGCTGTACCCTGCATGCTGGG - Intronic
1147400439 17:40177618-40177640 CCGGCTGCAGCCGGCATGGGGGG + Intronic
1148131043 17:45262725-45262747 TGGTGTGCATCCGGCATCCCTGG + Intergenic
1148236782 17:45974417-45974439 TGCGCGGCAGCCTGCTTGCCGGG - Exonic
1148773467 17:50079915-50079937 TAGGCTTCAACCGGCTTGCCAGG - Intronic
1148902724 17:50890571-50890593 TGGGCGCCAGCCACCATGCCTGG - Intergenic
1149296758 17:55267968-55267990 TGGGCTGCAGCCAGCTTCCTCGG + Exonic
1150264172 17:63821194-63821216 TGGGGTACAGCCTGCATGGCAGG - Intronic
1151987825 17:77555610-77555632 TGGCCTGCTGCCTGCCTGCCTGG + Intergenic
1152113578 17:78371044-78371066 TGCACTGCAGCCGGAATTCCTGG + Intergenic
1152180117 17:78814433-78814455 CGGGCTACAGCTGCCATGCCGGG - Exonic
1152241558 17:79163853-79163875 TGGGCTCCAGCAGGCCTGTCTGG - Intronic
1152495958 17:80671694-80671716 AAGGCTGCAGATGGCATGCCTGG - Intronic
1152704331 17:81834915-81834937 TGGGCTGTAGCGGGCATAGCGGG + Exonic
1152997352 18:420073-420095 AGGGTCTCAGCCGGCATGCCAGG - Intronic
1154312541 18:13278465-13278487 GAGGCTGAAGCTGGCATGCCAGG - Intronic
1155362284 18:25015621-25015643 GGGGCTCCAGCCAGCATGCAGGG + Intergenic
1157598137 18:48876183-48876205 TTGGCTGCAGCCCCCAGGCCAGG + Intergenic
1159334448 18:67044526-67044548 CCTGCTGCAGCTGGCATGCCTGG + Intergenic
1160067451 18:75589049-75589071 CGGGCTGCAGCCAGCAGGCTGGG + Intergenic
1160223129 18:76991728-76991750 CGGGGCGCAGCCAGCATGCCTGG - Intronic
1160580802 18:79883857-79883879 GGGGCTGCAGCCGCCATGACGGG - Intronic
1160779389 19:871119-871141 TGGGCTGCAGGCGGCTAACCAGG + Exonic
1160894487 19:1396241-1396263 TGGTGTGCAGCAGGCATGCAGGG - Intergenic
1161215859 19:3094801-3094823 GGGCCCGCAGCCGGCAGGCCCGG - Intronic
1161426455 19:4206215-4206237 TAGGCTGCAGCCACCATGCCCGG - Intronic
1161586711 19:5109610-5109632 TGTGCTGCAGCCGGCTTGCCTGG - Intronic
1162001889 19:7750003-7750025 TGGGCATCAGCCACCATGCCTGG - Intergenic
1162034448 19:7931660-7931682 TGGGCTGCAGGGGGCGTGCCTGG + Intronic
1162507890 19:11097993-11098015 TAGGCTGGAGCCACCATGCCCGG - Intronic
1162911135 19:13848143-13848165 GGGACTGCAGCCAACATGCCTGG + Intergenic
1163103876 19:15112444-15112466 TGTGCTGCTGCCGGCACGCCAGG + Exonic
1165247536 19:34505802-34505824 TGGGCTGCAGGCTGGAGGCCAGG + Exonic
1166862887 19:45819936-45819958 TGGCCTGCAGCGTGCACGCCTGG + Intronic
1166942203 19:46373924-46373946 AGGCCTGGAGCCAGCATGCCGGG + Intronic
1167216174 19:48166691-48166713 TGGGCAGCAGCCACCACGCCCGG - Intronic
1167292204 19:48630507-48630529 CGGGCTGCAGCCAGTATGCCAGG + Exonic
1168429674 19:56268261-56268283 TCGGCTGCAGCTGGCATGACTGG - Intronic
1168643573 19:58045684-58045706 GGAGCTGCAGGCGGCATGTCGGG + Intronic
925229238 2:2217538-2217560 TGGGTGGCTGCCAGCATGCCTGG - Intronic
925266500 2:2570066-2570088 AGGGCTCCATCCGGCAGGCCTGG + Intergenic
925408404 2:3624496-3624518 TGGGCAGCATCCTGCATGGCTGG + Intronic
926229343 2:10990874-10990896 TGGGTAGCAGAGGGCATGCCTGG - Intergenic
926675812 2:15619057-15619079 TGGGCAGCTGCAGCCATGCCTGG + Intronic
928149694 2:28815002-28815024 TGGGCTTGAGCCATCATGCCTGG - Intronic
928511912 2:32010547-32010569 TGGGCAGCAGCGGGGACGCCGGG - Exonic
928633787 2:33221379-33221401 TTGGCTGCATCCGCTATGCCAGG + Intronic
929336745 2:40756908-40756930 TGGGCATGAGCCAGCATGCCAGG + Intergenic
929458560 2:42084522-42084544 TGGGCTCCAGCCTGCAAGACTGG - Intergenic
929864853 2:45709228-45709250 TGGGCTGGGGCCAGCATACCGGG + Intronic
930121356 2:47763645-47763667 AGGTCTGCAGTCTGCATGCCTGG + Intronic
930946770 2:57084823-57084845 TGGGCTGCTGGAGCCATGCCTGG + Intergenic
933591326 2:84235838-84235860 TGGGATGCAGCCATCATGCAAGG - Intergenic
935162953 2:100544921-100544943 TGGGCTTGAGCCACCATGCCCGG + Intergenic
936531379 2:113278830-113278852 GGGCCTGCAGCCGGCCGGCCAGG - Exonic
937156844 2:119725664-119725686 TGGGCTAGAGCTGGCAGGCCAGG + Intergenic
942045168 2:172095682-172095704 TGGGCTGGCGGCGGCGTGCCTGG + Intergenic
942867930 2:180698902-180698924 TCGGCTGCATCTGGCTTGCCTGG - Intergenic
947586826 2:231361694-231361716 TGAGGGGCAGCTGGCATGCCTGG - Intronic
947742003 2:232488875-232488897 CGGGCTGGAGCCGGCAGACCTGG - Intergenic
948055777 2:235008342-235008364 TGGGCTGCAGCCTCCCTGCAGGG + Intronic
948864758 2:240769573-240769595 AGGGGTGCAGCCAGCAAGCCCGG - Intronic
1169269127 20:4186022-4186044 TGGGCAGGAGCCTGCATCCCTGG - Intronic
1169363339 20:4970453-4970475 TAGGCTTCAGCCACCATGCCTGG - Intronic
1169505063 20:6201242-6201264 TGGGCTGCAGCCATCATGGCTGG + Intergenic
1171123025 20:22582136-22582158 TGGGCCTCAGGCGGCAGGCCCGG + Exonic
1171185212 20:23120045-23120067 TGGGCTGCGGCAGGCAGGCCTGG - Intergenic
1171294881 20:24008700-24008722 GTGGCTGCAGCAGGGATGCCAGG - Intergenic
1172767552 20:37358833-37358855 TGGGGTGGAGACGGCAGGCCGGG - Intronic
1174085684 20:48005864-48005886 TGGGCTGCAGAAGGCAAGCCAGG + Intergenic
1174103437 20:48144793-48144815 TGGGCTGGAGCCAGGCTGCCTGG + Intergenic
1174178115 20:48657663-48657685 TGGGCTCCAGCCAGCACGGCAGG + Intronic
1174251162 20:49220628-49220650 GGGGCCGCAGCCAGCAGGCCTGG - Intronic
1174364518 20:50048472-50048494 GGGGCTGCAGACAGCATGTCGGG + Intergenic
1174628999 20:51940203-51940225 AGGGATGCAGCCGGAAAGCCAGG + Intergenic
1175173227 20:57094045-57094067 GCGGCTGCAGCCGGTATACCCGG - Intergenic
1175910852 20:62404866-62404888 TGCGCTGTGGCCGGCATCCCTGG - Intronic
1176104720 20:63380592-63380614 CCTGCCGCAGCCGGCATGCCTGG + Intergenic
1178029264 21:28505708-28505730 TGGGCTTCTGCCTGGATGCCAGG + Intergenic
1178488494 21:33033368-33033390 AGGGCCGCAGCCGGAATCCCGGG + Intergenic
1178839914 21:36130167-36130189 TGGGCAGCAGCGGGGACGCCGGG + Intergenic
1178951548 21:36990007-36990029 GGGGCTGCAGCCGGGACGGCCGG - Intronic
1179537388 21:42061320-42061342 TGGCCTGCAGCAGGCAGGGCCGG + Intergenic
1179988755 21:44934933-44934955 TGGGCTCCTGCCTGCCTGCCAGG - Exonic
1180186046 21:46139760-46139782 GGGGCTGCAGCCAGGAGGCCTGG - Intronic
1180235861 21:46459069-46459091 TGCGCTGCCGCCGCCAGGCCCGG + Intronic
1182306994 22:29376917-29376939 TGGGCATGAGCCAGCATGCCCGG - Intronic
1182711493 22:32325996-32326018 GGGTCTGCAGCTGGCAGGCCTGG + Intergenic
1184093910 22:42306315-42306337 AGGGCTGCAGCCGCCCTGCCAGG + Intronic
1184371372 22:44084268-44084290 TGGGGTGGAGCAGGCATCCCAGG - Intronic
1184399019 22:44262785-44262807 GGGTCTGCAGCTGGCAGGCCTGG + Intronic
1184417515 22:44360878-44360900 TGGGCTGGAGCCGGCTGGCATGG + Intergenic
1184658108 22:45952313-45952335 CGTGCTGCAGCCGGGCTGCCAGG + Intronic
1184695186 22:46135048-46135070 TGGGGAGCAGGCGGCCTGCCAGG + Intergenic
1185292297 22:50033139-50033161 TGGGCTGCTGCCTGCATGCCTGG - Intronic
950457548 3:13101636-13101658 TGGGCTGCAGGCGGAAGGGCTGG + Intergenic
951439639 3:22707793-22707815 TGGGCTGCAGGTGGCTTGCTGGG - Intergenic
952241308 3:31533237-31533259 CGAGCTGAAGCCGGCAAGCCAGG - Exonic
953336003 3:42094517-42094539 TGGGCTGGAGCCACCGTGCCTGG + Intronic
954388165 3:50255216-50255238 TGGGCAGCAGCCTGGAGGCCTGG + Intronic
954452549 3:50579614-50579636 TGGGATTCAGCAAGCATGCCTGG + Intronic
956684522 3:71812487-71812509 TGGGCTGCAGACAGCATGGATGG + Intergenic
958996878 3:100915406-100915428 AGGACTGCTGCCGCCATGCCCGG + Intronic
961009259 3:123425032-123425054 TGGGCTGCACTCAGGATGCCTGG - Intronic
961477061 3:127153535-127153557 TGGGGTGCTGCCGGCCAGCCAGG + Intergenic
961695526 3:128701521-128701543 TGGCCTGCAGTCTGCATTCCAGG - Intergenic
961955114 3:130793709-130793731 TGGGCTGCAGTTGGTTTGCCTGG + Intergenic
962388659 3:134953601-134953623 TGCGCTGCTGCAAGCATGCCGGG - Intronic
965757575 3:172040734-172040756 TGGGCTGGGGCCGGCAGGCGTGG + Intronic
967618690 3:191604930-191604952 TAGGCTCCTGCCAGCATGCCTGG + Intergenic
969167758 4:5331399-5331421 TGGGCTGCTGGCGGGATGCCTGG + Intronic
969192589 4:5534148-5534170 AGGGCTACAGGCTGCATGCCTGG + Intergenic
969429869 4:7147835-7147857 TGGGCTGGAGCCGGGGAGCCTGG - Intergenic
973531926 4:51843605-51843627 TGGGCTGTAGCGGGCAGGGCCGG + Intronic
974386324 4:61204769-61204791 TAGGCTGCATCAGGCATCCCCGG + Intronic
974683382 4:65194201-65194223 CCTGCTGCAGCCGGCATGCCTGG - Intergenic
977645813 4:99410355-99410377 CCTGCTGCAGCCAGCATGCCTGG - Intergenic
978248448 4:106603594-106603616 CCTGCTGCAGCCAGCATGCCTGG - Intergenic
978595131 4:110369175-110369197 AGGGCTGCAGGCAGCAGGCCCGG + Intronic
978663317 4:111153890-111153912 CCTGCTGCAGCCAGCATGCCTGG - Intergenic
979637766 4:122977360-122977382 TCCACTGCAGCCAGCATGCCTGG - Intronic
981719200 4:147781381-147781403 TGGGCTGGACCTGGCAAGCCAGG + Intronic
983323896 4:166228261-166228283 GCCGCAGCAGCCGGCATGCCTGG + Intergenic
983885297 4:172974785-172974807 CCTGCTGCAGCCGGCATGCCTGG - Intronic
984577907 4:181472761-181472783 TGCTCTGCAGCCAGCCTGCCGGG + Intergenic
985588025 5:750975-750997 TGGGCTGCTGCCGTCGGGCCAGG + Intronic
985602694 5:843442-843464 TGGGCTGCTGCCGTCGGGCCAGG + Intronic
985646250 5:1086027-1086049 TGGGGTGCAGCAGGCATGGAGGG + Intronic
988604620 5:32668739-32668761 TTGGGTGCAGCATGCATGCCGGG + Intergenic
988732267 5:33984325-33984347 CGGGCTGCAGCAGGAATCCCAGG + Exonic
992365266 5:76083810-76083832 TGGGCAGCAGCGGGGATGCAGGG + Intronic
992528084 5:77630595-77630617 TGGGCGGCGGCCGCCATGCCTGG - Exonic
995723868 5:115165573-115165595 TGGGCTGCAGCTGCCATCACTGG - Intronic
996176898 5:120369477-120369499 TCTGCTGCAGCTGGCATGCCTGG + Intergenic
997228728 5:132228075-132228097 TGGGCTGCGGGCGGCATGAAGGG - Intronic
999702158 5:154238019-154238041 TTGGCTGCTGCCTGCATACCCGG + Intronic
1001541454 5:172542722-172542744 TGGGCAGCAGCGGGCCTGCCGGG - Intergenic
1002087594 5:176785605-176785627 TGGGCTCCAGCAGCCATACCTGG + Intergenic
1002688869 5:181036891-181036913 GGGGCTGCAGCAGGGAGGCCTGG + Intergenic
1003777138 6:9380124-9380146 TGGAATGCAGCCGTGATGCCTGG + Intergenic
1003784912 6:9474733-9474755 TGGGCTTGAGCCAGCATGGCAGG - Intergenic
1004517298 6:16331141-16331163 TAGGCGGCTGCCGCCATGCCTGG + Intronic
1009992088 6:70855738-70855760 TGGGCTGGAGCCTGTCTGCCAGG - Intronic
1011188675 6:84707398-84707420 TGGGCTGCAGCAAGCTGGCCAGG + Intronic
1014056789 6:117025267-117025289 TGGGTTGCAAGCGGCAAGCCTGG + Intergenic
1014817741 6:125953648-125953670 TCCGCAGCAGCCAGCATGCCTGG + Intergenic
1016130584 6:140463485-140463507 TGGGATGCAGCAGGCAGGACAGG - Intergenic
1017793848 6:157823734-157823756 TGGGCTGCGGCGGGCTCGCCGGG + Intronic
1019319641 7:409767-409789 AGGGCTGCAGGTGGCATCCCAGG + Intergenic
1019342455 7:515010-515032 TGGGACGCAGCCTGCATGCTGGG + Intronic
1019782458 7:2951641-2951663 TGGGTTCCAGCCAGCATGTCTGG + Intronic
1021452941 7:20798530-20798552 GGGGCTGTAGCCGGCACGCGCGG + Intergenic
1022563114 7:31370758-31370780 TGGGCTGCACATGGCAGGCCAGG - Intergenic
1023401047 7:39793162-39793184 TGGGCTGCATGCGGGATGCCGGG - Intergenic
1023911798 7:44561702-44561724 TGGGCTGCAACAGGCGTGCCAGG + Intergenic
1024074819 7:45812989-45813011 TGGGCTGCACGCGGGCTGCCGGG - Intergenic
1024292737 7:47816839-47816861 TGGGCTGTAGACAGCAGGCCTGG + Intronic
1025057194 7:55774850-55774872 TGGGCAGGACCAGGCATGCCAGG + Intergenic
1025084290 7:56009911-56009933 TGGGCAGGACCAGGCATGCCAGG - Intergenic
1025966748 7:66280099-66280121 TGGGCTGCAGACGGAAATCCTGG + Intronic
1026664561 7:72331205-72331227 TGGGCTCCCGCCACCATGCCCGG - Intronic
1026911609 7:74094630-74094652 AGTGCTGCAGCCGGGAGGCCAGG - Intronic
1029217985 7:98965601-98965623 TGGGCAGAACCCAGCATGCCAGG + Intronic
1034417997 7:150975190-150975212 CGGGCTGCTGGCGGCCTGCCCGG - Intronic
1034468951 7:151245646-151245668 CGGGCTCCAGACGGCATCCCGGG + Exonic
1034546010 7:151789858-151789880 TGGGTTGCAGCCTGCAGGGCCGG - Intronic
1036637837 8:10564012-10564034 GGGGCTGCAACCCGCAGGCCTGG - Intergenic
1036792534 8:11730948-11730970 TGAGGTGCAGCCCGCGTGCCTGG + Intronic
1038453732 8:27657681-27657703 CAGGCGGCAGCCAGCATGCCCGG + Intronic
1041274526 8:56143236-56143258 CTCACTGCAGCCGGCATGCCTGG + Intergenic
1041357380 8:57014639-57014661 TGGGCAGCTGCCGCTATGCCTGG + Intergenic
1041915693 8:63136670-63136692 TGGGCTGCAGCCATCATGGCTGG + Intergenic
1042499482 8:69492605-69492627 TGCGCTGCAGCCGGCCGGCTTGG - Intronic
1044812628 8:96079618-96079640 TGGCCTGCAGTCTGCATTCCAGG + Intergenic
1045388149 8:101690422-101690444 AGGGCAGCACCCGGCCTGCCTGG + Intronic
1049330374 8:142047306-142047328 AGGGCTGCAGTCGGCATCCGCGG + Intergenic
1049394243 8:142391732-142391754 GCCGCAGCAGCCGGCATGCCTGG + Intronic
1049649536 8:143758963-143758985 TCCGCTGCACCCGCCATGCCGGG + Intergenic
1049782435 8:144435094-144435116 TGGGCAGCAGCCCGCAGGTCTGG + Exonic
1049790594 8:144470722-144470744 TGGGCTCCAGCAGGCCTGGCTGG + Intronic
1049826724 8:144673856-144673878 CCCGCTGCAGCTGGCATGCCTGG - Intergenic
1049855187 8:144857303-144857325 AGAACTGCAGGCGGCATGCCCGG + Intergenic
1050364906 9:4864894-4864916 TGGGCTGCTGCCGGACTCCCTGG + Intronic
1050985500 9:12076791-12076813 TGCACTGCAGCCTGCATGACAGG - Intergenic
1055645561 9:78358420-78358442 CCTGCTGCAGCCGGTATGCCTGG + Intergenic
1055892755 9:81141066-81141088 TGGGCAGGAGCCACCATGCCTGG - Intergenic
1056167349 9:83952259-83952281 TGGGCTTGAGCCACCATGCCTGG + Intronic
1057785993 9:98087713-98087735 TGGGCTGCAACCGCCAGTCCTGG - Exonic
1058700482 9:107596177-107596199 TAGACTGCAGCCAGCATGTCAGG + Intergenic
1059723742 9:116986218-116986240 TGGGCTGCAGCTGCCCTTCCAGG + Intronic
1060272895 9:122159670-122159692 GGGGCTGCAGCCGTCATGCCGGG - Exonic
1061216236 9:129223631-129223653 TGGCCTGCAGCCTCCAGGCCAGG + Intergenic
1061478742 9:130885936-130885958 TGGACTGCAGTCGGCATGCCAGG + Intronic
1061945077 9:133904158-133904180 TGGGCTGGAGCCGGCCCACCAGG - Intronic
1062021131 9:134319902-134319924 AGGGCTGCAGGCGGCTGGCCCGG + Intronic
1062547736 9:137071137-137071159 TGTTCTGCAGCAGGCAGGCCAGG - Intergenic
1185980318 X:4771951-4771973 TGGGCTGCAGTAAGCATGTCAGG + Intergenic
1190457236 X:50638176-50638198 TGTGTTGCAGCCAGAATGCCAGG + Exonic
1192081099 X:68048720-68048742 TGGTCTGCAGCCAGCTTCCCTGG - Intronic
1194257861 X:91656530-91656552 TGGGCTCAAGCCACCATGCCTGG + Intergenic
1194944165 X:100048502-100048524 ATGGCTGCAGCTGGCATGGCTGG - Intergenic
1196796027 X:119502599-119502621 TGGGATGCAGGGGGCATGGCAGG + Intergenic
1198404688 X:136300536-136300558 TGGGCTGGAGCTGCTATGCCTGG + Intergenic
1200161353 X:154011498-154011520 TGGGCTGCAGACGCCCTGCATGG + Exonic
1200165958 X:154035450-154035472 TAGGCTGAAGCCACCATGCCTGG - Intronic
1200576629 Y:4896110-4896132 TGGGCTCAAGCCACCATGCCTGG + Intergenic