ID: 1128313574

View in Genome Browser
Species Human (GRCh38)
Location 15:66646470-66646492
Sequence CCGGCATGCCTGGAAACCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 136}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128313567_1128313574 9 Left 1128313567 15:66646438-66646460 CCCTGGGATAGTGGTCAGTGCGT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1128313574 15:66646470-66646492 CCGGCATGCCTGGAAACCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 136
1128313566_1128313574 10 Left 1128313566 15:66646437-66646459 CCCCTGGGATAGTGGTCAGTGCG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1128313574 15:66646470-66646492 CCGGCATGCCTGGAAACCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 136
1128313561_1128313574 30 Left 1128313561 15:66646417-66646439 CCCGAGACTTTGAGGAAGGTCCC 0: 1
1: 0
2: 2
3: 29
4: 1302
Right 1128313574 15:66646470-66646492 CCGGCATGCCTGGAAACCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 136
1128313568_1128313574 8 Left 1128313568 15:66646439-66646461 CCTGGGATAGTGGTCAGTGCGTG 0: 1
1: 0
2: 0
3: 31
4: 850
Right 1128313574 15:66646470-66646492 CCGGCATGCCTGGAAACCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 136
1128313562_1128313574 29 Left 1128313562 15:66646418-66646440 CCGAGACTTTGAGGAAGGTCCCC 0: 1
1: 0
2: 1
3: 14
4: 137
Right 1128313574 15:66646470-66646492 CCGGCATGCCTGGAAACCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128313574 Original CRISPR CCGGCATGCCTGGAAACCTC AGG Intronic
900634709 1:3657295-3657317 TCTGCATGCCTGGGAACCACAGG - Intronic
900748516 1:4377908-4377930 CCAGGATGCCTGGAAACACCTGG + Intergenic
903501263 1:23801111-23801133 CCGGCAAGTCTGAAAACCTGCGG - Intergenic
903670548 1:25033035-25033057 CCGGCCTGCCTGGAACATTCAGG + Intergenic
904965862 1:34372037-34372059 CAGGCATCCCTGGACACCTCAGG + Intergenic
913486105 1:119333850-119333872 CCGGCAGGCCTGCGAACCCCGGG + Intergenic
921632837 1:217455722-217455744 CCCTCAAGCCTGGAAACCTATGG + Intronic
922355932 1:224775026-224775048 CAGGTATGCATGGAAAGCTCTGG + Intergenic
923743151 1:236674469-236674491 CCTGAATGCCTGGGAACCCCAGG - Intergenic
1066611115 10:37249422-37249444 TAAGAATGCCTGGAAACCTCAGG + Intronic
1069038764 10:63672853-63672875 CCCTCAAGCCTGGAAACCTGCGG + Intergenic
1070225161 10:74496509-74496531 TCAGCATGGCTGGAAGCCTCAGG - Intronic
1075805827 10:125188094-125188116 CCCTCAAGCCTGGAAACTTCTGG + Intergenic
1076697916 10:132255994-132256016 CCGGCATCCCTGGGCAGCTCCGG + Intronic
1079708682 11:23653412-23653434 CCGGCCGGCCTGCAAACCCCGGG - Intergenic
1083685920 11:64375020-64375042 CCGACAGCCCTGTAAACCTCTGG + Intergenic
1084747688 11:71183723-71183745 CCAGCATGCTGGGAAACTTCAGG + Intronic
1085323529 11:75589332-75589354 CCGGCCAGCCTGGAGCCCTCTGG + Intronic
1086286351 11:85256059-85256081 CCTCCAGGCCTGGAAACCTGTGG + Intronic
1096836184 12:54352709-54352731 CAGGCAAGACTGGAAAACTCTGG - Intergenic
1100027185 12:90145067-90145089 CCAGCATGCCTGGCAACAGCAGG - Intergenic
1105242484 13:18620501-18620523 CAGAGATGCCTGGAAACCTTGGG - Intergenic
1109830034 13:67773547-67773569 CCACCATGCCTGCAAACCTATGG + Intergenic
1113807296 13:113117383-113117405 CGGGCATGCCAAGGAACCTCTGG - Intronic
1117983689 14:61366792-61366814 CCTGAATGCCTTGAAGCCTCTGG - Intronic
1120158861 14:81124298-81124320 CCGGCATGCCTGAAAGACACAGG + Intronic
1123005957 14:105323960-105323982 TCAAGATGCCTGGAAACCTCTGG + Intronic
1123488814 15:20764090-20764112 CAGAGATGCCTGGAAACCTTGGG + Intergenic
1123545313 15:21333177-21333199 CAGAGATGCCTGGAAACCTTGGG + Intergenic
1125672845 15:41486230-41486252 CTGGCAAGCCCGGAAGCCTCAGG + Intergenic
1125864563 15:43033527-43033549 CCAGCACGCCTGTAATCCTCAGG + Intronic
1127331048 15:57940381-57940403 CTGGGAAGCCTGGAAAGCTCAGG + Intergenic
1128313574 15:66646470-66646492 CCGGCATGCCTGGAAACCTCAGG + Intronic
1129385292 15:75192914-75192936 GCAGCAGGCCTGGAATCCTCAGG - Intergenic
1129879288 15:78996424-78996446 CCGGCAGGCCTGCAGACCCCTGG - Intronic
1130841827 15:87707804-87707826 CCTGAATGCCTGGGAGCCTCCGG + Intergenic
1132204146 15:99975024-99975046 CCGGCCTGCTTGGGAACTTCAGG - Intronic
1202953659 15_KI270727v1_random:60448-60470 CAGAGATGCCTGGAAACCTTGGG + Intergenic
1132792816 16:1702386-1702408 CCAGCAAGCATGGGAACCTCTGG + Intergenic
1133283669 16:4680815-4680837 GCGGGATGCCTGGAGACCACGGG - Intronic
1134873725 16:17676471-17676493 CCCTCAAGCCTGGAAACCTGTGG - Intergenic
1136011081 16:27363681-27363703 CCGGCCTCCCTGGCACCCTCGGG + Exonic
1138391726 16:56675471-56675493 CCGGCAGGCCTGGAAAGTCCCGG + Intronic
1143409838 17:6702260-6702282 CAGACATGCCTGGAAGCCCCAGG + Intronic
1144726343 17:17504443-17504465 CAGGCTTGCCTGGAAGGCTCAGG + Intergenic
1146273548 17:31499895-31499917 CTGGCATGCCTGGAATTCTTGGG + Intronic
1151849614 17:76682699-76682721 CCGGCATGCCTAGGAGCCACAGG + Intronic
1154446459 18:14439376-14439398 CAGAGATGCCTGGAAACCTTGGG + Intergenic
1155240485 18:23859636-23859658 CTCCCATGCCTGGAACCCTCTGG - Intronic
1161001585 19:1913628-1913650 CAGGCACGCCTGGAACCATCAGG - Intronic
1161608442 19:5227955-5227977 CCGGCATGCCTGGGAACTGTGGG + Intronic
1163108719 19:15143784-15143806 CCGGCATGGCTGGACACCAGGGG + Intergenic
1165405496 19:35628621-35628643 CCGGTCTTCCTGGAAACCACAGG + Intergenic
1168235096 19:55057934-55057956 CCAGCATGCCTGGCTAACTCTGG + Intronic
925427163 2:3759555-3759577 CCGCCATCCCTGGAATCCTGAGG - Intronic
926817160 2:16810346-16810368 TCAGCAGCCCTGGAAACCTCAGG - Intergenic
927219855 2:20696780-20696802 CCAGTTTGTCTGGAAACCTCTGG - Intronic
927322446 2:21762867-21762889 CCCTCAAGCCTGGAAACCTTTGG - Intergenic
928710602 2:34001165-34001187 CCCTCAAGCCTGGAAACCTGCGG + Intergenic
929068133 2:38000949-38000971 CTGGCATGGCTGGAAACCACTGG + Intronic
930001595 2:46865468-46865490 CCAGGATGCCTGGTGACCTCTGG - Intergenic
931623048 2:64230198-64230220 CTGGCATACCTGGAAACCAATGG - Intergenic
934732796 2:96669945-96669967 CCTCCACGCCGGGAAACCTCTGG - Intergenic
935408071 2:102730335-102730357 CCACCATGCCTGGCCACCTCTGG + Intronic
936146299 2:109982406-109982428 CCGGCATGACTGTAAAGATCTGG - Intergenic
936198392 2:110389073-110389095 CCGGCATGACTGTAAAGATCTGG + Intergenic
937195905 2:120156252-120156274 CCTGCTTGCCGGGAAGCCTCTGG + Intronic
937289330 2:120772594-120772616 CAGGCAGACCTGGGAACCTCTGG - Intronic
937728041 2:125190318-125190340 CTGTCACGCCTGAAAACCTCAGG + Intergenic
938509490 2:131925811-131925833 CCCTCAAGCCTGGAAACCTGTGG + Intergenic
945042383 2:205752962-205752984 CTGGCTTACCTGGAAACGTCCGG - Exonic
946134412 2:217633956-217633978 CCTGAAGGCCTGGAGACCTCTGG + Intronic
1170341028 20:15327438-15327460 TTGGCATGACTGGAATCCTCAGG + Intronic
1172806375 20:37614944-37614966 CCGGAATGCCTCCAAACCTAGGG + Intergenic
1177982040 21:27926584-27926606 CCCTCAAGCCTGGAAACCTGTGG - Intergenic
1178852041 21:36220790-36220812 CCGCCATGCCTGGTACTCTCTGG + Intronic
1182915151 22:34022621-34022643 CCGCCAAGGATGGAAACCTCTGG + Intergenic
952404866 3:32996899-32996921 CAGGGATGCAGGGAAACCTCAGG + Exonic
956053426 3:65273754-65273776 CATGAATGCCTGGAAACCACTGG - Intergenic
959169771 3:102830596-102830618 CCTGCATGCAGGGGAACCTCAGG + Intergenic
961501469 3:127338617-127338639 CCCGCATGCCTGGCAGCCTGTGG - Intergenic
962389297 3:134958131-134958153 CCTTCATGCCTGGAAACCCAGGG + Intronic
963102780 3:141622445-141622467 CCCTCAAGCCTGGAAACCTGCGG + Intergenic
964733052 3:159887664-159887686 CTGGCATGCATGGAAGGCTCAGG + Intronic
967803344 3:193689374-193689396 CTACCATGCCTTGAAACCTCAGG - Intronic
968091732 3:195902239-195902261 CTGGCAGCCCCGGAAACCTCTGG + Intronic
968890605 4:3366676-3366698 CAGGCATGGCCGGAAAGCTCAGG + Intronic
970108308 4:12609730-12609752 CCGGCAGGCCTGCAAGCCCCGGG + Intergenic
977254637 4:94727367-94727389 CCCTCAAGCCTGGAAACCTGTGG + Intergenic
977569565 4:98615288-98615310 CACACAAGCCTGGAAACCTCAGG + Intronic
983810246 4:172051769-172051791 CCTGCAAGCCTGGAAACCCATGG - Intronic
984718867 4:182951958-182951980 CCCCCAAGCCTGGAAACCTATGG - Intergenic
989265690 5:39470967-39470989 CAGCCATGTTTGGAAACCTCTGG + Intergenic
991087404 5:62660767-62660789 CCCTCAGGCCTGGAAACCTGCGG + Intergenic
991246485 5:64513722-64513744 CTGGCATGCCTGCCAACCACAGG - Intronic
991526112 5:67559950-67559972 CCGGCATAGCAGGAAACCTTTGG - Intergenic
991958410 5:72018249-72018271 CCAGCATGCATGGAAACATCTGG + Intergenic
996780256 5:127178242-127178264 CCGGCAGGCCTGGAGATCTTTGG + Intergenic
997614011 5:135233913-135233935 CCTTCATCCCTGGAAAGCTCTGG + Intronic
998169964 5:139866888-139866910 CCGGCAAGGCTGGATACCTAAGG + Intronic
1000338841 5:160261553-160261575 CCTGCATGGCTGGAAATCCCAGG + Intronic
1003230987 6:4253698-4253720 CTGGCAAGCCTGGAAAACTGTGG - Intergenic
1004369303 6:15038402-15038424 CCGGAATGACTGGAATCCCCAGG + Intergenic
1007695011 6:43726300-43726322 CCTGCATCCCTGGAACCCACTGG - Intergenic
1012945407 6:105460877-105460899 CCCTCAAGCCTGGAAACCTGTGG + Intergenic
1018565811 6:165151504-165151526 AAGGCATGCCTGCAAACTTCAGG + Intergenic
1018746385 6:166765267-166765289 CCTGCAGCCCTGGAAACATCTGG - Intronic
1022112079 7:27238104-27238126 CCTGCATGGCTGGAAGGCTCAGG - Intergenic
1022374482 7:29801091-29801113 CCCTCAAGCCTGGAAACCTGCGG + Intergenic
1023991815 7:45133119-45133141 ATGGCATTCCTGGAACCCTCTGG - Intergenic
1024226435 7:47329506-47329528 ACGGCTTGCCTGGGACCCTCAGG + Intronic
1024797753 7:53038130-53038152 CCGCCATGGCTGGAAGCTTCCGG - Intergenic
1026562142 7:71458958-71458980 CCCTCAAGCCTGGAAACCTGTGG - Intronic
1026737633 7:72959237-72959259 TCGGCTTGCCTGGCAAACTCGGG + Intergenic
1026788666 7:73318033-73318055 TCGGCTTGCCTGGCAAACTCAGG + Intronic
1027106100 7:75405831-75405853 TCGGCTTGCCTGGCAAACTCGGG - Intronic
1029134900 7:98362986-98363008 CAGGCCTGCCTGGAAACTTCTGG + Intronic
1031379755 7:121071202-121071224 TCGGCAAGGTTGGAAACCTCTGG + Intronic
1035048596 7:155984897-155984919 GCTGCATGCCTGGGGACCTCTGG - Intergenic
1035370291 7:158375588-158375610 CCCTCAAGCCTGGAAACCTGTGG + Intronic
1035458058 7:159022462-159022484 CCGTCATGCATGTAAACCGCGGG + Intergenic
1039306379 8:36267640-36267662 CCCTCAAGCCTGGAAACCTGTGG - Intergenic
1039339104 8:36627224-36627246 CCACCATGCCTGGAAACAGCTGG + Intergenic
1040292653 8:46133325-46133347 CCAGCCTGCCTGGGAACCCCTGG + Intergenic
1045362687 8:101447892-101447914 CTGCCATGACTGGGAACCTCTGG - Intergenic
1049600831 8:143506831-143506853 GCCTCAGGCCTGGAAACCTCTGG + Intronic
1053357023 9:37455029-37455051 CCCTCAAGCCTGGAAACCTGTGG + Intronic
1057817828 9:98308681-98308703 AAGGCATGCCTGGAACCATCAGG + Intronic
1058093808 9:100836712-100836734 CCCTCAAGCCTGGAAACCTGTGG + Intergenic
1058115560 9:101080670-101080692 CCTGCATGTCTGCCAACCTCCGG + Intronic
1059256484 9:112935762-112935784 CCTGCTTCCCTGGAATCCTCTGG - Intergenic
1185670763 X:1807604-1807626 CTGGGATGCCTGGAAGCCTGTGG + Intergenic
1186056523 X:5655008-5655030 CCCTCAAGCCTGGAAACCTGTGG - Intergenic
1186141129 X:6575073-6575095 CCGGCTTGCCTTTAAAACTCAGG + Intergenic
1187144586 X:16625978-16626000 CCCTCAAGCCTGGAAACCTGTGG - Intronic
1191690356 X:63932850-63932872 CTGGCCTGGCTGGACACCTCAGG + Intergenic
1192785693 X:74332922-74332944 CTGGCATGTCTAGGAACCTCAGG - Intergenic
1194721312 X:97343379-97343401 CCACCATGCCTGGATTCCTCTGG - Intronic
1197253700 X:124240635-124240657 AAGAGATGCCTGGAAACCTCTGG - Intronic
1198939011 X:141932096-141932118 CCAGCAAGCCTCGCAACCTCAGG - Intergenic
1200509686 Y:4061444-4061466 CCCTCAAGCCTGGAAACCTGTGG - Intergenic