ID: 1128313576

View in Genome Browser
Species Human (GRCh38)
Location 15:66646484-66646506
Sequence AACCTCAGGCTGAAGCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1245
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 1199}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128313566_1128313576 24 Left 1128313566 15:66646437-66646459 CCCCTGGGATAGTGGTCAGTGCG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1128313576 15:66646484-66646506 AACCTCAGGCTGAAGCCAGCTGG 0: 1
1: 0
2: 4
3: 41
4: 1199
1128313567_1128313576 23 Left 1128313567 15:66646438-66646460 CCCTGGGATAGTGGTCAGTGCGT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1128313576 15:66646484-66646506 AACCTCAGGCTGAAGCCAGCTGG 0: 1
1: 0
2: 4
3: 41
4: 1199
1128313568_1128313576 22 Left 1128313568 15:66646439-66646461 CCTGGGATAGTGGTCAGTGCGTG 0: 1
1: 0
2: 0
3: 31
4: 850
Right 1128313576 15:66646484-66646506 AACCTCAGGCTGAAGCCAGCTGG 0: 1
1: 0
2: 4
3: 41
4: 1199
1128313573_1128313576 -9 Left 1128313573 15:66646470-66646492 CCGGCATGCCTGGAAACCTCAGG 0: 1
1: 0
2: 1
3: 15
4: 255
Right 1128313576 15:66646484-66646506 AACCTCAGGCTGAAGCCAGCTGG 0: 1
1: 0
2: 4
3: 41
4: 1199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128313576 Original CRISPR AACCTCAGGCTGAAGCCAGC TGG Intronic
900113192 1:1018237-1018259 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
900708707 1:4097157-4097179 AACCCCAGCTTGAAGCCAGGTGG - Intergenic
901045904 1:6395699-6395721 ACCCACTGGGTGAAGCCAGCTGG - Intergenic
901601392 1:10426285-10426307 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
901846320 1:11984990-11985012 AACCCCAGCCTGAAGCCAGTCGG + Intronic
902033525 1:13439682-13439704 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
902100347 1:13983088-13983110 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
902768321 1:18631292-18631314 AACTTCTGGCCGAGGCCAGCCGG + Exonic
903257552 1:22113038-22113060 AACCTAAGGCTTCAGCCTGCTGG - Intergenic
903460484 1:23517179-23517201 TACCTCCCGCTGAAGCCAGTTGG + Intronic
903519078 1:23933839-23933861 AACCCCAGCTTGAAGCCAGTCGG - Intergenic
904238811 1:29131069-29131091 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
904255488 1:29251879-29251901 CAGCTCAAGCTGAAGTCAGCTGG + Intronic
904611910 1:31730734-31730756 AATCACAGGCTGCAGCCAGGAGG - Intronic
905150290 1:35921777-35921799 CACCCCATGCTGTAGCCAGCAGG - Exonic
905742975 1:40388287-40388309 ATCCACTGGATGAAGCCAGCTGG + Intronic
906083057 1:43107288-43107310 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
907102155 1:51847303-51847325 ATCCACTGGGTGAAGCCAGCTGG - Intronic
907759429 1:57343375-57343397 ATCCACTGGGTGAAGCCAGCTGG - Intronic
907889575 1:58623865-58623887 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
907980133 1:59472520-59472542 ATCCACTGGGTGAAGCCAGCTGG + Intronic
908027671 1:59969590-59969612 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
908652437 1:66350407-66350429 AACCTCAGGATGAGGTCAGTAGG - Intronic
908888667 1:68818143-68818165 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
909318464 1:74253262-74253284 ATCCACTGGGTGAAGCCAGCTGG - Intronic
909608656 1:77531689-77531711 ATCCACTGGGTGAAGCCAGCTGG - Intronic
909759318 1:79269555-79269577 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
909820416 1:80053418-80053440 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
910034689 1:82776707-82776729 ATCCACTGGATGAAGCCAGCTGG - Intergenic
910066039 1:83151781-83151803 AACCTCTTGCTAAAGCCAACTGG + Intergenic
910622586 1:89273290-89273312 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
911001525 1:93170664-93170686 ATCCACTGGGTGAAGCCAGCTGG + Intronic
911259518 1:95669553-95669575 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
911839165 1:102659935-102659957 ACCCACTGGGTGAAGCCAGCTGG - Intergenic
912166239 1:107045203-107045225 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
913160986 1:116146479-116146501 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
913469080 1:119171940-119171962 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
913470262 1:119179459-119179481 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
913486185 1:119334140-119334162 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
913586183 1:120277808-120277830 CACCGCAGCATGAAGCCAGCCGG - Intergenic
913622003 1:120620561-120620583 CACCGCAGCATGAAGCCAGCCGG + Intergenic
914408401 1:147400633-147400655 ATCCTGTGGCTGAAGACAGCAGG + Intergenic
914568192 1:148889666-148889688 CACCGCAGCATGAAGCCAGCCGG - Exonic
914604633 1:149240583-149240605 CACCGCAGCATGAAGCCAGCCGG + Intergenic
914675733 1:149906021-149906043 GACATCACGCTGGAGCCAGCTGG + Exonic
914928138 1:151906572-151906594 ATCCACTGGGTGAAGCCAGCTGG + Intronic
915104202 1:153522212-153522234 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
915242248 1:154532014-154532036 ATCCACTGGGTGAAGCCAGCTGG - Intronic
915260144 1:154671197-154671219 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
915261314 1:154678484-154678506 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
915666024 1:157446208-157446230 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
915767086 1:158374081-158374103 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
916219946 1:162433587-162433609 ATCCACTGGATGAAGCCAGCTGG + Intergenic
916605871 1:166342785-166342807 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
916910030 1:169336999-169337021 ATCCACTGGGTGAAGCCAGCTGG - Intronic
916939105 1:169661608-169661630 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
916940144 1:169668446-169668468 ATCCACTGGGTGAAGCCAGCTGG + Intronic
916960365 1:169882546-169882568 ATCCACTGGGTGAAGCCAGCTGG + Intronic
917445332 1:175102225-175102247 ATCCACTGGGTGAAGCCAGCTGG - Intronic
918059092 1:181046264-181046286 ATCCACTGGGTGAAGCCAGCTGG + Intronic
918511938 1:185321641-185321663 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
918709024 1:187704055-187704077 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
918720914 1:187850637-187850659 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
918732225 1:188013246-188013268 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
918790050 1:188813454-188813476 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
918791961 1:188841100-188841122 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
918853132 1:189718224-189718246 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
919049705 1:192499002-192499024 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
919091986 1:192987344-192987366 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
919237096 1:194859435-194859457 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
919250910 1:195054713-195054735 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
919297695 1:195722839-195722861 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
919631025 1:199960055-199960077 AACCACTGGGTGAAGCCAGCTGG + Intergenic
920150311 1:203900674-203900696 AACCACTTGGTGAAGCCAGCTGG + Intergenic
920421502 1:205837534-205837556 AGCCTCGGGCTGGATCCAGCAGG - Intronic
920731290 1:208488363-208488385 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
920756765 1:208740113-208740135 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
920881946 1:209888873-209888895 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
921096338 1:211889845-211889867 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
921396298 1:214673072-214673094 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
921903751 1:220475593-220475615 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
921925434 1:220706858-220706880 AACATCAGGCTGGGGCCAGTAGG - Intergenic
921983595 1:221285583-221285605 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
922306897 1:224352444-224352466 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
922485504 1:225970201-225970223 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
922541829 1:226426219-226426241 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
922855874 1:228774139-228774161 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
922985958 1:229865891-229865913 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
923157161 1:231289428-231289450 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
923172525 1:231430744-231430766 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
923193376 1:231641874-231641896 ATCCACTGGGTGAAGCCAGCTGG - Intronic
923324732 1:232871369-232871391 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
923573900 1:235140729-235140751 ATCCACTGGGTGAAGCCAGCTGG + Intronic
924117605 1:240762923-240762945 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
924219157 1:241855506-241855528 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1062908493 10:1195941-1195963 AACAGCAGCCTGAAACCAGCTGG + Intronic
1063148866 10:3319739-3319761 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1063318642 10:5032444-5032466 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1063320981 10:5053070-5053092 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1063552713 10:7048265-7048287 AACAGCAGGATGAAGCCAGCAGG + Intergenic
1063769779 10:9183785-9183807 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1064449127 10:15426024-15426046 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1065441419 10:25756433-25756455 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1065743198 10:28815599-28815621 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1065752097 10:28896745-28896767 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1065841157 10:29702408-29702430 AATCTCACGCAGAACCCAGCGGG - Intronic
1065895965 10:30163247-30163269 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1065995589 10:31056255-31056277 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1066296178 10:34055950-34055972 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1066544165 10:36481923-36481945 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1066598276 10:37076398-37076420 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1066660960 10:37737764-37737786 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1067328522 10:45292694-45292716 ATCCTCAGGCTGAAGCCCTGTGG - Intergenic
1067526127 10:47039766-47039788 AACCTCAAGCTAAAGCAAGTGGG - Intergenic
1067947415 10:50698722-50698744 GAGCTCAGGCTGAAAACAGCAGG + Intergenic
1068147353 10:53088589-53088611 CACCTCAGGCTGCAACAAGCAGG + Intergenic
1068374104 10:56155559-56155581 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1068460442 10:57321911-57321933 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1068792352 10:61041049-61041071 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1068863250 10:61868078-61868100 ACCCACTGGGTGAAGCCAGCTGG + Intergenic
1068978222 10:63034024-63034046 ATCCACCGGGTGAAGCCAGCTGG + Intergenic
1069254870 10:66320215-66320237 AACAGCAGCCTAAAGCCAGCAGG - Intronic
1069601195 10:69709371-69709393 AATCACAGGGTGAAGCCAGCAGG - Intergenic
1069766228 10:70862096-70862118 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1069826903 10:71260178-71260200 GATCTCAGGCTGGAGACAGCTGG - Intronic
1069988761 10:72301038-72301060 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1070564011 10:77590206-77590228 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1070882729 10:79863709-79863731 GAGCTCAGGCTGAAAACAGCAGG + Intergenic
1070937964 10:80315836-80315858 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1070968387 10:80543649-80543671 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1070973460 10:80586309-80586331 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1071041007 10:81309000-81309022 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1071085274 10:81862610-81862632 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1071332262 10:84571631-84571653 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1071388082 10:85141835-85141857 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1071649295 10:87380011-87380033 GAGCTCAGGCTGAAAACAGCAGG + Intergenic
1071797005 10:89018579-89018601 ATCCACGGGGTGAAGCCAGCTGG - Intergenic
1071900927 10:90119755-90119777 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1071963703 10:90832100-90832122 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1073532595 10:104245607-104245629 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1073789693 10:106928030-106928052 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1073878373 10:107950971-107950993 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1074098217 10:110331901-110331923 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1074112832 10:110434478-110434500 AGCCTCTGGCTGAAGCAAGTGGG - Intergenic
1074317238 10:112370760-112370782 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1074732543 10:116393787-116393809 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1074996265 10:118760072-118760094 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1075375939 10:121978315-121978337 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1075399314 10:122150019-122150041 CTCCTCAGGCTGAAGCCAGCGGG - Intronic
1075683332 10:124347717-124347739 AAGCTGAGGCTGAAGGCATCTGG + Intergenic
1075913601 10:126147385-126147407 GACTTCATGCTGGAGCCAGCGGG + Intronic
1076261573 10:129071277-129071299 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1077201658 11:1310315-1310337 AAACTGAGGCTGAACCCCGCTGG + Intergenic
1077253402 11:1570647-1570669 TACCTCCTGCTGCAGCCAGCCGG - Intronic
1077333328 11:1992924-1992946 AACCTCAGGGTGAGGCGGGCAGG - Intergenic
1077343153 11:2034966-2034988 AACACCAGGCCGGAGCCAGCTGG - Intergenic
1077443758 11:2580774-2580796 AAGGTCAGGCTGAAGAAAGCAGG - Intronic
1077583720 11:3434910-3434932 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1077603306 11:3589115-3589137 ATCCACTGGATGAAGCCAGCTGG + Intergenic
1077674042 11:4181886-4181908 GACCTCAGGCTGTAGGCAGTGGG + Intergenic
1077764676 11:5144831-5144853 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1078023366 11:7673169-7673191 AACCTTTGGCTGTAGCCAGGAGG - Intronic
1079190903 11:18276061-18276083 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1079708602 11:23653103-23653125 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1079731674 11:23942201-23942223 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1080107420 11:28525722-28525744 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1080204505 11:29713089-29713111 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1080489959 11:32751551-32751573 AACACCAGGCGGAACCCAGCCGG - Intronic
1080557612 11:33431668-33431690 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1081126855 11:39332994-39333016 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1081136080 11:39442010-39442032 ATCCACTAGCTGAAGCCAGCTGG - Intergenic
1081196213 11:40164143-40164165 GACCTCAGTCTTAAGCCATCAGG + Intronic
1081315275 11:41623272-41623294 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1081420979 11:42874348-42874370 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1081422149 11:42881818-42881840 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1081428466 11:42950321-42950343 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1082270367 11:50163972-50163994 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1082272200 11:50183709-50183731 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1083546191 11:63550639-63550661 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1083920771 11:65780627-65780649 ACCCTCAGGCCGCAGCCACCGGG + Exonic
1084024669 11:66440703-66440725 ATCCGCTGGGTGAAGCCAGCTGG - Intronic
1084257634 11:67954041-67954063 AACCTGAGTCTGGAGCCAGGCGG - Intergenic
1084259203 11:67963658-67963680 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1085245685 11:75098643-75098665 ACCCACTGGGTGAAGCCAGCTGG + Intergenic
1085648556 11:78245775-78245797 TTCCTCAGGCTGAAGCAAGATGG - Intronic
1085671012 11:78464895-78464917 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1085689924 11:78656511-78656533 AAGCTGAGGCAGCAGCCAGCAGG - Exonic
1085863218 11:80257995-80258017 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1086034988 11:82404325-82404347 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1086087651 11:82971112-82971134 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1086168457 11:83807934-83807956 GACCTAAGGCTGGAGACAGCAGG - Intronic
1086210037 11:84308475-84308497 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1086397667 11:86433448-86433470 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1086563370 11:88195140-88195162 AACCGCAGGCTGCAGGCTGCAGG - Intergenic
1086808101 11:91269191-91269213 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1087486306 11:98763333-98763355 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1087966486 11:104422355-104422377 ATCCACTGGCTGAAGCCAGCTGG - Intergenic
1088481633 11:110300862-110300884 ATCCCCTGGGTGAAGCCAGCTGG - Intergenic
1089062042 11:115633818-115633840 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1089466324 11:118688901-118688923 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1089614525 11:119687740-119687762 AACATCAGCCTGAAGCCTGCGGG - Intronic
1089618695 11:119709838-119709860 AACCTCAGTCTCAAGCCACTTGG + Intronic
1090331078 11:125932597-125932619 ATCCTCAGGCTTCAGCCAGAGGG + Intergenic
1090776642 11:129971757-129971779 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1090782794 11:130022040-130022062 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1091201286 11:133782734-133782756 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1091233367 11:134002813-134002835 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1091248330 11:134119319-134119341 CACCCCAGGGTTAAGCCAGCAGG - Intronic
1202816308 11_KI270721v1_random:48105-48127 AACCTCAGGGTGAGGCGGGCAGG - Intergenic
1202826139 11_KI270721v1_random:90155-90177 AACACCAGGCCGGAGCCAGCTGG - Intergenic
1091402168 12:188042-188064 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1092062549 12:5563340-5563362 ACCTTCAGGCCAAAGCCAGCTGG - Exonic
1092134003 12:6132916-6132938 ACCCACTGGGTGAAGCCAGCTGG + Intergenic
1092142028 12:6190796-6190818 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1092220367 12:6708717-6708739 ATCCTCTAGGTGAAGCCAGCTGG + Intergenic
1092336756 12:7640257-7640279 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1092350436 12:7751993-7752015 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1092430517 12:8404663-8404685 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1092572340 12:9739495-9739517 ATCCACCGGGTGAAGCCAGCTGG - Intergenic
1092583755 12:9876096-9876118 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1092617066 12:10225538-10225560 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1092732538 12:11547683-11547705 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1092834145 12:12472359-12472381 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1093034585 12:14320529-14320551 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1093189485 12:16057810-16057832 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1093266357 12:17008059-17008081 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1093583169 12:20807314-20807336 AGCCTCTGGGTGAAGCCAGCTGG - Intergenic
1093653826 12:21673932-21673954 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1093700103 12:22210620-22210642 AACCTCAGCGTGCAGCCAGCTGG - Intronic
1093970288 12:25369801-25369823 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1094327640 12:29257078-29257100 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1094409918 12:30157295-30157317 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1094572100 12:31650105-31650127 AACCTGAGGCTGAAACCTGCTGG + Intronic
1094718114 12:33033856-33033878 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1094722124 12:33075737-33075759 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1094811513 12:34142960-34142982 AGCAGCAGGCTGAAGACAGCCGG + Intergenic
1095123171 12:38442384-38442406 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1095304218 12:40621047-40621069 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1095444881 12:42273633-42273655 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1095478568 12:42610872-42610894 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1095534042 12:43224715-43224737 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1095587489 12:43864335-43864357 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1095901624 12:47333816-47333838 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1096680703 12:53253398-53253420 CAGCTGAGGCTGTAGCCAGCTGG + Exonic
1096785358 12:54014263-54014285 AAGCACAGGCTGCAGGCAGCTGG + Intronic
1097017841 12:56000070-56000092 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1097213008 12:57386704-57386726 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1097664120 12:62461200-62461222 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1097865899 12:64558992-64559014 AAGGTCAGGCTGCAGCCAGAGGG - Intergenic
1097982083 12:65744749-65744771 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1098168135 12:67719157-67719179 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1098498676 12:71166125-71166147 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1098988886 12:77043293-77043315 AACCTCAGGTGGAAAGCAGCAGG + Intronic
1099191477 12:79565389-79565411 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1099204440 12:79711376-79711398 ACCCACTGGGTGAAGCCAGCTGG + Intergenic
1099228075 12:79993147-79993169 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1099450507 12:82801962-82801984 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1100166539 12:91923833-91923855 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1100211805 12:92406464-92406486 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1100716719 12:97313659-97313681 AGCCTCAGGCAGAAACCAGAAGG + Intergenic
1101009075 12:100430737-100430759 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1102309842 12:111836088-111836110 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1102771514 12:115481327-115481349 AACCTCAGGCTGAAGAGTCCAGG - Intergenic
1102998738 12:117368991-117369013 AAACTCAGGGTGAGGCCAGCAGG - Intronic
1103146066 12:118597101-118597123 ATCCACCGGGTGAAGCCAGCTGG - Intergenic
1103459587 12:121093460-121093482 ATCCACTGGCTGAAGCCAGCTGG - Intergenic
1103497633 12:121374874-121374896 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1103678638 12:122676562-122676584 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1103752362 12:123173902-123173924 AACCTCAACTTGAAGCCAGTTGG + Intronic
1103783310 12:123414038-123414060 ATCCACTGGGTGAAGCCAGCTGG - Exonic
1103853369 12:123947396-123947418 ATCCACTGGGTGAAGCCAGCCGG + Intronic
1103967144 12:124647021-124647043 AACCTCAGCCAGAGGCCGGCAGG - Intergenic
1104749324 12:131228247-131228269 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1105605088 13:21920627-21920649 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1105697150 13:22900374-22900396 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1105722251 13:23128006-23128028 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1105871071 13:24506744-24506766 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1106600479 13:31182977-31182999 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1106643352 13:31608754-31608776 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1107560476 13:41552988-41553010 AAAGTCAGGCTCAATCCAGCAGG - Intergenic
1107590383 13:41898504-41898526 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1107652653 13:42560138-42560160 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1107836196 13:44414010-44414032 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1108435426 13:50397024-50397046 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1108856460 13:54799649-54799671 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1108858878 13:54829425-54829447 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1109007841 13:56901165-56901187 AACCACTGGGTGAGGCCAGCTGG + Intergenic
1109145472 13:58773718-58773740 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1109159793 13:58958107-58958129 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1109446527 13:62447825-62447847 ATCCACAGGGTGAAGCCAGCTGG - Intergenic
1109506226 13:63306167-63306189 ATCCACAAGGTGAAGCCAGCTGG + Intergenic
1109563088 13:64077460-64077482 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1109699732 13:66009663-66009685 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1109741603 13:66561459-66561481 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1110023993 13:70511836-70511858 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1110368954 13:74718823-74718845 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1110609745 13:77475421-77475443 ATCCACTGGGTGAAGCCAGCCGG - Intergenic
1110751319 13:79119562-79119584 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1110862216 13:80355972-80355994 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1110919930 13:81070388-81070410 AACATCAGGCTGAAGCTACAGGG - Intergenic
1110940211 13:81340696-81340718 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1111286268 13:86096602-86096624 AAATTCAGGCAGAAGTCAGCTGG - Intergenic
1111747752 13:92291280-92291302 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1111841331 13:93454711-93454733 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1112282620 13:98076260-98076282 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1112518724 13:100077951-100077973 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1112533087 13:100223974-100223996 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1112613182 13:100976131-100976153 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1112842766 13:103600374-103600396 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1113211496 13:107987490-107987512 ATCCTGAGGCTGAAGCCCACTGG + Intergenic
1113482605 13:110632954-110632976 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1114559802 14:23581193-23581215 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1114616662 14:24072116-24072138 AGCCTCGGGCTGAAGCAGGCAGG - Intronic
1115124277 14:29973091-29973113 GACACCAGGCTGATGCCAGCTGG - Intronic
1115675976 14:35675082-35675104 AACCTCAGGCTAAAGGCAGATGG + Intronic
1116250951 14:42482310-42482332 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1116390607 14:44385177-44385199 ATCCACTGGGTGAAGCCAGCCGG + Intergenic
1116426669 14:44799122-44799144 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1116452443 14:45080871-45080893 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1116657061 14:47665996-47666018 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1117077948 14:52122680-52122702 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1117297642 14:54393875-54393897 ATCCGCTGGGTGAAGCCAGCTGG + Intergenic
1117449890 14:55839902-55839924 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1118306391 14:64658563-64658585 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1118743208 14:68756135-68756157 CAACACAGCCTGAAGCCAGCAGG - Intergenic
1119027852 14:71167928-71167950 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1119300242 14:73566258-73566280 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1119303611 14:73590403-73590425 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1119562871 14:75605009-75605031 AACCTGAGACTGAAGGAAGCGGG + Intronic
1120229684 14:81829390-81829412 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1120439026 14:84512833-84512855 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1120844240 14:89112083-89112105 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1122216446 14:100208091-100208113 AGCCACTGGGTGAAGCCAGCTGG - Intergenic
1123019959 14:105393032-105393054 AGCCTCAGGCGGAGGCCAGCTGG + Intronic
1123676696 15:22715737-22715759 AGCCTCGGGCTAAACCCAGCTGG - Intergenic
1123707436 15:22960153-22960175 GACCTCAGGCTGGAGGCAGTAGG - Intronic
1123799221 15:23803349-23803371 ATCCGCTGGGTGAAGCCAGCTGG + Intergenic
1124036436 15:26057308-26057330 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1124110536 15:26781594-26781616 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1124114771 15:26831104-26831126 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1124328911 15:28790000-28790022 AGCCTCGGGCTAAACCCAGCTGG - Intergenic
1124380289 15:29159858-29159880 ATCCACCGGGTGAAGCCAGCTGG - Intronic
1124387775 15:29224719-29224741 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1124633310 15:31349533-31349555 AACCACAGGCTGGCACCAGCTGG - Intronic
1124818396 15:33019411-33019433 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1125112297 15:36047388-36047410 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1125914475 15:43473797-43473819 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1126089072 15:45035270-45035292 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1126128166 15:45314533-45314555 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1126663338 15:51053431-51053453 AAACTCAGACTGAAGCCAGATGG + Intergenic
1126668488 15:51094909-51094931 AACCCCAGCCTGGAGCCCGCCGG - Intronic
1127211676 15:56780082-56780104 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1127765987 15:62186489-62186511 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1127984862 15:64061321-64061343 ATCCACTGGATGAAGCCAGCTGG + Intronic
1128128884 15:65212305-65212327 AACCTCATGCTGGGGCCAGGGGG - Intergenic
1128313576 15:66646484-66646506 AACCTCAGGCTGAAGCCAGCTGG + Intronic
1128594027 15:68928880-68928902 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1128669905 15:69567283-69567305 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1128715025 15:69901521-69901543 CCCCTCAGGCTTCAGCCAGCAGG + Intergenic
1128813228 15:70587099-70587121 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1129158185 15:73732110-73732132 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1129197003 15:73974144-73974166 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1129208713 15:74052935-74052957 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1129986971 15:79926510-79926532 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1129997223 15:80016913-80016935 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1130132947 15:81159057-81159079 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1130136892 15:81189030-81189052 AAGCCCAGGCTTAAGCCAGGAGG - Intronic
1130685303 15:86031929-86031951 AACCTCAGGCAGAGGGCAGCAGG - Intergenic
1131250327 15:90825908-90825930 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1131472757 15:92711010-92711032 ATCCACGGGGTGAAGCCAGCTGG - Intronic
1131846030 15:96491757-96491779 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1132097778 15:99000439-99000461 ATCCACAGGGTAAAGCCAGCTGG + Intronic
1132098798 15:99008201-99008223 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1132511096 16:341679-341701 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1132836734 16:1958125-1958147 ATCCACCGGGTGAAGCCAGCTGG - Intergenic
1132997304 16:2829971-2829993 ACCCTCAGGTGGAAGCCATCAGG + Intergenic
1133362577 16:5186289-5186311 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1133367454 16:5221935-5221957 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1134022218 16:10929176-10929198 AGCCTCGGGCTAAACCCAGCTGG + Exonic
1135113743 16:19709438-19709460 ATCCTCAGGCTGCGGCCTGCAGG + Intronic
1135280939 16:21153033-21153055 AGCCACTGGGTGAAGCCAGCTGG + Intronic
1135470141 16:22722917-22722939 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1135622598 16:23968589-23968611 ACCCACTGGCTGAACCCAGCTGG + Intronic
1135919379 16:26634805-26634827 TACCTCAGGCTCTAGCCAGGGGG + Intergenic
1135942621 16:26836024-26836046 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1136163377 16:28435804-28435826 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1136199586 16:28679183-28679205 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1136215932 16:28793356-28793378 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1136984495 16:35085871-35085893 AACCTCAGGCTGTATCTACCTGG - Intergenic
1138036414 16:53611532-53611554 ATCCGCAGGCTGACGCCTGCTGG + Intronic
1138300168 16:55919385-55919407 GACCTCAGGCTTTAACCAGCAGG - Intronic
1138688866 16:58749292-58749314 ATCCACTGGATGAAGCCAGCTGG + Intergenic
1138693522 16:58790694-58790716 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1138725029 16:59126821-59126843 ATGCTCGGGCTGAAGCCAACAGG + Intergenic
1139000573 16:62505655-62505677 AACCTCTGCCTAAAGCCAGGAGG + Intergenic
1139147818 16:64344328-64344350 ATCCACGGGGTGAAGCCAGCTGG + Intergenic
1139205423 16:65023979-65024001 AACCTGAGTCTGAAACCTGCTGG - Intronic
1139442385 16:66974664-66974686 ATCCACTGGGTGAAGCCAGCTGG + Exonic
1139600363 16:67982658-67982680 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1139676489 16:68527136-68527158 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1140473994 16:75229507-75229529 ACCCTCAGGCGGCTGCCAGCTGG + Exonic
1143283445 17:5771652-5771674 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1143664196 17:8347043-8347065 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1143708572 17:8718002-8718024 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1144128162 17:12221298-12221320 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1144578449 17:16444335-16444357 TACCTCAGGCTACGGCCAGCTGG - Intronic
1144804597 17:17956421-17956443 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1145094914 17:20016860-20016882 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1146740380 17:35278838-35278860 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1146809788 17:35894012-35894034 AACCCCAACTTGAAGCCAGCTGG - Intergenic
1147373702 17:40011370-40011392 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1147997613 17:44369239-44369261 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1148023450 17:44568620-44568642 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1148321548 17:46758471-46758493 AACCTAAGGCAGCAGCTAGCTGG - Intergenic
1148366099 17:47057209-47057231 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1148582236 17:48752212-48752234 AAGCTCAGGCAGACGCCAGCCGG + Intergenic
1148632193 17:49119829-49119851 AGGGTCAGGCTGAAGTCAGCTGG + Intergenic
1148755857 17:49972579-49972601 AGCCTCCGGCTGCGGCCAGCGGG - Intronic
1149099182 17:52883900-52883922 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1149754051 17:59172955-59172977 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1150174863 17:63042412-63042434 AGAGTCAGGCTGAAGGCAGCTGG + Intronic
1150666862 17:67148084-67148106 ACCCTCAACTTGAAGCCAGCCGG + Intronic
1150682585 17:67295146-67295168 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1150772357 17:68052307-68052329 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1150775894 17:68081050-68081072 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1150778359 17:68099716-68099738 ATCCACTGGATGAAGCCAGCTGG + Intergenic
1150792313 17:68208249-68208271 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1150804531 17:68308837-68308859 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1151866511 17:76806550-76806572 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1153070466 18:1098667-1098689 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1154057157 18:11023574-11023596 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1154128680 18:11716871-11716893 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1154334860 18:13457167-13457189 AACCCCAACCTGAAGCCAGTCGG - Intronic
1154942894 18:21132462-21132484 ATCCACTGGATGAAGCCAGCAGG - Intergenic
1155271877 18:24149476-24149498 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1155294954 18:24376504-24376526 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1155349228 18:24890185-24890207 GACCTCTGGCTGGAGACAGCTGG + Intergenic
1155441085 18:25863360-25863382 AACCTCAGTCAGAATGCAGCAGG - Intergenic
1155611634 18:27673813-27673835 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1155678273 18:28457524-28457546 TACCCTAAGCTGAAGCCAGCCGG + Intergenic
1155806222 18:30175019-30175041 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1155952768 18:31931423-31931445 CACCTCAGCCTGGAGCCATCCGG - Exonic
1155976850 18:32140257-32140279 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1156038751 18:32795009-32795031 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1156079573 18:33316593-33316615 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1156943247 18:42795665-42795687 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1156969754 18:43139955-43139977 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1157856827 18:51111768-51111790 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1158352002 18:56572726-56572748 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1158409600 18:57193685-57193707 AACCCCAGGCTGAAGACTGAAGG - Intergenic
1158460659 18:57643584-57643606 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1159167875 18:64725564-64725586 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1159472866 18:68879920-68879942 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1159649326 18:70958752-70958774 ACCCTCAGGCTGAAGGCAATAGG - Intergenic
1159744038 18:72209563-72209585 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1159909074 18:74126723-74126745 CACCTCAGGCACAAGCCAGCAGG + Intronic
1160256815 18:77254100-77254122 ATCCCCAGGATGTAGCCAGCAGG + Intronic
1160952348 19:1673837-1673859 AACCTCTGGCTGAGGCCAGCTGG - Intergenic
1162230225 19:9259949-9259971 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1162233027 19:9283377-9283399 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1162237828 19:9322032-9322054 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1162261979 19:9541251-9541273 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1163181647 19:15608571-15608593 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1163218930 19:15900119-15900141 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1163360681 19:16844172-16844194 AACCTGAGGCTGGAGTCACCAGG - Intronic
1163583252 19:18150706-18150728 TTCTCCAGGCTGAAGCCAGCAGG - Exonic
1164270513 19:23668452-23668474 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1164975873 19:32572020-32572042 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1165036460 19:33037037-33037059 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1165415455 19:35691021-35691043 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1166014060 19:39966817-39966839 AACCGCAGGCTGAAACCCTCCGG + Intergenic
1166210894 19:41305970-41305992 AACGCCAGGCCGAGGCCAGCAGG - Intronic
1166486934 19:43221846-43221868 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1168369313 19:55818892-55818914 AACTTGAGTCTGAAGCCAGTGGG - Intronic
1168659967 19:58157742-58157764 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
924964856 2:66520-66542 AACCTCAGACTGCAGGCAGAGGG + Intergenic
924967451 2:91425-91447 TACCACTGGGTGAAGCCAGCTGG + Intergenic
925098896 2:1229523-1229545 ATCCACTGGGTGAAGCCAGCTGG - Intronic
925213363 2:2070490-2070512 AACCTCAGTATCAAGCCAGAAGG - Intronic
925537730 2:4935239-4935261 ATCCACTGGGTGAAGCCAGCCGG - Intergenic
925777403 2:7348435-7348457 AACCCCAGGCTGGAGGAAGCAGG - Intergenic
926097568 2:10091853-10091875 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
926616552 2:15002459-15002481 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
926850727 2:17193947-17193969 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
927777873 2:25915897-25915919 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
927900483 2:26814795-26814817 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
928106432 2:28473067-28473089 ATCCACTGGGTGAAGCCAGCTGG + Intronic
928337727 2:30412484-30412506 AATCTCAGCCTGAAAGCAGCTGG + Intergenic
928493145 2:31804075-31804097 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
928617865 2:33057351-33057373 ACCCACTGGGTGAAGCCAGCTGG - Intronic
928936980 2:36688696-36688718 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
929379767 2:41336026-41336048 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
929890787 2:45917595-45917617 ATCCACTGGGTGAAGCCAGCTGG - Intronic
930038093 2:47100168-47100190 ATCCACTGGGTGAAGCCAGCTGG + Intronic
930039293 2:47107715-47107737 ATCCACTGGGTGAAGCCAGCTGG + Intronic
930468151 2:51780260-51780282 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
930485592 2:52007244-52007266 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
931708770 2:64969440-64969462 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
932178356 2:69622476-69622498 ATCCACTGGGTGAAGCCAGCTGG + Intronic
932240008 2:70148741-70148763 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
932840484 2:75077575-75077597 ATCCTGAGGCAGAAGCCTGCAGG + Intronic
932983418 2:76698115-76698137 AAGCACTGGATGAAGCCAGCTGG - Intergenic
933049997 2:77590908-77590930 ATCCACTGGGTGAAGCCAGCTGG + Intronic
933060762 2:77734704-77734726 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
933205760 2:79505677-79505699 AACCTCAGGCTAAAGCATGTGGG + Intronic
933442019 2:82326208-82326230 ACCCACTGGGTGAAGCCAGCTGG - Intergenic
933506392 2:83181435-83181457 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
933511388 2:83245891-83245913 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
933712081 2:85334338-85334360 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
933725844 2:85426796-85426818 AACCCCAGCTTGAAGCCAGTTGG + Intronic
933750564 2:85600159-85600181 TTCCTCAGGCTCCAGCCAGCAGG + Intronic
934085200 2:88503530-88503552 ATCCGCGGGGTGAAGCCAGCTGG + Intergenic
934725960 2:96619148-96619170 TACCTCATCCTGGAGCCAGCAGG + Intronic
934742505 2:96735300-96735322 AGCCTTTGGCTGAACCCAGCTGG - Intronic
934898573 2:98139438-98139460 ATCCACTGGGTGAAGCCAGCGGG + Intronic
935059833 2:99597709-99597731 AACCTCAGGCTGCAGACGCCAGG + Intronic
935896765 2:107747265-107747287 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
936346969 2:111682286-111682308 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
937711768 2:124987335-124987357 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
938401103 2:130991880-130991902 ATCCACTGGGTGAAGCCAGCTGG + Intronic
938725950 2:134109271-134109293 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
938931132 2:136087993-136088015 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
938933734 2:136110534-136110556 CAACTCAGCCTGCAGCCAGCTGG + Intergenic
939003206 2:136758856-136758878 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
939053139 2:137331532-137331554 ATCCACTGGGTGAAGCCAGCTGG - Intronic
939229843 2:139410777-139410799 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
939509546 2:143089522-143089544 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
939738692 2:145880828-145880850 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
939869130 2:147507365-147507387 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
939972471 2:148678325-148678347 ATCCACTGGGTGAAGCCAGCTGG - Intronic
940145585 2:150542247-150542269 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
941240167 2:163026712-163026734 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
941397849 2:164994679-164994701 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
941476510 2:165956986-165957008 AACCGCTAGGTGAAGCCAGCTGG - Intergenic
941779153 2:169426249-169426271 AACCTCATACTGAAACCAGCTGG + Intergenic
942218719 2:173748207-173748229 AACTCCAGGCTGGAGCAAGCTGG + Intergenic
942299526 2:174548516-174548538 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
942540268 2:177008286-177008308 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
942867367 2:180691823-180691845 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
943024287 2:182608832-182608854 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
943106083 2:183546603-183546625 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
943222917 2:185133038-185133060 AGCCACTGGATGAAGCCAGCTGG + Intergenic
943790110 2:191922023-191922045 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
943906045 2:193502386-193502408 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
943941375 2:194002682-194002704 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
943942802 2:194020596-194020618 ATCCACAGGGTGAAGCCAGCTGG + Intergenic
944043771 2:195385371-195385393 AAACTCAGGCTAAAACTAGCTGG - Intergenic
944058413 2:195547276-195547298 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
944228516 2:197371002-197371024 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
944482871 2:200175175-200175197 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
944729717 2:202503806-202503828 ATCCACTGGGTGAAGCCAGCTGG + Intronic
944857852 2:203785498-203785520 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
945069709 2:205977620-205977642 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
945180050 2:207082562-207082584 AACCTGAGATTGAAGCCTGCAGG - Intronic
945451417 2:210000541-210000563 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
945575394 2:211524302-211524324 ATCCACTGGGTGAAGCCAGCTGG - Intronic
945870295 2:215219498-215219520 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
945872752 2:215245665-215245687 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
946054071 2:216885659-216885681 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
946376577 2:219313212-219313234 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
946982086 2:225229373-225229395 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
947026712 2:225744569-225744591 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
947103872 2:226648447-226648469 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
947931980 2:233972393-233972415 ATCCACTGGGTGAAGCCAGCTGG - Intronic
948348067 2:237315743-237315765 AACATCAGGCTGTAACCAGCTGG - Intergenic
948449035 2:238057778-238057800 ATCCACTGGGTGAAGCCAGCTGG - Intronic
948589229 2:239038753-239038775 AAACTCAGGCTGAGCCCATCTGG + Intergenic
948802033 2:240437350-240437372 AACCTCAGGCTGGGGGCATCGGG - Intronic
1169036661 20:2458664-2458686 AACCTCAGACTGGTGCCACCAGG + Intergenic
1170230806 20:14044753-14044775 ATCCACTGGGTGAAGCCAGCGGG - Intronic
1170594458 20:17794604-17794626 AACTACTGGCGGAAGCCAGCGGG + Intergenic
1170649578 20:18227200-18227222 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1170806769 20:19639553-19639575 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1170989971 20:21292315-21292337 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1171452624 20:25247206-25247228 TCCCACAGGCTGAGGCCAGCAGG + Intergenic
1171973339 20:31578493-31578515 ATCCACAGGGTGAAGCCAGCCGG - Intergenic
1172431773 20:34898726-34898748 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1172441440 20:34969180-34969202 GACCTCAGGCTGAAGGCAGTGGG + Intergenic
1172876602 20:38168190-38168212 AACCCCAGGATGTGGCCAGCCGG + Intergenic
1174275080 20:49397790-49397812 AAGGTCAGGCTAAAGCCAGCAGG - Intronic
1174549496 20:51351737-51351759 AAACTCAGTCTGAAGCCCACGGG + Intergenic
1175210150 20:57348833-57348855 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1175254229 20:57629224-57629246 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1176078289 20:63259162-63259184 AAGCCTGGGCTGAAGCCAGCTGG - Intronic
1176114651 20:63426332-63426354 AGCCTCATGCTGAAGGCACCAGG - Intronic
1176332225 21:5559576-5559598 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1176344759 21:5733433-5733455 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1176351573 21:5854017-5854039 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1176395532 21:6261375-6261397 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1176441625 21:6727729-6727751 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1176465887 21:7054798-7054820 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1176489448 21:7436576-7436598 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1176500068 21:7591022-7591044 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1176539080 21:8131503-8131525 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1176558031 21:8314548-8314570 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1176872172 21:14092890-14092912 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1177182312 21:17757512-17757534 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1177565752 21:22818783-22818805 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1177637696 21:23807451-23807473 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1177795969 21:25778750-25778772 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1178082161 21:29077120-29077142 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1179050966 21:37888316-37888338 AACCACAGGCTGAAGCTAATTGG + Intronic
1180138607 21:45877211-45877233 AACCTAGGCCTGGAGCCAGCTGG + Intronic
1180193541 21:46180844-46180866 AGCCTCAACCTGAGGCCAGCAGG - Intronic
1180755167 22:18155923-18155945 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1181036531 22:20172336-20172358 AACCTCAGCAGGAAGCAAGCAGG - Intergenic
1181077595 22:20392335-20392357 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1181450464 22:23016977-23016999 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1181713599 22:24707351-24707373 ATCTCCAGACTGAAGCCAGCAGG + Intergenic
1181953885 22:26574380-26574402 AAGCTCATGCATAAGCCAGCTGG + Intronic
1182337962 22:29597990-29598012 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1182974949 22:34614783-34614805 AACCCAAGACTGAATCCAGCTGG + Intergenic
1183422041 22:37717765-37717787 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1183498279 22:38162960-38162982 AACCCCAGGCTGAAGCCACCTGG + Intronic
1184349839 22:43936341-43936363 AACTTCAGGCTGAAGAGACCAGG - Intronic
1184584333 22:45437164-45437186 ATCCACTGGATGAAGCCAGCTGG + Intergenic
1184851900 22:47125815-47125837 AACCCCAGCCTGAGCCCAGCTGG + Intronic
1184906169 22:47488231-47488253 ATCCACTGGATGAAGCCAGCTGG - Intergenic
1185012341 22:48321224-48321246 GACCTGAGCCTGAAGCCATCGGG + Intergenic
1203244030 22_KI270733v1_random:47858-47880 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
949259059 3:2084063-2084085 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
949770078 3:7569028-7569050 ATCCACTGGATGAAGCCAGCTGG + Intronic
950068880 3:10136361-10136383 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
950207962 3:11094435-11094457 ATCCACTGGATGAAGCCAGCTGG + Intergenic
950256885 3:11513170-11513192 ATCCACTGGGTGAAGCCAGCTGG - Intronic
950400889 3:12768717-12768739 ATCCACTGGGTGAAGCCAGCTGG - Intronic
950418629 3:12883285-12883307 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
950568095 3:13783311-13783333 AAGCCCCTGCTGAAGCCAGCTGG + Intergenic
950632718 3:14293607-14293629 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
950780046 3:15383775-15383797 AAGCTGAGTCTTAAGCCAGCAGG + Exonic
950929473 3:16774152-16774174 ATCCACTGGATGAAGCCAGCTGG + Intergenic
951024774 3:17817597-17817619 ATCCACTGGGTGAAGCCAGCTGG - Intronic
951332878 3:21387176-21387198 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
951734860 3:25852145-25852167 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
952058011 3:29473429-29473451 ATCCACTGGGTGAAGCCAGCTGG - Intronic
952275329 3:31870551-31870573 ATCCACTGGGTGAAGCCAGCTGG + Intronic
952355458 3:32579150-32579172 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
952360552 3:32626070-32626092 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
952393792 3:32903247-32903269 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
952593721 3:34988813-34988835 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
952713392 3:36453738-36453760 ATCCACTGGGTGAAGCCAGCTGG + Intronic
952890481 3:38037082-38037104 AACCTTAGCCTGGAGCCAGAGGG + Intergenic
952947664 3:38490266-38490288 AGCAGCAGCCTGAAGCCAGCGGG - Exonic
953124424 3:40077833-40077855 ATCCACTGGGTGAAGCCAGCTGG - Intronic
953522417 3:43656351-43656373 ATCCACTGGGTGAAGCCAGCTGG - Intronic
953673991 3:44986041-44986063 ATCCACTGGTTGAAGCCAGCCGG - Intronic
953714698 3:45307123-45307145 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
953882437 3:46697642-46697664 AACCCCAGCGTGAAGCCAGTTGG + Intergenic
954226125 3:49182589-49182611 ATCCACTGGGTGAAGCCAGCTGG - Intronic
954620217 3:51991008-51991030 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
954627071 3:52028449-52028471 CCCATCAGGCTGAAGCCAGGAGG + Intergenic
955183435 3:56692316-56692338 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
956392123 3:68785237-68785259 ATCCACTGGGTGAAGCCAGCTGG - Intronic
956563705 3:70612249-70612271 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
957009105 3:74985050-74985072 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
957074158 3:75588190-75588212 ATCCACTGGGTGAAGCCAGCGGG + Intergenic
957277549 3:78108824-78108846 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
957371565 3:79300652-79300674 ATCCACTGGGTGAAGCCAGCTGG + Intronic
957419581 3:79951295-79951317 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
957631020 3:82715766-82715788 ATCCACGGGGTGAAGCCAGCTGG + Intergenic
957804823 3:85133785-85133807 ATCCACTGGGTGAAGCCAGCTGG - Intronic
957919601 3:86731435-86731457 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
957921902 3:86758035-86758057 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
958022720 3:88016124-88016146 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
958476671 3:94592587-94592609 AAGCTCTGGCTGATGCTAGCAGG - Intergenic
959422815 3:106149069-106149091 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
960149719 3:114238214-114238236 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
960199330 3:114812621-114812643 ATCCACTGGGTGAAGCCAGCTGG - Intronic
960227455 3:115184813-115184835 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
960685566 3:120290105-120290127 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
961438702 3:126937746-126937768 ATCCTCAGGCTGACCACAGCAGG + Intronic
961461924 3:127056195-127056217 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
961464974 3:127076209-127076231 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
961746640 3:129068232-129068254 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
961867081 3:129961379-129961401 ATCCACTGGCTGTAGCCAGCCGG + Intergenic
961874460 3:130011029-130011051 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
962383686 3:134916280-134916302 ATCCACTGGGTGAAGCCAGCTGG - Intronic
962590993 3:136889925-136889947 ATCCACTGGGTGAAGCCAGCTGG - Intronic
962600420 3:136987512-136987534 ATCCACTGGGTGAAGCCAGCTGG - Intronic
962998211 3:140651827-140651849 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
963307692 3:143671809-143671831 TACCTCCCACTGAAGCCAGCAGG - Intronic
963397294 3:144750244-144750266 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
963440489 3:145333813-145333835 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
963533335 3:146497723-146497745 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
963673431 3:148280490-148280512 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
963742843 3:149097645-149097667 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
963744233 3:149109792-149109814 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
963760670 3:149284422-149284444 ATCCACCGGGTGAAGCCAGCTGG + Intergenic
963862258 3:150323406-150323428 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
964014463 3:151928592-151928614 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
964032405 3:152152855-152152877 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
964037615 3:152217737-152217759 ATCCACTGGGTGAAGCCAGCGGG + Intergenic
964117894 3:153155673-153155695 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
964198218 3:154088407-154088429 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
964444082 3:156741013-156741035 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
964982428 3:162702845-162702867 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
964983076 3:162710432-162710454 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
965003599 3:162987755-162987777 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
965040377 3:163499460-163499482 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
965044057 3:163552247-163552269 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
965078076 3:164003404-164003426 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
965200268 3:165649241-165649263 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
965220819 3:165924261-165924283 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
965245162 3:166258392-166258414 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
965256857 3:166424368-166424390 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
965288123 3:166843247-166843269 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
965298207 3:166976269-166976291 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
965446543 3:168780544-168780566 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
965837451 3:172867218-172867240 ATCCACTGGCTGAAGCCAGCTGG + Intergenic
966079850 3:175987871-175987893 AGCCTTAGACTGAAGCCTGCAGG + Intergenic
966096705 3:176213340-176213362 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
966190933 3:177271652-177271674 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
966372350 3:179262978-179263000 ATCCACTGGGTGAAGCCAGCTGG - Intronic
967234022 3:187367500-187367522 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
967499072 3:190176973-190176995 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
967718437 3:192789468-192789490 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
968412732 4:403924-403946 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
968433509 4:573346-573368 AAGCCCAGCCAGAAGCCAGCAGG + Intergenic
968469749 4:773964-773986 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
968510438 4:993184-993206 ACCCTCAGGCTCAAGGCAGGTGG - Intronic
968716239 4:2161704-2161726 ATCCGCTGGGTGAAGCCAGCTGG + Intronic
969017776 4:4115790-4115812 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
969032529 4:4226399-4226421 AGCCTCAGGATGCAGCCAGCGGG + Intronic
969272463 4:6112096-6112118 ATCCTCAGGCTGAATTCAGCAGG - Intronic
969440820 4:7215565-7215587 ATCCACTGGGTGAAGCCAGCTGG + Intronic
969514121 4:7637095-7637117 CATCTCAGGATGAAGCCATCTGG - Intronic
969719327 4:8884721-8884743 CCCTTCAGGCTGAAACCAGCTGG + Intergenic
969736216 4:8992822-8992844 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
969795415 4:9524385-9524407 ATCCACTGGATGAAGCCAGCTGG - Intergenic
970051318 4:11918070-11918092 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
970073834 4:12195381-12195403 GAGCTGAGGCTGAAGCCAGAGGG + Intergenic
970182668 4:13415819-13415841 ATCCACTGGGTGAAGCCAGCTGG + Intronic
970272189 4:14359049-14359071 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
970391295 4:15615350-15615372 ATCCACTGGGTGAAGCCAGCTGG + Intronic
970576789 4:17436484-17436506 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
970649243 4:18159194-18159216 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
970673084 4:18418261-18418283 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
970721866 4:18997476-18997498 ATCCTCAGGCTGCACACAGCAGG + Intergenic
970803612 4:20004451-20004473 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
970817805 4:20178935-20178957 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
971280452 4:25239166-25239188 ATCCACTGGGTGAAGCCAGCTGG - Intronic
971281602 4:25246548-25246570 ATCCACTGGGTGAAGCCAGCTGG - Intronic
971563639 4:28113212-28113234 ATCCACTGGGTGAAGCCAGCGGG + Intergenic
971639902 4:29117790-29117812 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
971709539 4:30093143-30093165 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
972306533 4:37835772-37835794 AACCTGGGGCTGATGCCACCGGG - Intronic
972392634 4:38627339-38627361 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
973037181 4:45420587-45420609 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
973048657 4:45567489-45567511 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
973146404 4:46831484-46831506 ATCCACTGGGTGAAGCCAGCTGG + Intronic
973190235 4:47377967-47377989 ATCCACTGGATGAAGCCAGCTGG - Intronic
973587682 4:52409669-52409691 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
973765017 4:54155049-54155071 ATCCACTGGGTGAAGCCAGCTGG - Intronic
973854184 4:54993906-54993928 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
973878192 4:55241891-55241913 ATCCACTGGATGAAGCCAGCTGG + Intergenic
974147499 4:57965861-57965883 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
974484706 4:62491821-62491843 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
974590509 4:63942806-63942828 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
974781661 4:66561416-66561438 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
974827839 4:67152316-67152338 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
974892217 4:67896489-67896511 AGCCACTGGGTGAAGCCAGCTGG - Intergenic
974992793 4:69115164-69115186 ATCCACTGGGTGAAGCCAGCTGG - Intronic
975055479 4:69924327-69924349 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
975298890 4:72766292-72766314 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
975439868 4:74398989-74399011 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
975745019 4:77466779-77466801 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
975755946 4:77571099-77571121 ATCCACTGGGTGAAGCCAGCTGG + Intronic
975995006 4:80303230-80303252 AGCCACTGGGTGAAGCCAGCTGG + Intronic
976406461 4:84665135-84665157 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
976565601 4:86547680-86547702 ATCCACTGGGTGAAGCCAGCTGG + Intronic
976736225 4:88313127-88313149 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
977470619 4:97438006-97438028 ATCCACTGGGTGAAGCCAGCTGG - Intronic
977507770 4:97923457-97923479 ATCCACTGGATGAAGCCAGCTGG + Intronic
977606839 4:98993405-98993427 AACCACTGGGTGTAGCCAGCTGG - Intergenic
977717270 4:100196444-100196466 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
978207116 4:106092323-106092345 ATCCACTGGGTGAAGCCAGCTGG - Intronic
978241805 4:106525268-106525290 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
978285662 4:107073630-107073652 ATCCACCGGATGAAGCCAGCTGG + Intronic
978463543 4:108984315-108984337 ATCCACTGGGTGAAGCCAGCTGG - Intronic
978482336 4:109207453-109207475 AACCTCAGGGACAAGCCATCAGG - Intronic
978917899 4:114148504-114148526 ATCCACTGGGTGAAGCCAGCGGG - Intergenic
978999499 4:115200118-115200140 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
979290738 4:118976974-118976996 ATCCTCTAGGTGAAGCCAGCTGG - Intronic
979308400 4:119174222-119174244 ATCCTCTAGGTGAAGCCAGCTGG + Intronic
979445606 4:120808535-120808557 ATCCACTGGGTGAAGCCAGCTGG - Intronic
979688673 4:123538353-123538375 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
979825625 4:125229506-125229528 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
979899625 4:126201215-126201237 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
980115284 4:128673055-128673077 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
980739339 4:136929431-136929453 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
980774575 4:137421456-137421478 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
980815637 4:137942507-137942529 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
980824033 4:138052870-138052892 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
980827248 4:138088516-138088538 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
981169486 4:141605357-141605379 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
982647742 4:158044563-158044585 ATCCCCTGGGTGAAGCCAGCTGG + Intergenic
982728265 4:158928138-158928160 ATCCACTGGATGAAGCCAGCTGG + Intronic
982814500 4:159868956-159868978 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
982863471 4:160482204-160482226 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
982921350 4:161277663-161277685 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
982985395 4:162200429-162200451 AACCTCAACCTGAAGTCAGTTGG - Intergenic
983026175 4:162739977-162739999 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
983060415 4:163153287-163153309 ATCCACTGGGTGAAGCCAGCTGG + Intronic
983135017 4:164068790-164068812 ATCCACTGGGTGAAGCCAGCTGG + Intronic
983230583 4:165125864-165125886 ATCCACTGGGTGAAGCCAGCTGG - Intronic
983734804 4:171043641-171043663 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
983752926 4:171298717-171298739 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
984238738 4:177193120-177193142 ATCCACCGGGTGAAGCCAGCTGG - Intergenic
984662329 4:182386986-182387008 ATCCACTGGGTGAAGCCAGCTGG + Intronic
984770645 4:183433581-183433603 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
984776027 4:183482612-183482634 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
984901826 4:184592303-184592325 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
985145503 4:186890551-186890573 ATCCACTGGATGAAGCCAGCTGG + Intergenic
985203331 4:187506067-187506089 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
985267122 4:188160604-188160626 AGCCCCAGGCTGAAGACAGGAGG + Intergenic
985366479 4:189236742-189236764 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
985403788 4:189616570-189616592 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
986422257 5:7597325-7597347 CACCTCAGGCTGCGCCCAGCTGG + Intronic
986626255 5:9725764-9725786 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
986807694 5:11324173-11324195 AACCTCATGGTGAGGGCAGCAGG + Intronic
986993352 5:13578906-13578928 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
987146170 5:14993728-14993750 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
987156682 5:15096439-15096461 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
987283812 5:16436617-16436639 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
987347362 5:16990905-16990927 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
987352220 5:17032399-17032421 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
987355921 5:17062626-17062648 ATCCACCGGGTGAAGCCAGCTGG + Intergenic
987383930 5:17311697-17311719 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
987896373 5:23951733-23951755 ATCCACTGGGTGAAGCCAGCTGG + Exonic
987990170 5:25199946-25199968 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
988086906 5:26485204-26485226 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
988177350 5:27743897-27743919 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
988201698 5:28077592-28077614 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
988279482 5:29127547-29127569 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
988388409 5:30596560-30596582 AACCTGGGGCTGAAAGCAGCAGG - Intergenic
988489067 5:31691937-31691959 ATCCACTGGGTGAAGCCAGCTGG - Intronic
988607682 5:32694042-32694064 AAACTCAGGCTGCCTCCAGCTGG - Intronic
988684657 5:33515312-33515334 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
988883675 5:35532064-35532086 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
988920808 5:35940444-35940466 AACCTCAGGCTGATGACAATGGG - Intergenic
989003283 5:36783017-36783039 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
989956929 5:50369874-50369896 ATCCACAGGGTGAAGCCAGCTGG + Intergenic
990243320 5:53837364-53837386 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
990323096 5:54648943-54648965 ACCCGCTGGGTGAAGCCAGCTGG - Intergenic
990346169 5:54873817-54873839 AACCTCAGCCTGATCCCAGAGGG - Intergenic
990490145 5:56295761-56295783 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
990512065 5:56498584-56498606 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
990880301 5:60530734-60530756 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
991330157 5:65485402-65485424 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
991567482 5:68020326-68020348 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
992065991 5:73109221-73109243 AAACTCATGGTGAAGCCATCAGG + Intergenic
992089350 5:73303598-73303620 AAGCGCACTCTGAAGCCAGCCGG - Intergenic
992947527 5:81824150-81824172 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
993529107 5:89003548-89003570 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
993678527 5:90847441-90847463 ATCCACTGGGTGAAGCCAGCTGG - Intronic
993770374 5:91917713-91917735 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
993803460 5:92374817-92374839 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
993822121 5:92631768-92631790 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
994096423 5:95851603-95851625 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
994230043 5:97301585-97301607 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
994251432 5:97541800-97541822 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
994507198 5:100657199-100657221 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
994509759 5:100688791-100688813 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
994701623 5:103141958-103141980 ATCCACTGGGTGAAGCCAGCTGG - Intronic
994769709 5:103966250-103966272 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
994841473 5:104929438-104929460 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
994928884 5:106154694-106154716 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
994932364 5:106206013-106206035 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
995032387 5:107494632-107494654 ATCCACTGGGTGAAGCCAGCTGG + Intronic
995326339 5:110893951-110893973 ATCCACTGGGTGAAGCCAGCAGG - Intergenic
995568749 5:113457580-113457602 ATCCACTGGGTGAAGCCAGCTGG + Intronic
995656585 5:114433117-114433139 ATCCACTGGGTGAAGCCAGCTGG + Intronic
995975909 5:118034262-118034284 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
996107123 5:119517541-119517563 ATCCACTGGGTGAAGCCAGCTGG + Intronic
996435779 5:123430991-123431013 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
996530481 5:124522059-124522081 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
997352289 5:133239396-133239418 ATCCACTGGGTGAAGCCAGCTGG + Intronic
997760643 5:136444651-136444673 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
997796625 5:136817276-136817298 GACCTCAAACAGAAGCCAGCAGG + Intergenic
998093965 5:139386907-139386929 AACCTCATCTTGAAGCCAGTAGG + Intergenic
998335365 5:141366501-141366523 TGCTTCAGGCTGAAGGCAGCAGG + Exonic
998499218 5:142617463-142617485 AACCTCAGCCAGAGCCCAGCAGG + Intronic
998543954 5:143010062-143010084 AACCTCAGTCTGATGCTAGTGGG + Intronic
999259500 5:150229270-150229292 AGCCCCAGGCTTAAGCCATCTGG - Intronic
999348619 5:150845862-150845884 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
999406264 5:151309629-151309651 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
999577167 5:152991868-152991890 AACCCAAGGCTGTAACCAGCTGG - Intergenic
999725159 5:154430906-154430928 ACCCTCAGGCGGAAGCTGGCAGG - Intergenic
999855201 5:155586676-155586698 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1000066115 5:157694275-157694297 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1000329108 5:160193820-160193842 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1000547692 5:162622281-162622303 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1000609216 5:163356250-163356272 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1000889249 5:166784466-166784488 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1001245676 5:170104491-170104513 AGCCACAGGGAGAAGCCAGCAGG + Intergenic
1001843640 5:174901954-174901976 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1001859607 5:175042258-175042280 AAGCTCCAGCTGAAGCCTGCTGG - Intergenic
1002004555 5:176221949-176221971 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1002221820 5:177688671-177688693 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1002295145 5:178226385-178226407 AACCTCAACTTGAAGCCAGTCGG - Intronic
1002474309 5:179455448-179455470 TGCCTCAGGCTCAAGGCAGCAGG - Intergenic
1002789298 6:426124-426146 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1002817785 6:695017-695039 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1003070292 6:2940030-2940052 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1003176935 6:3758555-3758577 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1003213817 6:4090527-4090549 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1003224389 6:4191211-4191233 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1003323778 6:5076540-5076562 AACCTTAGGTTTCAGCCAGCTGG - Intergenic
1003489965 6:6613201-6613223 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1003591688 6:7441653-7441675 TACCACCGGGTGAAGCCAGCTGG + Intergenic
1003671620 6:8164770-8164792 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1003717783 6:8666405-8666427 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1003748094 6:9024703-9024725 ACCCACTGGGTGAAGCCAGCTGG + Intergenic
1003749635 6:9041127-9041149 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1003770070 6:9290367-9290389 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1003836136 6:10074634-10074656 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1003845813 6:10172191-10172213 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1003908210 6:10721026-10721048 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1004045287 6:12017855-12017877 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1004200346 6:13541977-13541999 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1004220693 6:13743646-13743668 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1004452313 6:15758683-15758705 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1004499590 6:16198023-16198045 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1004511727 6:16288691-16288713 ATCCACTGGATGAAGCCAGCTGG + Intronic
1004647988 6:17581056-17581078 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1004665456 6:17745231-17745253 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1004689014 6:17976118-17976140 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1004865972 6:19854357-19854379 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1004883772 6:20032746-20032768 ATCCACAGAGTGAAGCCAGCTGG + Intergenic
1004908585 6:20259940-20259962 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1004912701 6:20301689-20301711 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1005042191 6:21609823-21609845 ATCCTCTGGGTGAAGCCAGCTGG - Intergenic
1005059371 6:21761598-21761620 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1005596131 6:27380991-27381013 ATCCACTGGATGAAGCCAGCTGG - Intronic
1005712086 6:28512223-28512245 ATCCACTGGCTGAAGCCAGCTGG + Intronic
1005749002 6:28866407-28866429 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1005758813 6:28949717-28949739 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1005978151 6:30816221-30816243 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1006005855 6:31000902-31000924 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1006008392 6:31021157-31021179 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1006128032 6:31852452-31852474 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1006352723 6:33532827-33532849 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1006696089 6:35931707-35931729 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1006748818 6:36364155-36364177 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1006978285 6:38124252-38124274 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1008230748 6:48983355-48983377 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1008230970 6:48984340-48984362 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1008254148 6:49275880-49275902 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1008270415 6:49483345-49483367 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1008567905 6:52786921-52786943 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1008587447 6:52962555-52962577 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1009407033 6:63326374-63326396 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1009470348 6:64024171-64024193 ATCCACTGGGTGAAGCCAGCGGG + Intronic
1009471485 6:64031559-64031581 ATCCACTGGGTGAAGCCAGCGGG + Intronic
1009510731 6:64547649-64547671 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1009685421 6:66949651-66949673 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1009872348 6:69467647-69467669 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1010066353 6:71686547-71686569 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1010235561 6:73572455-73572477 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1010238112 6:73591783-73591805 AACCTCAACTTGAAGCCAGCAGG - Intergenic
1010277880 6:73990590-73990612 ATCCACTGGATGAAGCCAGCTGG - Intergenic
1011178191 6:84587828-84587850 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1011246599 6:85326405-85326427 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1011248540 6:85345574-85345596 AACCTCTGGGTGAACACAGCTGG + Intergenic
1011567561 6:88693503-88693525 AAAATCAGCCTGAAGCCATCAGG - Intronic
1011620023 6:89234412-89234434 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1011900709 6:92292318-92292340 AACCTCAGGCTAGAGGCAGCAGG - Intergenic
1012189261 6:96260869-96260891 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1012598933 6:101070697-101070719 ATCCTCTAGGTGAAGCCAGCTGG + Intergenic
1012733480 6:102910643-102910665 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1012760421 6:103294327-103294349 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1012851066 6:104446722-104446744 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1013080307 6:106806193-106806215 ACCCACTGGGTGAAGCCAGCTGG + Intergenic
1013410705 6:109881069-109881091 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1013694729 6:112689290-112689312 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1013853298 6:114541773-114541795 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1013963372 6:115928005-115928027 ATCCGCATGGTGAAGCCAGCTGG - Intergenic
1014055966 6:117015190-117015212 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1014280885 6:119441441-119441463 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1014460189 6:121686378-121686400 ATCCACTGGATGAAGCCAGCTGG - Intergenic
1014499200 6:122165051-122165073 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1014718638 6:124892410-124892432 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1014727266 6:124986468-124986490 AAGCAAAGGCTGAAGACAGCTGG - Intronic
1014739084 6:125126291-125126313 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1014788554 6:125644890-125644912 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1015572168 6:134633467-134633489 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1015600427 6:134905167-134905189 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1016092749 6:139999507-139999529 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1016104653 6:140148044-140148066 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1016217283 6:141618651-141618673 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1016482234 6:144495073-144495095 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1017262484 6:152403177-152403199 AACCTGAGCCTGGAGCCAGTGGG + Intronic
1017325174 6:153134059-153134081 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1017581134 6:155866678-155866700 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1017649618 6:156568895-156568917 AACCTCAGCCAGGAGCCTGCAGG - Intergenic
1017742493 6:157419144-157419166 AACCTCAGGAGGAAGACAGCAGG - Intronic
1018064155 6:160114440-160114462 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1018624565 6:165765210-165765232 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1019944183 7:4313860-4313882 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1019965672 7:4496853-4496875 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1019989801 7:4683076-4683098 ATCCTCAGGCTGGAGCCTCCAGG - Intronic
1020163994 7:5793930-5793952 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1020784352 7:12556085-12556107 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1021513723 7:21461121-21461143 ATCCACTGGGTGAAGCCAGCAGG - Intronic
1021936462 7:25636796-25636818 AGGCTGAGGCTGAAGCCAGGTGG + Intergenic
1022174069 7:27856979-27857001 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1022273250 7:28831043-28831065 AATCTCTTGCAGAAGCCAGCTGG - Intergenic
1022487299 7:30789552-30789574 AACTTCTGGCTGAAGGGAGCTGG - Intronic
1023040933 7:36172827-36172849 AACCTCAACTTGAAGCCAGTTGG + Intronic
1023128015 7:36974175-36974197 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1023150403 7:37196414-37196436 AATCTCAAGCTAAACCCAGCAGG - Intronic
1023499398 7:40831787-40831809 AACCCCAGCCTGAATTCAGCAGG + Intronic
1024269159 7:47628914-47628936 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1024335553 7:48202836-48202858 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1024465986 7:49711694-49711716 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1024691364 7:51806272-51806294 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1024700554 7:51900808-51900830 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1024735734 7:52302817-52302839 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1024741847 7:52363044-52363066 ACCCACTGGGTGAAGCCAGCTGG + Intergenic
1024794422 7:53004368-53004390 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1024834127 7:53495458-53495480 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1026203026 7:68231469-68231491 AGCCACTGGGTGAAGCCAGCTGG + Intergenic
1026236865 7:68534911-68534933 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1026237147 7:68537009-68537031 AATATCAGGCTGATGCCTGCCGG + Intergenic
1026512422 7:71038032-71038054 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1026516648 7:71078424-71078446 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1027278070 7:76582994-76583016 AACCTCTTGCTAAAGCCAACGGG - Intergenic
1027579634 7:79977527-79977549 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1027667457 7:81057406-81057428 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1027698203 7:81437013-81437035 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1027779029 7:82500007-82500029 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1027868178 7:83673748-83673770 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1028070180 7:86441005-86441027 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1028303221 7:89228692-89228714 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1028392758 7:90334850-90334872 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1028778403 7:94705930-94705952 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1028852437 7:95552389-95552411 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1029076216 7:97936319-97936341 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1029809559 7:103034167-103034189 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1029904033 7:104072197-104072219 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1030102058 7:105955734-105955756 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1030215651 7:107042285-107042307 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1030292729 7:107888255-107888277 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1030366943 7:108657173-108657195 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1030599905 7:111581867-111581889 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1030733569 7:113017783-113017805 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1030780493 7:113593755-113593777 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1030980614 7:116181906-116181928 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1031110043 7:117596546-117596568 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1031409289 7:121422164-121422186 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1031605459 7:123763141-123763163 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1032561526 7:132898530-132898552 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1033065152 7:138146558-138146580 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1033147783 7:138885829-138885851 AACCTCAACTTGAAGCCAGTCGG + Intronic
1033664024 7:143424321-143424343 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1034097994 7:148426845-148426867 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1034512045 7:151543540-151543562 AACATCAGGCTGCAGCCTGAAGG - Intergenic
1034561294 7:151880926-151880948 CTCCTCTGGCTGAAGCAAGCTGG - Intergenic
1034651851 7:152697558-152697580 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1034655960 7:152730199-152730221 ATCCACTAGCTGAAGCCAGCTGG - Intergenic
1034696801 7:153060928-153060950 AACCACAGACTGAATCCAGTAGG + Intergenic
1034967019 7:155398068-155398090 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1035049200 7:155988750-155988772 AACTTCAGGCTGAATTCAACAGG - Intergenic
1035151109 7:156873929-156873951 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1035283540 7:157792478-157792500 ACCCTCGAGCTGAAGGCAGCTGG - Intronic
1035958149 8:4105902-4105924 AACCTTGGGCTGAAGCCTGCAGG - Intronic
1036123749 8:6044984-6045006 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1036440949 8:8781315-8781337 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1036554587 8:9847723-9847745 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1036801443 8:11795199-11795221 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1036831427 8:12023039-12023061 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1036851237 8:12203309-12203331 ACCCACTTGCTGAAGCCAGCTGG - Intergenic
1036872601 8:12445583-12445605 ACCCACTTGCTGAAGCCAGCTGG - Intergenic
1037417496 8:18667606-18667628 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1037425531 8:18750967-18750989 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1037559012 8:20055162-20055184 ATCCCCTGGGTGAAGCCAGCTGG + Intergenic
1038638355 8:29304691-29304713 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1038639485 8:29311899-29311921 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1038847531 8:31244073-31244095 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1039587688 8:38720233-38720255 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1039637382 8:39180564-39180586 ATCCACTGGATGAAGCCAGCTGG + Intronic
1040014555 8:42689949-42689971 ATCCACCGGGTGAAGCCAGCTGG + Intergenic
1040351351 8:46571962-46571984 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1040622150 8:49102926-49102948 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1040659905 8:49559357-49559379 AACCTCAGAGAGAAGCCACCTGG - Intergenic
1040723204 8:50350355-50350377 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1040791083 8:51231038-51231060 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1040804415 8:51377956-51377978 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1040806759 8:51404747-51404769 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1040954842 8:52969757-52969779 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1041034583 8:53775824-53775846 ACCCACTGGGTGAAGCCAGCTGG - Intronic
1041636588 8:60152891-60152913 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1041914600 8:63126511-63126533 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1043073263 8:75665389-75665411 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1043102162 8:76060376-76060398 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1043110177 8:76170008-76170030 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1043129857 8:76447539-76447561 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1043701198 8:83290787-83290809 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1043857234 8:85276463-85276485 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1044075901 8:87821271-87821293 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1044088562 8:87971551-87971573 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1044404962 8:91816758-91816780 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1044788764 8:95824076-95824098 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1044853640 8:96452714-96452736 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1045743272 8:105387256-105387278 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1046149267 8:110202500-110202522 ATCCACTGGGTGAAGCCAGCGGG - Intergenic
1046208810 8:111040761-111040783 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1046284975 8:112082943-112082965 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1046288985 8:112133129-112133151 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1046445418 8:114311787-114311809 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1046450787 8:114386592-114386614 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1046621286 8:116531481-116531503 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1047180701 8:122585029-122585051 CACAACAGGCTGCAGCCAGCAGG - Intergenic
1047591491 8:126331720-126331742 AATCTCAGTGTGAGGCCAGCTGG - Intergenic
1048112930 8:131487464-131487486 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1048575963 8:135690381-135690403 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1048655341 8:136530376-136530398 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1048676887 8:136793730-136793752 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1048757420 8:137755043-137755065 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1048789255 8:138084576-138084598 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1049157770 8:141077077-141077099 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1049500391 8:142959913-142959935 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1049815482 8:144597190-144597212 AACAGCAAGGTGAAGCCAGCAGG + Intronic
1049858001 8:144875564-144875586 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1050250021 9:3734202-3734224 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1050302180 9:4270742-4270764 AGCCTGAGGCTGAAGGCAGAAGG - Intronic
1050624187 9:7486260-7486282 AAGCTGAGGCTGAGGCCTGCTGG - Intergenic
1051337210 9:16076696-16076718 AACCTCAGGCCCCAGCCAGCAGG + Intergenic
1051383383 9:16480943-16480965 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1051439934 9:17073039-17073061 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1051449323 9:17178336-17178358 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1051463878 9:17354372-17354394 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1052056601 9:23914383-23914405 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1052075525 9:24135503-24135525 ACCCACTGGGTGAAGCCAGCTGG + Intergenic
1052979628 9:34438382-34438404 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1053159117 9:35801204-35801226 AACCTCTGGCTGAAGCCAGGTGG + Intronic
1053393516 9:37752360-37752382 ATCCACTGGATGAAGCCAGCTGG + Intronic
1054722533 9:68617460-68617482 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1054922351 9:70554991-70555013 GACTTCATGCTGAAGCCAGGGGG - Intronic
1055049441 9:71963974-71963996 ATCCACGGGGTGAAGCCAGCTGG + Intronic
1055248506 9:74275864-74275886 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1055461384 9:76523652-76523674 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1055651450 9:78410431-78410453 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1055803014 9:80061117-80061139 AAACTGTAGCTGAAGCCAGCTGG + Intergenic
1055949829 9:81720226-81720248 GAGCTCAGGCTGAAAACAGCAGG - Intergenic
1055985448 9:82054305-82054327 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1056080883 9:83093223-83093245 ATCCACCGGGTGAAGCCAGCTGG - Intergenic
1056216358 9:84408916-84408938 ACCCACTGGGTGAAGCCAGCTGG + Intergenic
1056305840 9:85289480-85289502 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1056337714 9:85591321-85591343 AACCCCAGACTGTAGCCAGAGGG - Intronic
1056478676 9:86979035-86979057 ATGCTCAGGATGGAGCCAGCCGG - Intergenic
1056575615 9:87854012-87854034 GAGCTCAGGCTGAAAACAGCAGG - Intergenic
1056799611 9:89681688-89681710 ACCCACTGGGTGAAGCCAGCTGG + Intergenic
1056914117 9:90729927-90729949 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1057035295 9:91807528-91807550 AACCCCAACCTGAAGCCAGTAGG + Intronic
1057300779 9:93880345-93880367 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1057543783 9:96001643-96001665 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1057550818 9:96049942-96049964 ATCCTCAGGCTGGAGGCAGCTGG + Intergenic
1057726988 9:97574610-97574632 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1058174791 9:101724039-101724061 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1058235619 9:102486907-102486929 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1058285357 9:103169999-103170021 AACATGAGGCAGAATCCAGCTGG - Intergenic
1058286641 9:103187327-103187349 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1058585308 9:106501264-106501286 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1058727609 9:107818238-107818260 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1059061182 9:111037369-111037391 AACCTCAGGCCCCAGACAGCAGG + Intronic
1059092635 9:111376806-111376828 AACCTCAGGCTCAAGAAGGCTGG - Intronic
1059142895 9:111870830-111870852 AACCTCAGATTGAAACCAGTTGG + Intergenic
1059190924 9:112325399-112325421 AACCTGAGGTGGAAGCCAGCTGG + Intronic
1059791079 9:117642689-117642711 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1059810692 9:117852421-117852443 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1060077813 9:120609241-120609263 AACCTCAGACAGAAGAAAGCAGG - Intronic
1060091420 9:120746781-120746803 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1060305303 9:122406123-122406145 ATCCACTGGATGAAGCCAGCTGG - Intergenic
1060594153 9:124838657-124838679 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1061499691 9:130994694-130994716 CACCTCAGGCTGAACACAGCAGG + Intergenic
1061870556 9:133518070-133518092 AGGCTCAGGCTGAAGCCTGCTGG + Intronic
1062146132 9:134990956-134990978 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1062520561 9:136955985-136956007 AGCCTCGGGCTGGAGCCTGCTGG + Intronic
1062537391 9:137026999-137027021 AAACCCAGGCTGCAGTCAGCTGG - Intronic
1203429870 Un_GL000195v1:80756-80778 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1203460358 Un_GL000220v1:30945-30967 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1186152519 X:6690432-6690454 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1186293286 X:8122044-8122066 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1186295576 X:8144895-8144917 ATCCACCGGGTGAAGCCAGCTGG - Intergenic
1186631104 X:11349858-11349880 ACCCTGAGGCAGAAGCCACCAGG + Intronic
1186638781 X:11433071-11433093 ACCCCCAGCCTGAAGACAGCTGG + Intronic
1187139130 X:16575888-16575910 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1187877387 X:23815602-23815624 TGCCTCAGGCTGAAACCACCTGG + Intergenic
1188189602 X:27157439-27157461 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1188242753 X:27809727-27809749 ATCCACTGGGTGAAGCCAGCTGG + Intronic
1188836982 X:34970188-34970210 AGACACAGTCTGAAGCCAGCTGG + Intergenic
1188856178 X:35198663-35198685 GACCCCAGGCTGAGCCCAGCTGG + Intergenic
1188881911 X:35499714-35499736 ACCCACTGGGTGAAGCCAGCTGG + Intergenic
1189209909 X:39276016-39276038 ATCCACTGGGTGAAGCCAGCCGG + Intergenic
1189536137 X:41937104-41937126 AAACTCAGCCAGAAGCCAGAGGG - Intergenic
1189896772 X:45664742-45664764 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1190045793 X:47110928-47110950 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1190303940 X:49072045-49072067 GACCTCAGCCTGCAGCCAACCGG + Intronic
1190413890 X:50163256-50163278 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1191053838 X:56222529-56222551 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1192186829 X:68952550-68952572 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1192227317 X:69238320-69238342 AACCCCAGGCTGAGCCGAGCAGG + Intergenic
1192233349 X:69280826-69280848 CACCTCAGGCTACAGCCGGCTGG - Intergenic
1193040133 X:76996583-76996605 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1193271142 X:79531018-79531040 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1193803963 X:85972283-85972305 ATCCACTGGGTGAAGCCAGCTGG - Intronic
1194025526 X:88746299-88746321 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1195257961 X:103107273-103107295 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1195259297 X:103117035-103117057 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1195460199 X:105115675-105115697 ACCCACTGGGTGAAGCCAGCTGG - Intronic
1195896291 X:109749259-109749281 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1195909532 X:109875819-109875841 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1196103053 X:111867463-111867485 CACCTCTGGCTGAAGCAATCAGG - Intronic
1196319457 X:114270485-114270507 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1196616226 X:117769469-117769491 ATCCGCTGGGTGAAGCCAGCTGG + Intergenic
1196705833 X:118716861-118716883 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1196845129 X:119891026-119891048 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1196860783 X:120025693-120025715 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1196861442 X:120032644-120032666 AAACTGAGGCTGCAGTCAGCAGG - Intergenic
1197000211 X:121431453-121431475 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1197331101 X:125155393-125155415 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1197376724 X:125690503-125690525 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1197533707 X:127662938-127662960 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1197608016 X:128607060-128607082 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1198468180 X:136921799-136921821 ATCCACGGGGTGAAGCCAGCTGG + Intergenic
1198872242 X:141188463-141188485 ACCCACTGGGTGAAGCCAGCTGG - Intergenic
1198972514 X:142298170-142298192 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1199050159 X:143228616-143228638 ATCCCCTGGGTGAAGCCAGCTGG - Intergenic
1199134099 X:144231176-144231198 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1199285025 X:146046112-146046134 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1199356169 X:146866807-146866829 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1199628180 X:149758961-149758983 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1199831722 X:151555116-151555138 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1199832862 X:151562587-151562609 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1200089190 X:153626429-153626451 AACCTCCGGCTGCAGGGAGCAGG + Intergenic
1200470820 Y:3584015-3584037 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1200789753 Y:7288797-7288819 AACATGAGGCTGAAGCCTGCTGG - Intergenic
1200873562 Y:8128445-8128467 ATCCACTGGGTGAAGCCAGCTGG - Intergenic
1201285406 Y:12374934-12374956 ATCCACTGGCTGAAGCCAGCTGG - Intergenic
1201468409 Y:14309679-14309701 ATCCACTGGGTGAAGCCAGCGGG + Intergenic
1201469172 Y:14314886-14314908 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1201715883 Y:17043549-17043571 ATCCACTGGGTGAAGCCAGCTGG + Intergenic
1201901035 Y:19046489-19046511 ATCCGCTGGGTGAAGCCAGCTGG - Intergenic
1202137016 Y:21676588-21676610 ATCCACTGGGTGAAGCCAGCTGG - Intergenic