ID: 1128313577

View in Genome Browser
Species Human (GRCh38)
Location 15:66646485-66646507
Sequence ACCTCAGGCTGAAGCCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1244
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 1205}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128313567_1128313577 24 Left 1128313567 15:66646438-66646460 CCCTGGGATAGTGGTCAGTGCGT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1128313577 15:66646485-66646507 ACCTCAGGCTGAAGCCAGCTGGG 0: 1
1: 0
2: 0
3: 38
4: 1205
1128313573_1128313577 -8 Left 1128313573 15:66646470-66646492 CCGGCATGCCTGGAAACCTCAGG 0: 1
1: 0
2: 1
3: 15
4: 255
Right 1128313577 15:66646485-66646507 ACCTCAGGCTGAAGCCAGCTGGG 0: 1
1: 0
2: 0
3: 38
4: 1205
1128313566_1128313577 25 Left 1128313566 15:66646437-66646459 CCCCTGGGATAGTGGTCAGTGCG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1128313577 15:66646485-66646507 ACCTCAGGCTGAAGCCAGCTGGG 0: 1
1: 0
2: 0
3: 38
4: 1205
1128313568_1128313577 23 Left 1128313568 15:66646439-66646461 CCTGGGATAGTGGTCAGTGCGTG 0: 1
1: 0
2: 0
3: 31
4: 850
Right 1128313577 15:66646485-66646507 ACCTCAGGCTGAAGCCAGCTGGG 0: 1
1: 0
2: 0
3: 38
4: 1205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128313577 Original CRISPR ACCTCAGGCTGAAGCCAGCT GGG Intronic
900113191 1:1018236-1018258 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
900613220 1:3553194-3553216 TCCTCAGGCTGGAGCCAGGGAGG - Intronic
900692998 1:3992947-3992969 AGCTGAGGCTGAAGGCAGATAGG - Intergenic
901045902 1:6395698-6395720 CCCACTGGGTGAAGCCAGCTGGG - Intergenic
901601391 1:10426284-10426306 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
902033526 1:13439683-13439705 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
902037240 1:13466820-13466842 CCCTCTGGCTGGAGCAAGCTAGG + Intergenic
902100346 1:13983087-13983109 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
902604292 1:17560237-17560259 ACATCAGGAGGAGGCCAGCTCGG + Intronic
903071655 1:20729776-20729798 ACCTCAGGCTCAGGCCAGGGTGG + Intronic
903188068 1:21640574-21640596 TCCTCAGCCTGCAGGCAGCTGGG + Intronic
903252820 1:22068824-22068846 AGCACAAGCTGAAGCCAGCATGG - Intronic
904238810 1:29131068-29131090 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
904252364 1:29234297-29234319 ATCTCAGCATGAAGCCAGCTAGG + Intergenic
905742976 1:40388288-40388310 TCCACTGGATGAAGCCAGCTGGG + Intronic
905894809 1:41538705-41538727 AGCCTGGGCTGAAGCCAGCTTGG + Intronic
906083056 1:43107287-43107309 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
906261963 1:44399487-44399509 ACACCAGCCTGAAGGCAGCTGGG + Intergenic
906563426 1:46778433-46778455 TCCACTGGGTGAAGCCAGCTAGG - Intronic
907102154 1:51847302-51847324 TCCACTGGGTGAAGCCAGCTGGG - Intronic
907759428 1:57343374-57343396 TCCACTGGGTGAAGCCAGCTGGG - Intronic
907889576 1:58623866-58623888 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
907980134 1:59472521-59472543 TCCACTGGGTGAAGCCAGCTGGG + Intronic
908027670 1:59969589-59969611 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
908888668 1:68818144-68818166 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
908960894 1:69695728-69695750 AGCTAAGGCTGAAGCCAGAGCGG - Intronic
909318463 1:74253261-74253283 TCCACTGGGTGAAGCCAGCTGGG - Intronic
909608655 1:77531688-77531710 TCCACTGGGTGAAGCCAGCTGGG - Intronic
909759319 1:79269556-79269578 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
909820415 1:80053417-80053439 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
910034688 1:82776706-82776728 TCCACTGGATGAAGCCAGCTGGG - Intergenic
910169086 1:84358771-84358793 ACCTCATCCTGAAGCTACCTAGG - Intronic
910622585 1:89273289-89273311 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
910693065 1:89984584-89984606 TCCACTGGGTGAAGCCAGCTAGG - Intergenic
911001526 1:93170665-93170687 TCCACTGGGTGAAGCCAGCTGGG + Intronic
911259517 1:95669552-95669574 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
911839163 1:102659934-102659956 CCCACTGGGTGAAGCCAGCTGGG - Intergenic
912166240 1:107045204-107045226 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
913160985 1:116146478-116146500 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
913212793 1:116595333-116595355 ACAACAGGCAGAAGCCACCTGGG + Intronic
913331702 1:117672943-117672965 ACCGCAGGCCTCAGCCAGCTCGG + Intergenic
913469081 1:119171941-119171963 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
913470263 1:119179460-119179482 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
913486186 1:119334141-119334163 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
914928139 1:151906573-151906595 TCCACTGGGTGAAGCCAGCTGGG + Intronic
915104203 1:153522213-153522235 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
915242247 1:154532013-154532035 TCCACTGGGTGAAGCCAGCTGGG - Intronic
915260145 1:154671198-154671220 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
915261315 1:154678485-154678507 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
915666023 1:157446207-157446229 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
915767085 1:158374080-158374102 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
915995744 1:160561321-160561343 TCCTAGGGATGAAGCCAGCTTGG - Intronic
916219947 1:162433588-162433610 TCCACTGGATGAAGCCAGCTGGG + Intergenic
916605870 1:166342784-166342806 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
916910029 1:169336998-169337020 TCCACTGGGTGAAGCCAGCTGGG - Intronic
916939106 1:169661609-169661631 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
916940145 1:169668447-169668469 TCCACTGGGTGAAGCCAGCTGGG + Intronic
916960366 1:169882547-169882569 TCCACTGGGTGAAGCCAGCTGGG + Intronic
917445331 1:175102224-175102246 TCCACTGGGTGAAGCCAGCTGGG - Intronic
918059093 1:181046265-181046287 TCCACTGGGTGAAGCCAGCTGGG + Intronic
918511937 1:185321640-185321662 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
918709025 1:187704056-187704078 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
918720915 1:187850638-187850660 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
918732224 1:188013245-188013267 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
918790051 1:188813455-188813477 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
918791960 1:188841099-188841121 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
918853131 1:189718223-189718245 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
919026054 1:192172081-192172103 ACCTCAGTTTGCAGCCAGCAAGG - Intronic
919049704 1:192499001-192499023 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
919091987 1:192987345-192987367 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
919237097 1:194859436-194859458 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
919250911 1:195054714-195054736 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
919297694 1:195722838-195722860 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
919452198 1:197785969-197785991 CCCTGAGGCTGAAACAAGCTTGG + Intergenic
919631026 1:199960056-199960078 ACCACTGGGTGAAGCCAGCTGGG + Intergenic
920150312 1:203900675-203900697 ACCACTTGGTGAAGCCAGCTGGG + Intergenic
920247729 1:204600992-204601014 CTCTTAGGCTGGAGCCAGCTGGG - Intergenic
920731289 1:208488362-208488384 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
920756766 1:208740114-208740136 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
920881945 1:209888872-209888894 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
921096339 1:211889846-211889868 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
921396297 1:214673071-214673093 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
921903750 1:220475592-220475614 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
922306896 1:224352443-224352465 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
922485505 1:225970202-225970224 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
922541828 1:226426218-226426240 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
922570835 1:226633988-226634010 AGAGAAGGCTGAAGCCAGCTTGG - Exonic
922740551 1:228011982-228012004 ACCTCAGGCACTGGCCAGCTTGG + Intronic
922855875 1:228774140-228774162 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
922985959 1:229865892-229865914 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
923157160 1:231289427-231289449 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
923193375 1:231641873-231641895 TCCACTGGGTGAAGCCAGCTGGG - Intronic
923324731 1:232871368-232871390 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
923353263 1:233129556-233129578 TCCACTGGGTGAAGCCAGCTAGG + Intronic
923573901 1:235140730-235140752 TCCACTGGGTGAAGCCAGCTGGG + Intronic
924117606 1:240762924-240762946 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
924219156 1:241855505-241855527 TCCACTGGGTGAAGCCAGCTGGG - Intronic
924386035 1:243498480-243498502 GCCTCAGGCTGAATGCAGGTGGG - Intronic
1062768908 10:84765-84787 ACCTAAGGCTGAAGCCCCATGGG + Intergenic
1063148865 10:3319738-3319760 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1063300308 10:4844839-4844861 TCCACTGGGTGAAGCCAGCTAGG - Intronic
1063318641 10:5032443-5032465 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1063320980 10:5053069-5053091 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1063769780 10:9183786-9183808 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1063921567 10:10938784-10938806 AACTCAGGCTCGAGCCCGCTGGG + Intergenic
1064449126 10:15426023-15426045 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1065441420 10:25756434-25756456 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1065743197 10:28815598-28815620 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1065752096 10:28896744-28896766 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1065895966 10:30163248-30163270 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1065995590 10:31056256-31056278 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1066296179 10:34055951-34055973 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1066544164 10:36481922-36481944 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1066598277 10:37076399-37076421 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1066660961 10:37737765-37737787 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1067328521 10:45292693-45292715 TCCTCAGGCTGAAGCCCTGTGGG - Intergenic
1067343221 10:45420624-45420646 ACCTCTGGCTGGCGACAGCTTGG + Intronic
1067947416 10:50698723-50698745 AGCTCAGGCTGAAAACAGCAGGG + Intergenic
1068374105 10:56155560-56155582 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1068460443 10:57321912-57321934 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1068792353 10:61041050-61041072 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1068863252 10:61868079-61868101 CCCACTGGGTGAAGCCAGCTGGG + Intergenic
1068978223 10:63034025-63034047 TCCACCGGGTGAAGCCAGCTGGG + Intergenic
1069601194 10:69709370-69709392 ATCACAGGGTGAAGCCAGCAGGG - Intergenic
1069766229 10:70862097-70862119 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1069988762 10:72301039-72301061 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1070564010 10:77590205-77590227 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1070882730 10:79863710-79863732 AGCTCAGGCTGAAAACAGCAGGG + Intergenic
1070937965 10:80315837-80315859 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1070968388 10:80543650-80543672 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1070973461 10:80586310-80586332 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1071041006 10:81308999-81309021 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1071055766 10:81506209-81506231 TCCACTGGGTGAAGCCAGCTTGG + Intergenic
1071332263 10:84571632-84571654 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1071388083 10:85141836-85141858 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1071649296 10:87380012-87380034 AGCTCAGGCTGAAAACAGCAGGG + Intergenic
1071797004 10:89018578-89018600 TCCACGGGGTGAAGCCAGCTGGG - Intergenic
1071900926 10:90119754-90119776 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1071963702 10:90832099-90832121 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1073532596 10:104245608-104245630 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1073789692 10:106928029-106928051 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1073878374 10:107950972-107950994 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1074098218 10:110331902-110331924 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1074317239 10:112370761-112370783 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1074404862 10:113172145-113172167 AAGTCTGGGTGAAGCCAGCTTGG + Intergenic
1074779111 10:116787857-116787879 CCCCCACGCTGAAGCCAGTTTGG - Intergenic
1074996264 10:118760071-118760093 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1075375938 10:121978314-121978336 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1076261572 10:129071276-129071298 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1076887378 10:133268903-133268925 ACCTCAGGCAGGAGCCAGGGAGG + Intronic
1077253401 11:1570646-1570668 ACCTCCTGCTGCAGCCAGCCGGG - Intronic
1077315330 11:1917183-1917205 GCCTCAGGCTGGATCCAGCCTGG + Intergenic
1077583719 11:3434909-3434931 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1077603307 11:3589116-3589138 TCCACTGGATGAAGCCAGCTGGG + Intergenic
1077764677 11:5144832-5144854 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1078891424 11:15561359-15561381 TCCACTGGGTGAAGCCAGCTAGG + Intergenic
1078911602 11:15737851-15737873 ACCTCAGGCTGAAGATAGAGAGG + Intergenic
1079190902 11:18276060-18276082 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1079346377 11:19656387-19656409 CCCTGAGGCTGGAGGCAGCTTGG + Intronic
1079731673 11:23942200-23942222 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1079957099 11:26879193-26879215 AGCTGAGGCTGAAGCCAGAGTGG + Intergenic
1080107419 11:28525721-28525743 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1080204506 11:29713090-29713112 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1080557611 11:33431667-33431689 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1080645105 11:34182458-34182480 ACCTCAAGCAGAAGTCACCTGGG - Intronic
1080748145 11:35127363-35127385 AACTGGGGCTAAAGCCAGCTGGG + Intergenic
1080771275 11:35344405-35344427 GCCTGAGGCAGAAGCAAGCTTGG + Intronic
1081126854 11:39332993-39333015 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1081136079 11:39442009-39442031 TCCACTAGCTGAAGCCAGCTGGG - Intergenic
1081315276 11:41623273-41623295 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1081420980 11:42874349-42874371 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1081422150 11:42881819-42881841 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1081428467 11:42950322-42950344 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1081712867 11:45228736-45228758 ATCTCAAGCTGAAGTCAGGTGGG - Intronic
1081725929 11:45329115-45329137 ATCTCAGGCTGAAGTCAGTTTGG - Intergenic
1082270366 11:50163971-50163993 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1082272201 11:50183710-50183732 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1083546192 11:63550640-63550662 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1084024668 11:66440702-66440724 TCCGCTGGGTGAAGCCAGCTGGG - Intronic
1084192387 11:67504952-67504974 TCCTCAGGCTGAGGCCAGAGTGG + Intronic
1084259204 11:67963659-67963681 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1085245687 11:75098644-75098666 CCCACTGGGTGAAGCCAGCTGGG + Intergenic
1085671011 11:78464894-78464916 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1085863219 11:80257996-80258018 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1086034989 11:82404326-82404348 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1086087652 11:82971113-82971135 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1086210036 11:84308474-84308496 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1086256343 11:84881369-84881391 CTCTCAGGCTGAAGCCAACAAGG + Intronic
1086397666 11:86433447-86433469 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1086808102 11:91269192-91269214 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1087481789 11:98710817-98710839 CCCTCAGGCTGAAATCAGCAAGG + Intergenic
1087486305 11:98763332-98763354 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1087966485 11:104422354-104422376 TCCACTGGCTGAAGCCAGCTGGG - Intergenic
1088481632 11:110300861-110300883 TCCCCTGGGTGAAGCCAGCTGGG - Intergenic
1088669465 11:112127368-112127390 TCCTGAGGCTGGAGCAAGCTTGG - Intronic
1089062041 11:115633817-115633839 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1089614524 11:119687739-119687761 ACATCAGCCTGAAGCCTGCGGGG - Intronic
1089948745 11:122505867-122505889 ACCCCTGGCAGAAGCCAACTTGG + Intergenic
1089962244 11:122626359-122626381 ACCTTAAGCTCCAGCCAGCTAGG + Intergenic
1090776641 11:129971756-129971778 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1090782795 11:130022041-130022063 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1091201287 11:133782735-133782757 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1091233366 11:134002812-134002834 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1091402167 12:188041-188063 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1091977436 12:4836740-4836762 GCCTCCGGCTGAAGCAAGATGGG + Intronic
1092062547 12:5563339-5563361 CCTTCAGGCCAAAGCCAGCTGGG - Exonic
1092134005 12:6132917-6132939 CCCACTGGGTGAAGCCAGCTGGG + Intergenic
1092142027 12:6190795-6190817 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1092220368 12:6708718-6708740 TCCTCTAGGTGAAGCCAGCTGGG + Intergenic
1092336757 12:7640258-7640280 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1092350435 12:7751992-7752014 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1092430518 12:8404664-8404686 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1092572339 12:9739494-9739516 TCCACCGGGTGAAGCCAGCTGGG - Intergenic
1092583754 12:9876095-9876117 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1092617065 12:10225537-10225559 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1092732539 12:11547684-11547706 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1092834144 12:12472358-12472380 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1093034586 12:14320530-14320552 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1093189486 12:16057811-16057833 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1093266358 12:17008060-17008082 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1093580094 12:20777335-20777357 TCCACTGGGTGAAGCCAGCTAGG - Intergenic
1093580953 12:20783704-20783726 TCCACTGGGTGAAGCCAGCTAGG - Intergenic
1093583168 12:20807313-20807335 GCCTCTGGGTGAAGCCAGCTGGG - Intergenic
1093653825 12:21673931-21673953 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1093970289 12:25369802-25369824 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1094327641 12:29257079-29257101 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1094405280 12:30110406-30110428 TCCACTGGGTGAAGCCAGCTAGG - Intergenic
1094409919 12:30157296-30157318 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1094572101 12:31650106-31650128 ACCTGAGGCTGAAACCTGCTGGG + Intronic
1094718113 12:33033855-33033877 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1094722125 12:33075738-33075760 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1095123172 12:38442385-38442407 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1095304219 12:40621048-40621070 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1095444880 12:42273632-42273654 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1095478567 12:42610871-42610893 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1095534043 12:43224716-43224738 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1095587490 12:43864336-43864358 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1095901625 12:47333817-47333839 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1096594432 12:52685594-52685616 ACCTGAGGCTGGAGGGAGCTGGG + Intergenic
1096785359 12:54014264-54014286 AGCACAGGCTGCAGGCAGCTGGG + Intronic
1097017840 12:56000069-56000091 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1097213009 12:57386705-57386727 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1097224990 12:57471765-57471787 ACCTCAGGATGACCACAGCTGGG - Exonic
1097664119 12:62461199-62461221 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1097982084 12:65744750-65744772 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1098168134 12:67719156-67719178 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1098498675 12:71166124-71166146 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1098914304 12:76241120-76241142 AACTGAAGCTGGAGCCAGCTGGG - Intergenic
1099191478 12:79565390-79565412 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1099204442 12:79711377-79711399 CCCACTGGGTGAAGCCAGCTGGG + Intergenic
1099228074 12:79993146-79993168 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1099450506 12:82801961-82801983 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1100166538 12:91923832-91923854 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1100211804 12:92406463-92406485 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1101009076 12:100430738-100430760 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1102227120 12:111236623-111236645 ACCACAGGCTGAGGCCTGATTGG + Intronic
1102309843 12:111836089-111836111 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1103146065 12:118597100-118597122 TCCACCGGGTGAAGCCAGCTGGG - Intergenic
1103459586 12:121093459-121093481 TCCACTGGCTGAAGCCAGCTGGG - Intergenic
1103497634 12:121374875-121374897 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1103678637 12:122676561-122676583 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1103783309 12:123414037-123414059 TCCACTGGGTGAAGCCAGCTGGG - Exonic
1103793118 12:123485585-123485607 ACCTCAGTAAGGAGCCAGCTCGG + Intronic
1104142680 12:126003977-126003999 ACCTGAGGCTGAAGCTAGAGTGG - Intergenic
1104749325 12:131228248-131228270 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1105216039 13:18285964-18285986 ACAACAGGCAGAAGCCACCTGGG + Intergenic
1105605087 13:21920626-21920648 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1105697149 13:22900373-22900395 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1105722252 13:23128007-23128029 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1105871070 13:24506743-24506765 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1106473708 13:30079408-30079430 GCCTCGGGCTGCAGCCAGATTGG + Intergenic
1106600478 13:31182976-31182998 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1106643351 13:31608753-31608775 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1107590382 13:41898503-41898525 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1107652654 13:42560139-42560161 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1107836197 13:44414011-44414033 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1108435427 13:50397025-50397047 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1108643895 13:52407999-52408021 TCCACTGGGTGAAGCCAGCTAGG - Intergenic
1108856459 13:54799648-54799670 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1108858877 13:54829424-54829446 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1109007842 13:56901166-56901188 ACCACTGGGTGAGGCCAGCTGGG + Intergenic
1109033848 13:57230216-57230238 ACCGCAGTCTGAAGCCAACCTGG + Intergenic
1109145473 13:58773719-58773741 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1109159792 13:58958106-58958128 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1109506227 13:63306168-63306190 TCCACAAGGTGAAGCCAGCTGGG + Intergenic
1109563087 13:64077459-64077481 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1109699733 13:66009664-66009686 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1109741604 13:66561460-66561482 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1110023992 13:70511835-70511857 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1110368955 13:74718824-74718846 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1110751318 13:79119561-79119583 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1110862217 13:80355973-80355995 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1110940210 13:81340695-81340717 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1111232625 13:85363355-85363377 ACTGAAGGATGAAGCCAGCTGGG + Intergenic
1111286267 13:86096601-86096623 AATTCAGGCAGAAGTCAGCTGGG - Intergenic
1111747753 13:92291281-92291303 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1111841330 13:93454710-93454732 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1112282619 13:98076259-98076281 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1112518725 13:100077952-100077974 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1112533086 13:100223973-100223995 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1112613183 13:100976132-100976154 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1112625514 13:101099097-101099119 ACTTCAGGATGAAGCCTGCTAGG - Intronic
1112842767 13:103600375-103600397 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1113280951 13:108786791-108786813 GTCTCAGGCAGAAGCAAGCTGGG + Intronic
1113482604 13:110632953-110632975 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1113560150 13:111272362-111272384 ACCTCTGGCAGTAGCCAGCTTGG + Intronic
1113863797 13:113508382-113508404 TCCTCAGGCTGCAGCCAGCGTGG + Intronic
1113937642 13:114002846-114002868 GCCTCAGGCTGAAAGCAGCTCGG + Intronic
1114328307 14:21611792-21611814 ACCTAAGGCTGAAGATATCTGGG + Intergenic
1114559803 14:23581194-23581216 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1116250950 14:42482309-42482331 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1116426670 14:44799123-44799145 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1116452444 14:45080872-45080894 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1116657062 14:47665997-47666019 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1117077949 14:52122681-52122703 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1117110279 14:52446443-52446465 ACCTCAGGCTGGAGTGTGCTGGG + Intronic
1117150948 14:52887372-52887394 ACTTCAGGCAGATGCCAGCATGG - Intronic
1117297643 14:54393876-54393898 TCCGCTGGGTGAAGCCAGCTGGG + Intergenic
1117449891 14:55839903-55839925 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1118306392 14:64658564-64658586 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1119027853 14:71167929-71167951 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1119300241 14:73566257-73566279 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1119517368 14:75258864-75258886 ACCTGAGGCTGAGGCGTGCTGGG + Intronic
1120229683 14:81829389-81829411 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1120331057 14:83092817-83092839 TCCACTGGGTGAAGCCAGCTAGG + Intergenic
1120439025 14:84512832-84512854 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1120844241 14:89112084-89112106 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1121350580 14:93170038-93170060 TCCGCTGGGTGAAGCCAGCTGGG - Intergenic
1121729778 14:96178352-96178374 TGCTCAGGTTGAAGCCAGGTAGG - Intergenic
1122139979 14:99657269-99657291 AGCTCAGCCTGCAGCTAGCTGGG + Intronic
1122216445 14:100208090-100208112 GCCACTGGGTGAAGCCAGCTGGG - Intergenic
1123019960 14:105393033-105393055 GCCTCAGGCGGAGGCCAGCTGGG + Intronic
1123707435 15:22960152-22960174 ACCTCAGGCTGGAGGCAGTAGGG - Intronic
1123799222 15:23803350-23803372 TCCGCTGGGTGAAGCCAGCTGGG + Intergenic
1124036437 15:26057309-26057331 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1124110535 15:26781593-26781615 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1124114770 15:26831103-26831125 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1124380288 15:29159857-29159879 TCCACCGGGTGAAGCCAGCTGGG - Intronic
1124387774 15:29224718-29224740 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1124818395 15:33019410-33019432 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1125112298 15:36047389-36047411 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1125914474 15:43473796-43473818 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1126089073 15:45035271-45035293 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1126128167 15:45314534-45314556 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1127211677 15:56780083-56780105 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1127765986 15:62186488-62186510 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1127984863 15:64061322-64061344 TCCACTGGATGAAGCCAGCTGGG + Intronic
1128313577 15:66646485-66646507 ACCTCAGGCTGAAGCCAGCTGGG + Intronic
1128594026 15:68928879-68928901 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1128660579 15:69498039-69498061 ACCTGAGGCTGAGGCCATCAAGG + Intergenic
1128669904 15:69567282-69567304 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1128715027 15:69901522-69901544 CCCTCAGGCTTCAGCCAGCAGGG + Intergenic
1129158184 15:73732109-73732131 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1129158437 15:73733165-73733187 ACCTCAGGCTGACGCTATCCAGG - Intergenic
1129197004 15:73974145-73974167 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1129208714 15:74052936-74052958 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1129716932 15:77857687-77857709 AGCTAAGGCTGAAGCCAGATTGG + Intergenic
1129986972 15:79926511-79926533 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1129997224 15:80016914-80016936 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1130132948 15:81159058-81159080 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1131250328 15:90825909-90825931 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1131323608 15:91421385-91421407 ACCACAGGCTAAAGCGATCTGGG - Intergenic
1131463167 15:92634210-92634232 TCCTCAGCCTGAAGCCGTCTGGG - Intronic
1131472756 15:92711009-92711031 TCCACGGGGTGAAGCCAGCTGGG - Intronic
1131846029 15:96491756-96491778 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1132097779 15:99000440-99000462 TCCACAGGGTAAAGCCAGCTGGG + Intronic
1132098797 15:99008200-99008222 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1132511097 16:341680-341702 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1132576127 16:665214-665236 ACCTCAGTCTGCAGCCTGCTAGG + Intronic
1132576134 16:665264-665286 GCCTCAGTCTGCAGCCTGCTAGG + Intronic
1132576141 16:665314-665336 GCCTCAGTCTGCAGCCTGCTAGG + Intronic
1132576148 16:665364-665386 GCCTCAGTCTGTAGCCTGCTAGG + Intronic
1132836733 16:1958124-1958146 TCCACCGGGTGAAGCCAGCTGGG - Intergenic
1133362576 16:5186288-5186310 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1133367453 16:5221934-5221956 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1134849775 16:17470560-17470582 TCCTCGGGCTGCAGCCGGCTCGG + Exonic
1135280940 16:21153034-21153056 GCCACTGGGTGAAGCCAGCTGGG + Intronic
1135470140 16:22722916-22722938 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1135888845 16:26338871-26338893 GCCTCAAGCTGACACCAGCTAGG - Intergenic
1135942620 16:26836023-26836045 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1136163378 16:28435805-28435827 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1136199585 16:28679182-28679204 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1136215931 16:28793355-28793377 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1136776369 16:32873948-32873970 ACCTCTGACTAATGCCAGCTGGG + Intergenic
1136894246 16:33987564-33987586 ACCTCTGACTAATGCCAGCTGGG - Intergenic
1137512380 16:49113008-49113030 GCCCCAGGCTGCAGCCAGCAAGG - Intergenic
1138036415 16:53611533-53611555 TCCGCAGGCTGACGCCTGCTGGG + Intronic
1138688867 16:58749293-58749315 TCCACTGGATGAAGCCAGCTGGG + Intergenic
1138693521 16:58790693-58790715 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1139147819 16:64344329-64344351 TCCACGGGGTGAAGCCAGCTGGG + Intergenic
1139205422 16:65023978-65024000 ACCTGAGTCTGAAACCTGCTGGG - Intronic
1139442386 16:66974665-66974687 TCCACTGGGTGAAGCCAGCTGGG + Exonic
1139600364 16:67982659-67982681 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1139676490 16:68527137-68527159 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1203078784 16_KI270728v1_random:1136057-1136079 ACCTCTGACTAATGCCAGCTGGG + Intergenic
1143009549 17:3858421-3858443 ACCCCATCCTGAAGCCACCTAGG - Intergenic
1143283446 17:5771653-5771675 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1143459783 17:7094856-7094878 ATGTCAGGCTTGAGCCAGCTAGG - Intergenic
1143664195 17:8347042-8347064 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1143708571 17:8718001-8718023 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1144128163 17:12221299-12221321 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1144578448 17:16444334-16444356 ACCTCAGGCTACGGCCAGCTGGG - Intronic
1144804596 17:17956420-17956442 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1145094915 17:20016861-20016883 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1146740379 17:35278837-35278859 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1147373703 17:40011371-40011393 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1147431893 17:40376266-40376288 TCCACTGGGTGAAGCCAGCTAGG + Intergenic
1147977276 17:44255098-44255120 TCCCCAACCTGAAGCCAGCTGGG - Intronic
1147997614 17:44369240-44369262 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1148023451 17:44568621-44568643 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1148090714 17:45021096-45021118 AGCTGAGGCTGCACCCAGCTGGG - Intergenic
1148366098 17:47057208-47057230 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1148496461 17:48055921-48055943 ACCACAGGCTGATGCAAGCCTGG + Intronic
1148538779 17:48463136-48463158 GCCAGAGACTGAAGCCAGCTTGG + Intergenic
1148582237 17:48752213-48752235 AGCTCAGGCAGACGCCAGCCGGG + Intergenic
1148632194 17:49119830-49119852 GGGTCAGGCTGAAGTCAGCTGGG + Intergenic
1149099181 17:52883899-52883921 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1149204001 17:54222644-54222666 GCTTCAGACTGTAGCCAGCTAGG - Intergenic
1149630132 17:58115577-58115599 CCCTCGGGTTGAAGCCAGGTGGG + Intergenic
1149754052 17:59172956-59172978 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1150682586 17:67295147-67295169 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1150772358 17:68052308-68052330 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1150775895 17:68081051-68081073 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1150778360 17:68099717-68099739 TCCACTGGATGAAGCCAGCTGGG + Intergenic
1150792314 17:68208250-68208272 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1150804530 17:68308836-68308858 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1151866512 17:76806551-76806573 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1152618964 17:81351957-81351979 TCCACTGGGTGAAGCCAGCTAGG - Intergenic
1153070467 18:1098668-1098690 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1154057156 18:11023573-11023595 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1154080119 18:11248127-11248149 GCCTCAGGGTGAGGGCAGCTCGG - Intergenic
1154128679 18:11716870-11716892 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1155294953 18:24376503-24376525 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1155349229 18:24890186-24890208 ACCTCTGGCTGGAGACAGCTGGG + Intergenic
1155493259 18:26420001-26420023 ACCTCAGGGTGACGACGGCTGGG - Intergenic
1155611633 18:27673812-27673834 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1155806221 18:30175018-30175040 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1155976851 18:32140258-32140280 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1156038752 18:32795010-32795032 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1156079574 18:33316594-33316616 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1156943248 18:42795666-42795688 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1156969755 18:43139956-43139978 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1157856826 18:51111767-51111789 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1158352003 18:56572727-56572749 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1158460658 18:57643583-57643605 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1159167874 18:64725563-64725585 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1159472865 18:68879919-68879941 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1159744039 18:72209564-72209586 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1161564163 19:4990473-4990495 ACCTGAGTCTGAAGGCAGCGTGG + Intronic
1162091009 19:8280277-8280299 TCCACTGCCTGAAGCCAGCTGGG - Intronic
1162093243 19:8295115-8295137 TCCACTGCCTGAAGCCAGCTGGG - Intronic
1162198724 19:9006125-9006147 GCCTCAGGCTCAAGCAAACTGGG + Intergenic
1162230226 19:9259950-9259972 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1162233026 19:9283376-9283398 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1162237829 19:9322033-9322055 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1162261978 19:9541250-9541272 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1162436135 19:10660421-10660443 GCCTCAGGCTGCAGACAGCAAGG - Intronic
1163176801 19:15569898-15569920 TGCCCAGGCTGGAGCCAGCTGGG - Intergenic
1163181646 19:15608570-15608592 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1163218931 19:15900120-15900142 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1164270512 19:23668451-23668473 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1164975874 19:32572021-32572043 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1165036461 19:33037038-33037060 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1165137063 19:33676111-33676133 ACCTCAGGCCAAATCCAGCATGG + Intronic
1165415454 19:35691020-35691042 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1165728971 19:38132122-38132144 ACCTCAGCCTGAAAATAGCTGGG - Intronic
1166046127 19:40232189-40232211 AGCTCAGGGTGAGGGCAGCTGGG - Exonic
1166486933 19:43221845-43221867 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1167420483 19:49399705-49399727 GCCTCAGCCTGAAGCCATGTAGG - Intronic
1168659968 19:58157743-58157765 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
924967452 2:91426-91448 ACCACTGGGTGAAGCCAGCTGGG + Intergenic
925088613 2:1134649-1134671 TCCACTGGGTGAAGCCAGCTAGG - Intronic
925098895 2:1229522-1229544 TCCACTGGGTGAAGCCAGCTGGG - Intronic
926044315 2:9698576-9698598 ACCTTAGGCTGAGGCCAGTGAGG + Intergenic
926097569 2:10091854-10091876 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
926616551 2:15002458-15002480 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
926850728 2:17193948-17193970 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
927357155 2:22186735-22186757 TCCACTGGGTGAAGCCAGCTAGG + Intergenic
927640315 2:24841616-24841638 ACTGCAGGCAGAAGACAGCTGGG + Exonic
927777874 2:25915898-25915920 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
927900484 2:26814796-26814818 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
928106433 2:28473068-28473090 TCCACTGGGTGAAGCCAGCTGGG + Intronic
928248193 2:29650269-29650291 ACCCCATCCTGAAGCCAGGTAGG + Intronic
928493146 2:31804076-31804098 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
928617863 2:33057350-33057372 CCCACTGGGTGAAGCCAGCTGGG - Intronic
928732025 2:34242518-34242540 AACTCTGTCTGAAACCAGCTTGG + Intergenic
928936981 2:36688697-36688719 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
929379768 2:41336027-41336049 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
929890786 2:45917594-45917616 TCCACTGGGTGAAGCCAGCTGGG - Intronic
930038094 2:47100169-47100191 TCCACTGGGTGAAGCCAGCTGGG + Intronic
930039294 2:47107716-47107738 TCCACTGGGTGAAGCCAGCTGGG + Intronic
930468150 2:51780259-51780281 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
930485593 2:52007245-52007267 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
931708771 2:64969441-64969463 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
932127025 2:69153803-69153825 ACCTCTGGGTGAGGACAGCTAGG + Intronic
932178357 2:69622477-69622499 TCCACTGGGTGAAGCCAGCTGGG + Intronic
932240009 2:70148742-70148764 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
932421482 2:71604012-71604034 CCCTCAGCCTGCAGCCTGCTTGG - Intronic
932457695 2:71860059-71860081 ATGGCAGCCTGAAGCCAGCTTGG + Intergenic
932983417 2:76698114-76698136 AGCACTGGATGAAGCCAGCTGGG - Intergenic
933049998 2:77590909-77590931 TCCACTGGGTGAAGCCAGCTGGG + Intronic
933060761 2:77734703-77734725 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
933442017 2:82326207-82326229 CCCACTGGGTGAAGCCAGCTGGG - Intergenic
933506393 2:83181436-83181458 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
933511387 2:83245890-83245912 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
933712080 2:85334337-85334359 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
933750565 2:85600160-85600182 TCCTCAGGCTCCAGCCAGCAGGG + Intronic
934085201 2:88503531-88503553 TCCGCGGGGTGAAGCCAGCTGGG + Intergenic
934298286 2:91760762-91760784 ACAACAGGCAGAAGCCACCTGGG - Intergenic
934725961 2:96619149-96619171 ACCTCATCCTGGAGCCAGCAGGG + Intronic
935084218 2:99828605-99828627 GCCACAGGCTGAAACCAGCAAGG + Intronic
935500267 2:103830745-103830767 CCCTCAGGCCGAGGCCAGGTTGG + Intergenic
935896764 2:107747264-107747286 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
936346970 2:111682287-111682309 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
937220701 2:120341736-120341758 GCCTCAGCCTGGAGCCAGGTGGG - Intergenic
937505453 2:122531647-122531669 TCCTCAGGGGGAAGCCAGATCGG + Intergenic
937711767 2:124987334-124987356 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
938401104 2:130991881-130991903 TCCACTGGGTGAAGCCAGCTGGG + Intronic
938725949 2:134109270-134109292 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
938931131 2:136087992-136088014 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
938954237 2:136283388-136283410 AGCTCAGGGGCAAGCCAGCTTGG + Intergenic
939003207 2:136758857-136758879 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
939053138 2:137331531-137331553 TCCACTGGGTGAAGCCAGCTGGG - Intronic
939229844 2:139410778-139410800 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
939509545 2:143089521-143089543 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
939738691 2:145880827-145880849 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
939869131 2:147507366-147507388 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
939956466 2:148531750-148531772 ACCCCAGGCTGGGGGCAGCTGGG - Intergenic
939972470 2:148678324-148678346 TCCACTGGGTGAAGCCAGCTGGG - Intronic
940145584 2:150542246-150542268 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
940662470 2:156564248-156564270 ACCTTAGGATGAAACCACCTTGG - Intronic
941240168 2:163026713-163026735 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
941397848 2:164994678-164994700 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
941476509 2:165956985-165957007 ACCGCTAGGTGAAGCCAGCTGGG - Intergenic
941747999 2:169107691-169107713 ACCTCAGTTTGCAGGCAGCTGGG + Intergenic
942299525 2:174548515-174548537 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
943024288 2:182608833-182608855 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
943106082 2:183546602-183546624 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
943222918 2:185133039-185133061 GCCACTGGATGAAGCCAGCTGGG + Intergenic
943790111 2:191922024-191922046 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
943906044 2:193502385-193502407 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
943941374 2:194002681-194002703 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
943942803 2:194020597-194020619 TCCACAGGGTGAAGCCAGCTGGG + Intergenic
944058412 2:195547275-195547297 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
944228517 2:197371003-197371025 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
944482872 2:200175176-200175198 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
944616522 2:201465728-201465750 ACCACAGGCTGAGGCCCTCTGGG - Intronic
944729718 2:202503807-202503829 TCCACTGGGTGAAGCCAGCTGGG + Intronic
944857851 2:203785497-203785519 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
945069710 2:205977621-205977643 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
945451416 2:210000540-210000562 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
945575393 2:211524301-211524323 TCCACTGGGTGAAGCCAGCTGGG - Intronic
945870296 2:215219499-215219521 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
945872751 2:215245664-215245686 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
946054072 2:216885660-216885682 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
946982085 2:225229372-225229394 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
947026713 2:225744570-225744592 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
947103873 2:226648448-226648470 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
947412068 2:229851153-229851175 TCCACTGGGTGAAGCCAGCTAGG + Intronic
947464174 2:230326538-230326560 ACCAGAGGCTGGAGCCAGCATGG - Intergenic
947473080 2:230415580-230415602 ACCAGAGGCTGGAGCCAGCATGG - Intergenic
947591894 2:231390612-231390634 CCCTCTGGCTGGAGCCACCTTGG + Intergenic
947931979 2:233972392-233972414 TCCACTGGGTGAAGCCAGCTGGG - Intronic
948157373 2:235794127-235794149 ACCCCATGGTGAGGCCAGCTTGG + Intronic
948457843 2:238115213-238115235 TCCTCAGGCTGTGGCCACCTTGG + Intronic
948487788 2:238291706-238291728 ACCTACGGCTGACCCCAGCTTGG + Intergenic
1168903870 20:1388934-1388956 CCCTGAGGCTGGAGCCTGCTCGG - Intronic
1170091185 20:12591243-12591265 AGCTCATGCAGAAGCCAGGTGGG - Intergenic
1170420324 20:16186241-16186263 ACCCCAGGCAGAAACCAGCCAGG + Intergenic
1170649579 20:18227201-18227223 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1170806768 20:19639552-19639574 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1170989972 20:21292316-21292338 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1171003025 20:21433879-21433901 CCTTCAAGCAGAAGCCAGCTGGG + Intergenic
1171464803 20:25319946-25319968 CCCACAGGCTGAGGCCAGCACGG - Intronic
1171959896 20:31485875-31485897 ACCGCAGGCCGGAGACAGCTTGG - Intergenic
1171973338 20:31578492-31578514 TCCACAGGGTGAAGCCAGCCGGG - Intergenic
1172431772 20:34898725-34898747 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1175080659 20:56417797-56417819 AGCTTAGGCTGACGCCAGGTAGG - Intronic
1175210151 20:57348834-57348856 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1175254230 20:57629225-57629247 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1175412111 20:58777254-58777276 ACCTCAGGCTGAAAGCAAGTAGG + Intergenic
1175720659 20:61284940-61284962 ACAACAGGCTGCAGCCAGATTGG + Intronic
1176078288 20:63259161-63259183 AGCCTGGGCTGAAGCCAGCTGGG - Intronic
1176332224 21:5559575-5559597 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1176344758 21:5733432-5733454 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1176351572 21:5854016-5854038 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1176395533 21:6261376-6261398 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1176441624 21:6727728-6727750 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1176465886 21:7054797-7054819 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1176489447 21:7436575-7436597 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1176500069 21:7591023-7591045 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1176539079 21:8131502-8131524 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1176558030 21:8314547-8314569 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1176872171 21:14092889-14092911 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1177182311 21:17757511-17757533 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1177565751 21:22818782-22818804 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1177629159 21:23704132-23704154 ATCCCAGGCTGAAGCCACCCAGG - Intergenic
1177637697 21:23807452-23807474 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1177795970 21:25778751-25778773 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1178082160 21:29077119-29077141 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1178467992 21:32866241-32866263 TCCTCAGGCTGGTGCCAGCATGG + Intergenic
1178585569 21:33868241-33868263 TCCACTGGGTGAAGCCAGCTAGG - Intronic
1178983276 21:37283109-37283131 TCCACTGGGTGAAGCCAGCTAGG - Intergenic
1179248745 21:39655763-39655785 ACCCCAGACTGACGCCAGCCTGG - Intronic
1180755168 22:18155924-18155946 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1181077594 22:20392334-20392356 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1181450463 22:23016976-23016998 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1181501053 22:23315713-23315735 ACCACAGTCTGAGGCCAGCCTGG - Exonic
1182067067 22:27438349-27438371 ACCCCCGCCAGAAGCCAGCTGGG - Intergenic
1182219136 22:28743951-28743973 ACCTCTGGCTGAAGAAATCTGGG - Exonic
1182337961 22:29597989-29598011 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1183352818 22:37343455-37343477 ACCTCAGACTGGAGGCAGCCTGG - Intergenic
1183422040 22:37717764-37717786 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1183605872 22:38866513-38866535 ACCTCCGGCTCGCGCCAGCTGGG + Exonic
1184089556 22:42285078-42285100 GCCTCAGGCTGAAGCGAGCATGG - Intronic
1184584334 22:45437165-45437187 TCCACTGGATGAAGCCAGCTGGG + Intergenic
1184803030 22:46774105-46774127 AACTCAGGCTGCTGCCTGCTGGG + Intronic
1184851901 22:47125816-47125838 ACCCCAGCCTGAGCCCAGCTGGG + Intronic
1184906168 22:47488230-47488252 TCCACTGGATGAAGCCAGCTGGG - Intergenic
1185117938 22:48948809-48948831 ACCTGACGCTGCACCCAGCTAGG + Intergenic
1185229041 22:49670130-49670152 TCCACTGGCTGAAGCCAGCTAGG - Intergenic
1203244029 22_KI270733v1_random:47857-47879 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
949259060 3:2084064-2084086 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
949770079 3:7569029-7569051 TCCACTGGATGAAGCCAGCTGGG + Intronic
949923530 3:9022893-9022915 GCCTCAGGCAGAGCCCAGCTGGG - Intronic
950068879 3:10136360-10136382 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
950207963 3:11094436-11094458 TCCACTGGATGAAGCCAGCTGGG + Intergenic
950256884 3:11513169-11513191 TCCACTGGGTGAAGCCAGCTGGG - Intronic
950400888 3:12768716-12768738 TCCACTGGGTGAAGCCAGCTGGG - Intronic
950418630 3:12883286-12883308 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
950568096 3:13783312-13783334 AGCCCCTGCTGAAGCCAGCTGGG + Intergenic
950632719 3:14293608-14293630 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
950668503 3:14511507-14511529 ACCCCAGGCTGAGGCCACCAAGG - Intronic
950929474 3:16774153-16774175 TCCACTGGATGAAGCCAGCTGGG + Intergenic
951024773 3:17817596-17817618 TCCACTGGGTGAAGCCAGCTGGG - Intronic
951332877 3:21387175-21387197 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
951734861 3:25852146-25852168 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
952058010 3:29473428-29473450 TCCACTGGGTGAAGCCAGCTGGG - Intronic
952275330 3:31870552-31870574 TCCACTGGGTGAAGCCAGCTGGG + Intronic
952355459 3:32579151-32579173 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
952360553 3:32626071-32626093 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
952393793 3:32903248-32903270 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
952568450 3:34684791-34684813 ACCTCTGGCTCGAGGCAGCTAGG - Intergenic
952593722 3:34988814-34988836 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
952713393 3:36453739-36453761 TCCACTGGGTGAAGCCAGCTGGG + Intronic
952935685 3:38396752-38396774 ACCTAGGGCTGGAGACAGCTGGG - Intronic
953124423 3:40077832-40077854 TCCACTGGGTGAAGCCAGCTGGG - Intronic
953522416 3:43656350-43656372 TCCACTGGGTGAAGCCAGCTGGG - Intronic
953714699 3:45307124-45307146 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
954226124 3:49182588-49182610 TCCACTGGGTGAAGCCAGCTGGG - Intronic
954579519 3:51695695-51695717 AACTCAGGCTGAAGTGAGGTGGG + Intronic
954620218 3:51991009-51991031 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
954754040 3:52829414-52829436 GCCTCAGGCTGAACCCAGTGAGG + Intronic
955183436 3:56692317-56692339 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
956392122 3:68785236-68785258 TCCACTGGGTGAAGCCAGCTGGG - Intronic
956563706 3:70612250-70612272 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
957009104 3:74985049-74985071 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
957277550 3:78108825-78108847 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
957371566 3:79300653-79300675 TCCACTGGGTGAAGCCAGCTGGG + Intronic
957419580 3:79951294-79951316 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
957532378 3:81456776-81456798 ACCTCAAGGTTAAGCAAGCTTGG - Intergenic
957631021 3:82715767-82715789 TCCACGGGGTGAAGCCAGCTGGG + Intergenic
957804822 3:85133784-85133806 TCCACTGGGTGAAGCCAGCTGGG - Intronic
957919600 3:86731434-86731456 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
957921903 3:86758036-86758058 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
958022721 3:88016125-88016147 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
958936783 3:100263691-100263713 ACTTCAGGCTATAACCAGCTAGG - Intronic
959422816 3:106149070-106149092 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
960149718 3:114238213-114238235 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
960199329 3:114812620-114812642 TCCACTGGGTGAAGCCAGCTGGG - Intronic
960227454 3:115184812-115184834 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
960685567 3:120290106-120290128 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
961032388 3:123617982-123618004 ACTTCAGACTGAGGCCAGTTGGG - Intronic
961461923 3:127056194-127056216 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
961464973 3:127076208-127076230 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
961746639 3:129068231-129068253 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
961874461 3:130011030-130011052 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
962271418 3:133980445-133980467 AGCTCAGCCTGGAGCCAACTAGG - Intronic
962383685 3:134916279-134916301 TCCACTGGGTGAAGCCAGCTGGG - Intronic
962590992 3:136889924-136889946 TCCACTGGGTGAAGCCAGCTGGG - Intronic
962998212 3:140651828-140651850 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
963055333 3:141181906-141181928 TCCTCAGGCAGAACCAAGCTTGG + Intergenic
963397295 3:144750245-144750267 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
963440490 3:145333814-145333836 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
963533336 3:146497724-146497746 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
963673430 3:148280489-148280511 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
963742842 3:149097644-149097666 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
963744234 3:149109793-149109815 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
963760671 3:149284423-149284445 TCCACCGGGTGAAGCCAGCTGGG + Intergenic
963862259 3:150323407-150323429 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
964014464 3:151928593-151928615 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
964032406 3:152152856-152152878 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
964117893 3:153155672-153155694 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
964198219 3:154088408-154088430 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
964444083 3:156741014-156741036 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
964751940 3:160060965-160060987 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
964982427 3:162702844-162702866 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
964983075 3:162710431-162710453 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
965003600 3:162987756-162987778 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
965044056 3:163552246-163552268 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
965078077 3:164003405-164003427 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
965200267 3:165649240-165649262 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
965220818 3:165924260-165924282 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
965245161 3:166258391-166258413 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
965256858 3:166424369-166424391 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
965288124 3:166843248-166843270 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
965298208 3:166976270-166976292 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
965446544 3:168780545-168780567 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
965837452 3:172867219-172867241 TCCACTGGCTGAAGCCAGCTGGG + Intergenic
966096704 3:176213339-176213361 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
966190932 3:177271651-177271673 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
966372349 3:179262977-179262999 TCCACTGGGTGAAGCCAGCTGGG - Intronic
967234021 3:187367499-187367521 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
967499071 3:190176972-190176994 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
967718438 3:192789469-192789491 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
968412731 4:403923-403945 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
968469750 4:773965-773987 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
968614823 4:1572703-1572725 ACCTGTGGCAGAAGCCAGGTGGG + Intergenic
968716240 4:2161705-2161727 TCCGCTGGGTGAAGCCAGCTGGG + Intronic
969017777 4:4115791-4115813 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
969228500 4:5814329-5814351 ACCGCAGGATGAAGCCAGCACGG + Intronic
969272462 4:6112095-6112117 TCCTCAGGCTGAATTCAGCAGGG - Intronic
969440821 4:7215566-7215588 TCCACTGGGTGAAGCCAGCTGGG + Intronic
969460134 4:7324620-7324642 GGCCCAGGCTGCAGCCAGCTAGG - Intronic
969736215 4:8992821-8992843 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
969795414 4:9524384-9524406 TCCACTGGATGAAGCCAGCTGGG - Intergenic
970051319 4:11918071-11918093 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
970073835 4:12195382-12195404 AGCTGAGGCTGAAGCCAGAGGGG + Intergenic
970182669 4:13415820-13415842 TCCACTGGGTGAAGCCAGCTGGG + Intronic
970272190 4:14359050-14359072 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
970391296 4:15615351-15615373 TCCACTGGGTGAAGCCAGCTGGG + Intronic
970576788 4:17436483-17436505 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
970579217 4:17458749-17458771 ACCTCAGGCTGAACTCCCCTCGG + Intergenic
970649242 4:18159193-18159215 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
970673083 4:18418260-18418282 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
970803613 4:20004452-20004474 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
970817804 4:20178934-20178956 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
971281601 4:25246547-25246569 TCCACTGGGTGAAGCCAGCTGGG - Intronic
971639903 4:29117791-29117813 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
971709540 4:30093144-30093166 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
972392635 4:38627340-38627362 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
973048658 4:45567490-45567512 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
973146405 4:46831485-46831507 TCCACTGGGTGAAGCCAGCTGGG + Intronic
973190234 4:47377966-47377988 TCCACTGGATGAAGCCAGCTGGG - Intronic
973587681 4:52409668-52409690 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
973765016 4:54155048-54155070 TCCACTGGGTGAAGCCAGCTGGG - Intronic
973797963 4:54448279-54448301 ACCTCATTCTGAAGCCAGTTAGG + Intergenic
973854185 4:54993907-54993929 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
973878193 4:55241892-55241914 TCCACTGGATGAAGCCAGCTGGG + Intergenic
974147500 4:57965862-57965884 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
974484705 4:62491820-62491842 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
974590508 4:63942805-63942827 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
974781660 4:66561415-66561437 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
974827840 4:67152317-67152339 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
974892216 4:67896488-67896510 GCCACTGGGTGAAGCCAGCTGGG - Intergenic
974992792 4:69115163-69115185 TCCACTGGGTGAAGCCAGCTGGG - Intronic
975055480 4:69924328-69924350 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
975298891 4:72766293-72766315 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
975517089 4:75259218-75259240 AACTGAGGCTGGAGCCAGATTGG + Intergenic
975745020 4:77466780-77466802 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
975755947 4:77571100-77571122 TCCACTGGGTGAAGCCAGCTGGG + Intronic
975995007 4:80303231-80303253 GCCACTGGGTGAAGCCAGCTGGG + Intronic
976406462 4:84665136-84665158 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
976565602 4:86547681-86547703 TCCACTGGGTGAAGCCAGCTGGG + Intronic
976736224 4:88313126-88313148 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
977151671 4:93520521-93520543 TCCTGAGGCAGAAGCTAGCTTGG + Intronic
977470618 4:97438005-97438027 TCCACTGGGTGAAGCCAGCTGGG - Intronic
977507771 4:97923458-97923480 TCCACTGGATGAAGCCAGCTGGG + Intronic
977606838 4:98993404-98993426 ACCACTGGGTGTAGCCAGCTGGG - Intergenic
978207115 4:106092322-106092344 TCCACTGGGTGAAGCCAGCTGGG - Intronic
978241804 4:106525267-106525289 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
978285663 4:107073631-107073653 TCCACCGGATGAAGCCAGCTGGG + Intronic
978463542 4:108984314-108984336 TCCACTGGGTGAAGCCAGCTGGG - Intronic
978999498 4:115200117-115200139 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
979290737 4:118976973-118976995 TCCTCTAGGTGAAGCCAGCTGGG - Intronic
979308401 4:119174223-119174245 TCCTCTAGGTGAAGCCAGCTGGG + Intronic
979445605 4:120808534-120808556 TCCACTGGGTGAAGCCAGCTGGG - Intronic
979688674 4:123538354-123538376 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
979825624 4:125229505-125229527 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
979857433 4:125651686-125651708 TCCACTGGGTGAAGCCAGCTAGG - Intergenic
979899624 4:126201214-126201236 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
980739340 4:136929432-136929454 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
980774576 4:137421457-137421479 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
980815638 4:137942508-137942530 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
980824032 4:138052869-138052891 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
980827247 4:138088515-138088537 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
981169485 4:141605356-141605378 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
981452317 4:144912542-144912564 AATTTAGGCTGAACCCAGCTGGG + Intergenic
982647743 4:158044564-158044586 TCCCCTGGGTGAAGCCAGCTGGG + Intergenic
982728266 4:158928139-158928161 TCCACTGGATGAAGCCAGCTGGG + Intronic
982814499 4:159868955-159868977 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
982863472 4:160482205-160482227 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
982921351 4:161277664-161277686 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
983026176 4:162739978-162740000 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
983060416 4:163153288-163153310 TCCACTGGGTGAAGCCAGCTGGG + Intronic
983135018 4:164068791-164068813 TCCACTGGGTGAAGCCAGCTGGG + Intronic
983230582 4:165125863-165125885 TCCACTGGGTGAAGCCAGCTGGG - Intronic
983734805 4:171043642-171043664 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
983752927 4:171298718-171298740 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
983893866 4:173060402-173060424 ACATCTGGCTTATGCCAGCTAGG + Intergenic
984238737 4:177193119-177193141 TCCACCGGGTGAAGCCAGCTGGG - Intergenic
984776026 4:183482611-183482633 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
984901827 4:184592304-184592326 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
985203332 4:187506068-187506090 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
985366480 4:189236743-189236765 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
985403787 4:189616569-189616591 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
985714707 5:1448841-1448863 ACATCAGGCTGAATCAACCTGGG + Intergenic
986175206 5:5346491-5346513 ACATCAGGCTGTGGCCAGATTGG - Intergenic
986263833 5:6175332-6175354 ACCTTTGGCTAAGGCCAGCTGGG - Intergenic
986422258 5:7597326-7597348 ACCTCAGGCTGCGCCCAGCTGGG + Intronic
986440584 5:7777963-7777985 GCCTCCTGCTGAAGGCAGCTTGG + Intronic
986626256 5:9725765-9725787 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
986993353 5:13578907-13578929 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
987146169 5:14993727-14993749 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
987156681 5:15096438-15096460 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
987283813 5:16436618-16436640 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
987347361 5:16990904-16990926 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
987352219 5:17032398-17032420 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
987355922 5:17062627-17062649 TCCACCGGGTGAAGCCAGCTGGG + Intergenic
987383929 5:17311696-17311718 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
987836608 5:23170600-23170622 CCCACAACCTGAAGCCAGCTAGG + Intergenic
987896374 5:23951734-23951756 TCCACTGGGTGAAGCCAGCTGGG + Exonic
987990169 5:25199945-25199967 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
988086905 5:26485203-26485225 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
988177351 5:27743898-27743920 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
988201697 5:28077591-28077613 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
988279481 5:29127546-29127568 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
988489066 5:31691936-31691958 TCCACTGGGTGAAGCCAGCTGGG - Intronic
988684656 5:33515311-33515333 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
988883676 5:35532065-35532087 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
989003284 5:36783018-36783040 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
989652938 5:43713690-43713712 ACTTCAGCCTCAAGCCAGGTAGG + Intergenic
989712189 5:44412534-44412556 CCCTCAAACTCAAGCCAGCTAGG + Intergenic
989956930 5:50369875-50369897 TCCACAGGGTGAAGCCAGCTGGG + Intergenic
990243321 5:53837365-53837387 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
990323094 5:54648942-54648964 CCCGCTGGGTGAAGCCAGCTGGG - Intergenic
990490146 5:56295762-56295784 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
990512064 5:56498583-56498605 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
990880302 5:60530735-60530757 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
990992663 5:61700859-61700881 TTCTCAGGCTGAATCAAGCTTGG + Intronic
991330156 5:65485401-65485423 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
991567481 5:68020325-68020347 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
992947528 5:81824151-81824173 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
993430181 5:87823229-87823251 ACCTCAGGGTGATGGCACCTTGG + Intergenic
993529106 5:89003547-89003569 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
993678526 5:90847440-90847462 TCCACTGGGTGAAGCCAGCTGGG - Intronic
993770375 5:91917714-91917736 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
993803459 5:92374816-92374838 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
993822122 5:92631769-92631791 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
994096424 5:95851604-95851626 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
994230044 5:97301586-97301608 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
994251431 5:97541799-97541821 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
994254714 5:97579917-97579939 TCCACTGGGTGAAGCCAGCTAGG - Intergenic
994507199 5:100657200-100657222 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
994701622 5:103141957-103141979 TCCACTGGGTGAAGCCAGCTGGG - Intronic
994769708 5:103966249-103966271 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
994841474 5:104929439-104929461 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
994928885 5:106154695-106154717 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
994932363 5:106206012-106206034 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
995032388 5:107494633-107494655 TCCACTGGGTGAAGCCAGCTGGG + Intronic
995482250 5:112604915-112604937 ACCTCAGGCTGCAGTCTGCATGG + Intergenic
995568750 5:113457581-113457603 TCCACTGGGTGAAGCCAGCTGGG + Intronic
995656586 5:114433118-114433140 TCCACTGGGTGAAGCCAGCTGGG + Intronic
995975910 5:118034263-118034285 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
996107124 5:119517542-119517564 TCCACTGGGTGAAGCCAGCTGGG + Intronic
996435780 5:123430992-123431014 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
996530482 5:124522060-124522082 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
997241952 5:132314240-132314262 AACTCAGGGTGAGGCCAGATAGG - Intronic
997352290 5:133239397-133239419 TCCACTGGGTGAAGCCAGCTGGG + Intronic
997760644 5:136444652-136444674 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
998335648 5:141370210-141370232 TCCTCCCGCTGCAGCCAGCTCGG + Intronic
998854962 5:146385797-146385819 CTCTCAGGCTGCAGCCTGCTTGG - Intergenic
999217405 5:149946842-149946864 CCCTCAGCCTGAAGCTACCTAGG - Intergenic
999348620 5:150845863-150845885 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
999406265 5:151309630-151309652 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
999855200 5:155586675-155586697 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1000066116 5:157694276-157694298 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1000329107 5:160193819-160193841 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1000547693 5:162622282-162622304 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1000609217 5:163356251-163356273 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1000619058 5:163461666-163461688 GCCTCAGCCTGTAGTCAGCTGGG - Intronic
1000889248 5:166784465-166784487 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1001179264 5:169503419-169503441 CCTTCAGGGTGAAGCCTGCTGGG - Intergenic
1001579908 5:172791486-172791508 GCCTAAGGCTGATGCCAGCCAGG + Intergenic
1001636527 5:173213870-173213892 ACCACTGAGTGAAGCCAGCTGGG + Intergenic
1001646874 5:173288633-173288655 ACCACAGGCTGAGGCTACCTGGG + Intergenic
1001820781 5:174708644-174708666 GGCTCAGGATGAAGCCAACTTGG - Intergenic
1001843641 5:174901955-174901977 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1001859606 5:175042257-175042279 AGCTCCAGCTGAAGCCTGCTGGG - Intergenic
1002004554 5:176221948-176221970 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1002187195 5:177459846-177459868 GCCCCTGGCTGAAGGCAGCTTGG - Intronic
1002221821 5:177688672-177688694 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1002789297 6:426123-426145 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1002817786 6:695018-695040 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1003070293 6:2940031-2940053 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1003100274 6:3171202-3171224 TCCACTGGGTGAAGCCAGCTAGG + Intergenic
1003176936 6:3758556-3758578 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1003213818 6:4090528-4090550 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1003224388 6:4191210-4191232 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1003489964 6:6613200-6613222 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1003578109 6:7315613-7315635 TCCACGGGGTGAAGCCAGCTGGG + Intronic
1003591689 6:7441654-7441676 ACCACCGGGTGAAGCCAGCTGGG + Intergenic
1003671621 6:8164771-8164793 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1003717784 6:8666406-8666428 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1003748096 6:9024704-9024726 CCCACTGGGTGAAGCCAGCTGGG + Intergenic
1003749636 6:9041128-9041150 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1003770069 6:9290366-9290388 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1003836135 6:10074633-10074655 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1003845814 6:10172192-10172214 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1003881999 6:10487710-10487732 TCCACTGGGTGAAGCCAGCTTGG - Intergenic
1003908211 6:10721027-10721049 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1004045286 6:12017854-12017876 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1004200347 6:13541978-13542000 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1004220694 6:13743647-13743669 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1004452312 6:15758682-15758704 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1004499589 6:16198022-16198044 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1004511728 6:16288692-16288714 TCCACTGGATGAAGCCAGCTGGG + Intronic
1004647989 6:17581057-17581079 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1004665455 6:17745230-17745252 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1004689013 6:17976117-17976139 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1004865971 6:19854356-19854378 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1004883773 6:20032747-20032769 TCCACAGAGTGAAGCCAGCTGGG + Intergenic
1004908586 6:20259941-20259963 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1004912702 6:20301690-20301712 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1005042190 6:21609822-21609844 TCCTCTGGGTGAAGCCAGCTGGG - Intergenic
1005059372 6:21761599-21761621 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1005596130 6:27380990-27381012 TCCACTGGATGAAGCCAGCTGGG - Intronic
1005600785 6:27424750-27424772 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1005710296 6:28497949-28497971 ACCTCACTCTGAAGCTATCTGGG + Intergenic
1005712087 6:28512224-28512246 TCCACTGGCTGAAGCCAGCTGGG + Intronic
1005749001 6:28866406-28866428 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1005758812 6:28949716-28949738 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1005978150 6:30816220-30816242 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1006005856 6:31000903-31000925 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1006008393 6:31021158-31021180 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1006122274 6:31814788-31814810 ACCTCAGGCTTAAACCAACTAGG + Intronic
1006128033 6:31852453-31852475 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1006352724 6:33532828-33532850 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1006406288 6:33847655-33847677 ACCTCAGGCCAAGGCCAACTGGG - Intergenic
1006605002 6:35249761-35249783 ACCCCACTCTGAAGCCAGCCTGG + Exonic
1006696090 6:35931708-35931730 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1006748817 6:36364154-36364176 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1006978284 6:38124251-38124273 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1008230747 6:48983354-48983376 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1008230971 6:48984341-48984363 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1008254149 6:49275881-49275903 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1008270414 6:49483344-49483366 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1008567906 6:52786922-52786944 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1008587446 6:52962554-52962576 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1009376507 6:62977651-62977673 AACTCAGGCTCCACCCAGCTGGG + Intergenic
1009407032 6:63326373-63326395 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1009510730 6:64547648-64547670 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1009685422 6:66949652-66949674 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1010066354 6:71686548-71686570 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1010235560 6:73572454-73572476 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1010277879 6:73990589-73990611 TCCACTGGATGAAGCCAGCTGGG - Intergenic
1010785374 6:79994031-79994053 AGCTGAGGCTGAAGCCAGCATGG - Intergenic
1011246600 6:85326406-85326428 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1011620022 6:89234411-89234433 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1011772530 6:90690828-90690850 GCCTCAGCCTGCAGACAGCTGGG - Intergenic
1012189260 6:96260868-96260890 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1012598934 6:101070698-101070720 TCCTCTAGGTGAAGCCAGCTGGG + Intergenic
1012733479 6:102910642-102910664 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1012760420 6:103294326-103294348 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1012851067 6:104446723-104446745 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1013410704 6:109881068-109881090 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1013694728 6:112689289-112689311 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1013853297 6:114541772-114541794 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1013908477 6:115246114-115246136 ACCTCAGGCTAAAGTGATCTGGG + Intergenic
1013963371 6:115928004-115928026 TCCGCATGGTGAAGCCAGCTGGG - Intergenic
1014055967 6:117015191-117015213 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1014280886 6:119441442-119441464 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1014460188 6:121686377-121686399 TCCACTGGATGAAGCCAGCTGGG - Intergenic
1014499199 6:122165050-122165072 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1014718639 6:124892411-124892433 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1014739085 6:125126292-125126314 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1014788555 6:125644891-125644913 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1015572167 6:134633466-134633488 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1015586271 6:134779528-134779550 ACTTCAGGCTGAGTTCAGCTGGG - Intergenic
1015600428 6:134905168-134905190 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1015856142 6:137626516-137626538 ACATCAGGCTGAAGCAGGCAAGG + Intergenic
1016092748 6:139999506-139999528 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1016104652 6:140148043-140148065 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1016217284 6:141618652-141618674 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1016911942 6:149207990-149208012 ACATCAGCCAGAAGCCAGTTTGG - Intergenic
1017325175 6:153134060-153134082 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1017437069 6:154425740-154425762 ACTTGAGGCTGAAGCAAGCAAGG - Intronic
1017581133 6:155866677-155866699 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1017728254 6:157291023-157291045 ACATCAGGCTGATGGCAGCTAGG - Exonic
1018064154 6:160114439-160114461 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1018624564 6:165765209-165765231 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1019219487 6:170462981-170463003 AACTGAGGCAGAAGCCAGCGAGG + Intergenic
1019944182 7:4313859-4313881 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1019965671 7:4496852-4496874 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1020163995 7:5793931-5793953 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1020375276 7:7478469-7478491 TCCACTGGGTGAAGCCAGCTAGG - Intronic
1020662121 7:10995476-10995498 TCCACTGGGTGAAGCCAGCTAGG - Intronic
1020784351 7:12556084-12556106 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1022174068 7:27856978-27857000 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1022750520 7:33219411-33219433 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1023128016 7:36974176-36974198 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1023440420 7:40179666-40179688 ACATCTGGATGAAGCCATCTTGG - Intronic
1024335552 7:48202835-48202857 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1024465987 7:49711695-49711717 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1024691365 7:51806273-51806295 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1024700553 7:51900807-51900829 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1024735733 7:52302816-52302838 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1024741849 7:52363045-52363067 CCCACTGGGTGAAGCCAGCTGGG + Intergenic
1024794423 7:53004369-53004391 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1024834128 7:53495459-53495481 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1026203027 7:68231470-68231492 GCCACTGGGTGAAGCCAGCTGGG + Intergenic
1026236864 7:68534910-68534932 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1026322157 7:69277398-69277420 ACCTCAGACTCATACCAGCTGGG - Intergenic
1026510498 7:71023438-71023460 ATATCTGGCTGAAGACAGCTAGG + Intergenic
1026512423 7:71038033-71038055 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1026516649 7:71078425-71078447 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1026909884 7:74085285-74085307 ATCCTGGGCTGAAGCCAGCTGGG - Intronic
1027563960 7:79767886-79767908 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1027579633 7:79977526-79977548 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1027667456 7:81057405-81057427 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1027698202 7:81437012-81437034 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1027779030 7:82500008-82500030 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1027868179 7:83673749-83673771 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1028070181 7:86441006-86441028 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1028303220 7:89228691-89228713 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1028392759 7:90334851-90334873 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1028778404 7:94705931-94705953 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1028852436 7:95552388-95552410 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1029076217 7:97936320-97936342 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1029904034 7:104072198-104072220 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1030215650 7:107042284-107042306 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1030292730 7:107888256-107888278 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1030366942 7:108657172-108657194 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1030599904 7:111581866-111581888 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1030733570 7:113017784-113017806 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1030780494 7:113593756-113593778 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1030980613 7:116181905-116181927 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1031110044 7:117596547-117596569 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1031215352 7:118883256-118883278 ACCTCAGGCTAAAGTAATCTGGG + Intergenic
1031239568 7:119219984-119220006 ACCTAAAGCTGGAGCCAGCCTGG + Intergenic
1031409290 7:121422165-121422187 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1031605458 7:123763140-123763162 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1032561525 7:132898529-132898551 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1033065153 7:138146559-138146581 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1033664023 7:143424320-143424342 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1034097995 7:148426846-148426868 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1034561293 7:151880925-151880947 TCCTCTGGCTGAAGCAAGCTGGG - Intergenic
1034651852 7:152697559-152697581 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1034655959 7:152730198-152730220 TCCACTAGCTGAAGCCAGCTGGG - Intergenic
1034967018 7:155398067-155398089 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1034967715 7:155401643-155401665 CCCTCAGCCAGAAGACAGCTTGG + Intergenic
1035151108 7:156873928-156873950 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1035958148 8:4105901-4105923 ACCTTGGGCTGAAGCCTGCAGGG - Intronic
1036123748 8:6044983-6045005 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1036260541 8:7236088-7236110 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1036306072 8:7603434-7603456 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1036312578 8:7694644-7694666 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1036356918 8:8051419-8051441 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1036440948 8:8781314-8781336 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1036554586 8:9847722-9847744 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1036801444 8:11795200-11795222 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1036831428 8:12023040-12023062 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1036851235 8:12203308-12203330 CCCACTTGCTGAAGCCAGCTGGG - Intergenic
1036872599 8:12445582-12445604 CCCACTTGCTGAAGCCAGCTGGG - Intergenic
1037417495 8:18667605-18667627 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1037433705 8:18841153-18841175 AACTCAGGCCTAAGGCAGCTAGG + Intronic
1037559013 8:20055163-20055185 TCCCCTGGGTGAAGCCAGCTGGG + Intergenic
1037567830 8:20132432-20132454 AACTCTGGCTGATTCCAGCTTGG + Intergenic
1038638356 8:29304692-29304714 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1038639486 8:29311900-29311922 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1038654230 8:29434200-29434222 AATTCAAGCTGAAGCTAGCTAGG - Intergenic
1038847530 8:31244072-31244094 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1039129758 8:34249693-34249715 AACTCAGGGTGGAGCCAGGTAGG - Intergenic
1039466268 8:37787566-37787588 AGCTCAGGCTGATGGCAGCTTGG - Intronic
1039587689 8:38720234-38720256 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1039637383 8:39180565-39180587 TCCACTGGATGAAGCCAGCTGGG + Intronic
1039919459 8:41883012-41883034 ACCTCTGGCTGAGGCCAGGGAGG - Intronic
1040014556 8:42689950-42689972 TCCACCGGGTGAAGCCAGCTGGG + Intergenic
1040351352 8:46571963-46571985 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1040622149 8:49102925-49102947 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1040659904 8:49559356-49559378 ACCTCAGAGAGAAGCCACCTGGG - Intergenic
1040723205 8:50350356-50350378 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1040791084 8:51231039-51231061 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1040804416 8:51377957-51377979 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1040806758 8:51404746-51404768 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1040954841 8:52969756-52969778 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1041034581 8:53775823-53775845 CCCACTGGGTGAAGCCAGCTGGG - Intronic
1041636587 8:60152890-60152912 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1041914601 8:63126512-63126534 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1043073262 8:75665388-75665410 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1043102161 8:76060375-76060397 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1043110178 8:76170009-76170031 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1043129856 8:76447538-76447560 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1043701199 8:83290788-83290810 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1043857235 8:85276464-85276486 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1044075902 8:87821272-87821294 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1044088563 8:87971552-87971574 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1044404963 8:91816759-91816781 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1044613088 8:94113768-94113790 AACTCATGCTGAAGTCAGGTTGG - Intergenic
1044788765 8:95824077-95824099 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1044853641 8:96452715-96452737 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1045192103 8:99893368-99893390 AGCTCACTCCGAAGCCAGCTGGG + Intronic
1045383558 8:101649581-101649603 AGCTCATTCTGAAGCCATCTCGG - Intronic
1045682997 8:104682266-104682288 AACTCAGGCTGAAGTCATATGGG - Intronic
1045743271 8:105387255-105387277 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1045954048 8:107886238-107886260 ACCACAGGGTGAAAGCAGCTTGG - Intergenic
1046208809 8:111040760-111040782 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1046284974 8:112082942-112082964 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1046288986 8:112133130-112133152 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1046445419 8:114311788-114311810 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1046450788 8:114386593-114386615 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1046621287 8:116531482-116531504 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1047180700 8:122585028-122585050 ACAACAGGCTGCAGCCAGCAGGG - Intergenic
1047184458 8:122619282-122619304 AAATCACTCTGAAGCCAGCTTGG - Intergenic
1047405630 8:124583452-124583474 ACCTCTGGGTGAAGCCTGATAGG - Intronic
1047591490 8:126331719-126331741 ATCTCAGTGTGAGGCCAGCTGGG - Intergenic
1047631622 8:126714560-126714582 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1048112931 8:131487465-131487487 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1048341899 8:133546670-133546692 AAATCAGGCTGAGGCCAGATAGG + Intronic
1048575962 8:135690380-135690402 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1048655340 8:136530375-136530397 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1048676886 8:136793729-136793751 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1048757419 8:137755042-137755064 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1048789256 8:138084577-138084599 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1049157771 8:141077078-141077100 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1049500392 8:142959914-142959936 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1049858002 8:144875565-144875587 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1050250022 9:3734203-3734225 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1050624186 9:7486259-7486281 AGCTGAGGCTGAGGCCTGCTGGG - Intergenic
1051109928 9:13624569-13624591 ACCTCAGGATGGAGCCAGGCTGG + Intergenic
1051383384 9:16480944-16480966 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1051439935 9:17073040-17073062 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1051449322 9:17178335-17178357 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1051463879 9:17354373-17354395 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1052056600 9:23914382-23914404 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1052979629 9:34438383-34438405 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1053393517 9:37752361-37752383 TCCACTGGATGAAGCCAGCTGGG + Intronic
1054722534 9:68617461-68617483 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1055049442 9:71963975-71963997 TCCACGGGGTGAAGCCAGCTGGG + Intronic
1055248505 9:74275863-74275885 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1055461383 9:76523651-76523673 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1055651451 9:78410432-78410454 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1055949828 9:81720225-81720247 AGCTCAGGCTGAAAACAGCAGGG - Intergenic
1055985447 9:82054304-82054326 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1056216360 9:84408917-84408939 CCCACTGGGTGAAGCCAGCTGGG + Intergenic
1056305841 9:85289481-85289503 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1056377152 9:86025606-86025628 CCCTCAGGCTGCAGCCACATTGG + Intergenic
1056575614 9:87854011-87854033 AGCTCAGGCTGAAAACAGCAGGG - Intergenic
1056799613 9:89681689-89681711 CCCACTGGGTGAAGCCAGCTGGG + Intergenic
1056914118 9:90729928-90729950 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1057007958 9:91577216-91577238 ACTTCACGCACAAGCCAGCTGGG - Intronic
1057300780 9:93880346-93880368 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1057543782 9:96001642-96001664 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1057726989 9:97574611-97574633 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1058174790 9:101724038-101724060 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1058235618 9:102486906-102486928 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1058286642 9:103187328-103187350 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1058585307 9:106501263-106501285 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1058727610 9:107818239-107818261 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1059409621 9:114123920-114123942 AATCCAGGCTGAGGCCAGCTTGG - Intergenic
1059791078 9:117642688-117642710 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1059810693 9:117852422-117852444 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1060091421 9:120746782-120746804 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1060305302 9:122406122-122406144 TCCACTGGATGAAGCCAGCTGGG - Intergenic
1060594152 9:124838656-124838678 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1061368824 9:130186642-130186664 AGCTCAGGCAGAAGCCAAATTGG + Intronic
1061499692 9:130994695-130994717 ACCTCAGGCTGAACACAGCAGGG + Intergenic
1062146131 9:134990955-134990977 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1062520562 9:136955986-136956008 GCCTCGGGCTGGAGCCTGCTGGG + Intronic
1062534939 9:137017295-137017317 ACCGCAGGCCGAGGCCAGCTTGG + Exonic
1062537390 9:137026998-137027020 AACCCAGGCTGCAGTCAGCTGGG - Intronic
1203429871 Un_GL000195v1:80757-80779 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1203460357 Un_GL000220v1:30944-30966 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1185503781 X:617972-617994 ACTTCAGGGTGCAGCCAGGTTGG - Intergenic
1186152518 X:6690431-6690453 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1186293287 X:8122045-8122067 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1186295575 X:8144894-8144916 TCCACCGGGTGAAGCCAGCTGGG - Intergenic
1186638783 X:11433072-11433094 CCCCCAGCCTGAAGACAGCTGGG + Intronic
1187139131 X:16575889-16575911 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1187877388 X:23815603-23815625 GCCTCAGGCTGAAACCACCTGGG + Intergenic
1188189603 X:27157440-27157462 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1188242754 X:27809728-27809750 TCCACTGGGTGAAGCCAGCTGGG + Intronic
1188881913 X:35499715-35499737 CCCACTGGGTGAAGCCAGCTGGG + Intergenic
1188946839 X:36315784-36315806 ACATGAGGCTCAAGGCAGCTAGG - Intronic
1189408088 X:40743843-40743865 ACCTTAGGCTGAAACCAGTCAGG + Intergenic
1189896771 X:45664741-45664763 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1190045792 X:47110927-47110949 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1190303941 X:49072046-49072068 ACCTCAGCCTGCAGCCAACCGGG + Intronic
1190413889 X:50163255-50163277 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1191053837 X:56222528-56222550 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1191663806 X:63677443-63677465 ACTAAAGGCTGATGCCAGCTTGG - Intronic
1192186830 X:68952551-68952573 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1192225808 X:69226963-69226985 ACCTCAGGCCTGGGCCAGCTTGG + Intergenic
1192804411 X:74496540-74496562 ACCCCAGGCTGAAGTAAGCCAGG + Intronic
1193003357 X:76587967-76587989 ATCCCAGGGTGAAGCCAACTTGG + Intergenic
1193040132 X:76996582-76996604 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1193259080 X:79383861-79383883 ATCTCGGGATGAAGCCAACTTGG - Intergenic
1193271143 X:79531019-79531041 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1193803962 X:85972282-85972304 TCCACTGGGTGAAGCCAGCTGGG - Intronic
1194025525 X:88746298-88746320 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1194384459 X:93236174-93236196 TCCACTGGGTGAAGCCAGCTAGG + Intergenic
1195257960 X:103107272-103107294 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1195259296 X:103117034-103117056 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1195325005 X:103751375-103751397 TCTTCAGGCTGAAGCTAGGTTGG - Intergenic
1195460197 X:105115674-105115696 CCCACTGGGTGAAGCCAGCTGGG - Intronic
1195479415 X:105326165-105326187 ACCTCAGCCTGCAGATAGCTGGG + Intronic
1195896290 X:109749258-109749280 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1195909531 X:109875818-109875840 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1196103052 X:111867462-111867484 ACCTCTGGCTGAAGCAATCAGGG - Intronic
1196319456 X:114270484-114270506 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1196413082 X:115440505-115440527 CCCTCAGGAAGAAGACAGCTTGG + Intergenic
1196616227 X:117769470-117769492 TCCGCTGGGTGAAGCCAGCTGGG + Intergenic
1196705832 X:118716860-118716882 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1196845130 X:119891027-119891049 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1196860782 X:120025692-120025714 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1197000210 X:121431452-121431474 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1197015905 X:121626239-121626261 ACATCAGGCGGAAGTCAGCCAGG + Intergenic
1197331100 X:125155392-125155414 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1197376723 X:125690502-125690524 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1197608017 X:128607061-128607083 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1198468181 X:136921800-136921822 TCCACGGGGTGAAGCCAGCTGGG + Intergenic
1198872240 X:141188462-141188484 CCCACTGGGTGAAGCCAGCTGGG - Intergenic
1198972513 X:142298169-142298191 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1199050158 X:143228615-143228637 TCCCCTGGGTGAAGCCAGCTGGG - Intergenic
1199134098 X:144231175-144231197 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1199285024 X:146046111-146046133 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1199356168 X:146866806-146866828 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1199628181 X:149758962-149758984 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1199831721 X:151555115-151555137 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1199832861 X:151562586-151562608 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1200103499 X:153700097-153700119 ACCTCTGACTAATGCCAGCTGGG - Intergenic
1200125776 X:153813869-153813891 AACTCAGGGTGAAGCCCTCTTGG - Intronic
1200470819 Y:3584014-3584036 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1200789752 Y:7288796-7288818 ACATGAGGCTGAAGCCTGCTGGG - Intergenic
1200873561 Y:8128444-8128466 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1201285405 Y:12374933-12374955 TCCACTGGCTGAAGCCAGCTGGG - Intergenic
1201422974 Y:13820129-13820151 TCCACTGGGTGAAGCCAGCTAGG - Intergenic
1201469173 Y:14314887-14314909 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1201715884 Y:17043550-17043572 TCCACTGGGTGAAGCCAGCTGGG + Intergenic
1201901034 Y:19046488-19046510 TCCGCTGGGTGAAGCCAGCTGGG - Intergenic
1202137015 Y:21676587-21676609 TCCACTGGGTGAAGCCAGCTGGG - Intergenic
1202260807 Y:22968475-22968497 ACCTCAGGCTGGAACCAGTCTGG - Intergenic
1202413795 Y:24602216-24602238 ACCTCAGGCTGGAACCAGTCTGG - Intergenic
1202456990 Y:25067870-25067892 ACCTCAGGCTGGAACCAGTCTGG + Intergenic