ID: 1128313579

View in Genome Browser
Species Human (GRCh38)
Location 15:66646488-66646510
Sequence TCAGGCTGAAGCCAGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 328}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128313566_1128313579 28 Left 1128313566 15:66646437-66646459 CCCCTGGGATAGTGGTCAGTGCG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1128313579 15:66646488-66646510 TCAGGCTGAAGCCAGCTGGGTGG 0: 1
1: 0
2: 1
3: 36
4: 328
1128313568_1128313579 26 Left 1128313568 15:66646439-66646461 CCTGGGATAGTGGTCAGTGCGTG 0: 1
1: 0
2: 0
3: 31
4: 850
Right 1128313579 15:66646488-66646510 TCAGGCTGAAGCCAGCTGGGTGG 0: 1
1: 0
2: 1
3: 36
4: 328
1128313573_1128313579 -5 Left 1128313573 15:66646470-66646492 CCGGCATGCCTGGAAACCTCAGG 0: 1
1: 0
2: 1
3: 15
4: 255
Right 1128313579 15:66646488-66646510 TCAGGCTGAAGCCAGCTGGGTGG 0: 1
1: 0
2: 1
3: 36
4: 328
1128313567_1128313579 27 Left 1128313567 15:66646438-66646460 CCCTGGGATAGTGGTCAGTGCGT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1128313579 15:66646488-66646510 TCAGGCTGAAGCCAGCTGGGTGG 0: 1
1: 0
2: 1
3: 36
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128313579 Original CRISPR TCAGGCTGAAGCCAGCTGGG TGG Intronic
900548736 1:3243079-3243101 TCCGGCTGGAGCGACCTGGGAGG + Intronic
900630189 1:3630985-3631007 ACAGCCTGCAGACAGCTGGGCGG - Exonic
900857040 1:5194567-5194589 ACAGGATGAAGGCAGCTGGGTGG + Intergenic
901053525 1:6437830-6437852 ACAGGGAGATGCCAGCTGGGAGG + Intronic
901261390 1:7874465-7874487 TGAGGCTGCAGCCTTCTGGGTGG - Intergenic
901722182 1:11208070-11208092 TCAGGATGAAAACATCTGGGTGG + Intronic
901871659 1:12142168-12142190 TCAGCCTGAAGCCACCCGGCAGG + Intronic
901929120 1:12585712-12585734 TCTGGCAGGAGCCACCTGGGCGG - Intronic
902387433 1:16083754-16083776 TCAGGGTGGTGCCAGCTGAGGGG + Intergenic
902480751 1:16710314-16710336 ACAGGGAGATGCCAGCTGGGAGG - Intergenic
902631230 1:17705803-17705825 CAGGGCTGGAGCCAGCTGGGGGG - Intergenic
902992425 1:20197593-20197615 TGTGGCTGGAGCCAGGTGGGTGG + Intergenic
903500872 1:23799672-23799694 GCAGGCTGAGGCCAGCTCAGGGG + Intronic
903686354 1:25135040-25135062 TCAGGCTCAAGGCAGATGGATGG + Intergenic
904252365 1:29234300-29234322 TCAGCATGAAGCCAGCTAGGAGG + Intergenic
905214502 1:36397409-36397431 TCAGGCTGCAGCCGGGTGGCTGG - Intronic
906034279 1:42740911-42740933 TCAGGCTGATGCCAGAAGGTTGG - Intergenic
907049325 1:51318874-51318896 TCATGCGAAGGCCAGCTGGGAGG - Intronic
909700256 1:78514015-78514037 TCAGGCAGAAGCCTGCTGCAGGG + Intronic
911183813 1:94884180-94884202 TGGGGCTGCAGCCAGGTGGGAGG - Intronic
912086602 1:106014013-106014035 TCAGGCAGAAGCCTGCTGCAAGG - Intergenic
912861137 1:113214912-113214934 TCAGGCAGAAGCCTGCTGCAGGG - Intergenic
913212177 1:116590714-116590736 CCAAGCTTAAGCCAGCTGGCAGG - Intronic
913342196 1:117769684-117769706 CCAGGCTGTAGCCAGGTGGGGGG - Intergenic
913495277 1:119422675-119422697 TCTGTATGAAGCCAGGTGGGTGG - Exonic
913611316 1:120512358-120512380 TCAGGCTGAACATAGCTGTGGGG - Intergenic
914954890 1:152153007-152153029 TCAGGCAGAAAACAGCGGGGAGG + Intergenic
915592893 1:156880580-156880602 TCTGGCTGTGGCCAGCTAGGAGG - Intronic
915694132 1:157721933-157721955 TCAGGCAGAAGCCTGCTGTAGGG - Intergenic
916900406 1:169216209-169216231 TCATTCTGAAGCTACCTGGGTGG - Intronic
917466074 1:175277338-175277360 TGAGGCCAAAGCCTGCTGGGCGG + Intergenic
917732260 1:177886507-177886529 TGAGTCTGTAGGCAGCTGGGTGG - Intergenic
918177689 1:182059993-182060015 TCAGACTGAAGCCTGCTCTGGGG + Intronic
919789438 1:201281109-201281131 TCTGCCTGTTGCCAGCTGGGTGG + Intergenic
920506536 1:206519026-206519048 TGGGGCTGAAGGCTGCTGGGTGG + Intronic
921073791 1:211683898-211683920 GCAGGCTGATGCCATGTGGGTGG - Intergenic
921098744 1:211910330-211910352 TCAGGGTGAAGCCAACCAGGAGG + Intergenic
922726754 1:227926358-227926380 TGAGCCAGCAGCCAGCTGGGGGG - Intronic
922802269 1:228369924-228369946 TCAGGCTGAAGACAGAGGGAGGG - Exonic
923055581 1:230424490-230424512 TCATGCTGCAGCCTGCTGGGAGG - Intronic
924024138 1:239815183-239815205 TAAGACTGAAGCCAGTTGAGAGG + Intronic
1062983815 10:1747949-1747971 ACAAGCTGAAGCCACCTGGTTGG - Intergenic
1063072906 10:2684784-2684806 TCAGACTGAAGACAGATGAGTGG - Intergenic
1063135049 10:3208886-3208908 TCAGGCTCCAGCCAGCTCGTCGG - Intergenic
1065272972 10:24055199-24055221 TGAGGCTGCAGTCAGCTGAGAGG + Intronic
1065841155 10:29702404-29702426 TCACGCAGAACCCAGCGGGGAGG - Intronic
1067947417 10:50698726-50698748 TCAGGCTGAAAACAGCAGGGAGG + Intergenic
1069977791 10:72228991-72229013 TCAGGATCAAACCATCTGGGAGG + Intronic
1070161439 10:73868914-73868936 TGAGGCTGCGGCAAGCTGGGTGG - Intronic
1070882731 10:79863713-79863735 TCAGGCTGAAAACAGCAGGGAGG + Intergenic
1071649297 10:87380015-87380037 TCAGGCTGAAAACAGCAGGGAGG + Intergenic
1071978037 10:90975140-90975162 TCAGGCCAAGCCCAGCTGGGAGG + Intergenic
1072441454 10:95459713-95459735 TCAGAGTGAAGCCAGCTGCCAGG + Intronic
1074779107 10:116787854-116787876 CCACGCTGAAGCCAGTTTGGAGG - Intergenic
1075320752 10:121490009-121490031 TCAGGCTGAGGCCAGGTGTTAGG - Intronic
1076068311 10:127466175-127466197 TCAGGCTGCAGCCACCTGATGGG - Intergenic
1076260346 10:129060031-129060053 ACAGGCTGAAGCTGGATGGGAGG + Intergenic
1076505985 10:130973001-130973023 TCATGCTGAGACCAGCTTGGTGG - Intergenic
1076672837 10:132132675-132132697 TCTGCCTGAAGACAGCTGTGCGG + Intronic
1076881672 10:133242444-133242466 ACAGGCTGAGGCCAGCGGAGTGG - Intergenic
1077315334 11:1917186-1917208 TCAGGCTGGATCCAGCCTGGGGG + Intergenic
1077343150 11:2034962-2034984 CCAGGCCGGAGCCAGCTGGAGGG - Intergenic
1078244898 11:9565138-9565160 TCACACTGGACCCAGCTGGGAGG - Intergenic
1079445911 11:20555945-20555967 TCAGGCTGTACACAGCAGGGGGG + Intergenic
1080579569 11:33631295-33631317 TCAGGCTGGAGCCAAGGGGGTGG - Intronic
1081704377 11:45172406-45172428 TCATCCTGAAGCTATCTGGGGGG + Intronic
1082139851 11:48595981-48596003 TCAGACTGAAGCCTGCTGCAGGG - Intergenic
1083391010 11:62350103-62350125 TAAGGCTGAAACCTGCTGGGCGG - Intronic
1083766241 11:64842921-64842943 TCAGGCAGAAGCCCGCAGCGGGG + Intronic
1083781916 11:64923212-64923234 ATGGGCTGTAGCCAGCTGGGAGG + Intronic
1084119853 11:67062671-67062693 TCAGGCCCTGGCCAGCTGGGAGG - Intronic
1084798505 11:71525792-71525814 TCAGGCAGAAGCCTGCTGCAGGG + Intergenic
1085048578 11:73367808-73367830 GCAGGCTGAAGGCAGGTGGGCGG - Exonic
1085199592 11:74693695-74693717 TGAGGCTGAGGCCAGGTAGGAGG - Intergenic
1085409902 11:76284692-76284714 GCAGGGTGAAGACAGCAGGGCGG + Intergenic
1085521259 11:77140235-77140257 TTAGGCTGAGGGCAGCTGGAAGG - Intronic
1086921106 11:92588061-92588083 TGAGGATGAAGCAAGGTGGGAGG - Intronic
1087017396 11:93567391-93567413 TTAGCCTCAACCCAGCTGGGAGG + Intergenic
1088926434 11:114307785-114307807 CCAGACTGAAGCAAGCAGGGAGG - Intronic
1090260428 11:125315095-125315117 TCTGGCTGAAGCCTGCTCAGAGG + Intronic
1090647446 11:128777199-128777221 TCAGGCTCAGGGCCGCTGGGGGG + Intronic
1090801943 11:130178616-130178638 TCAGGCTGTAACCAGGTGTGGGG + Intronic
1091197537 11:133744812-133744834 TGAGGCTGGAGCCATCTGGGTGG - Intergenic
1091266432 11:134275746-134275768 TCAGGCTGAAGTCACTTGGCGGG - Intronic
1202826136 11_KI270721v1_random:90151-90173 CCAGGCCGGAGCCAGCTGGAGGG - Intergenic
1091792950 12:3281846-3281868 TGAGGCTGAGGCCAGCAGGGTGG - Intronic
1095938081 12:47706134-47706156 TCAGGATGGAACCAGCTTGGTGG + Intergenic
1096649148 12:53053403-53053425 ACAGGCTGAAGTCACCTGGAAGG - Exonic
1097035703 12:56122103-56122125 GCAGACTGAAGCCAGCAGAGAGG + Exonic
1097865898 12:64558988-64559010 TCAGGCTGCAGCCAGAGGGCTGG - Intergenic
1098166709 12:67705937-67705959 TCAGCTTGAAGACAGCTGGCAGG - Intergenic
1098327972 12:69322526-69322548 TCAGTCTGAAGCCCTATGGGTGG - Intergenic
1099408476 12:82293451-82293473 GCTAGCTGCAGCCAGCTGGGAGG + Intronic
1100774287 12:97957319-97957341 TTAGGCTGAGCTCAGCTGGGTGG - Intergenic
1101155576 12:101924661-101924683 TGAGAATGAAGCCAGCTGAGAGG - Intronic
1102432494 12:112894570-112894592 TCCGGTTTCAGCCAGCTGGGAGG - Exonic
1103044254 12:117722353-117722375 TGAGGCTGAAACCTACTGGGCGG + Intronic
1103478951 12:121238606-121238628 TCAGGCAGCACCCAGCTGTGGGG - Exonic
1104934651 12:132358004-132358026 TCTGGCTGGAGCCACCAGGGGGG + Intergenic
1105215423 13:18281336-18281358 CCAAGCTTAAGCCAGCTGGCAGG - Intergenic
1108493225 13:51001363-51001385 TCAGGCTCCAGGCAGCTGGGTGG - Intergenic
1110436365 13:75481739-75481761 TCATCCTGAATGCAGCTGGGCGG + Exonic
1110766563 13:79286020-79286042 TCATGCTGAAAGCAGATGGGAGG - Intergenic
1110890131 13:80688701-80688723 CCAGGCAGAAGCCTGCTGAGAGG - Intergenic
1111419857 13:87998500-87998522 TCAGGCAGAAGCCAGCTGCAGGG + Intergenic
1117485792 14:56195437-56195459 TCAGCCTCAAACCAGCTGTGAGG - Intronic
1117994641 14:61467338-61467360 ACATGTTGAAGCCAGCTGGAGGG - Intronic
1118743207 14:68756131-68756153 ACAGCCTGAAGCCAGCAGGCAGG - Intergenic
1119555229 14:75547744-75547766 TCAGGATGGAGCCAGTTGGCTGG - Intergenic
1121671200 14:95711947-95711969 ACAGGCTGAAGGCTGGTGGGAGG - Intronic
1121792807 14:96711737-96711759 TCAGGCTGCAGCCACCTGAATGG - Intergenic
1121867193 14:97373501-97373523 TCCAGCTGAAGCAAGCTGAGGGG + Intergenic
1122937601 14:104967225-104967247 CCAGGCTCCTGCCAGCTGGGTGG - Intronic
1123019962 14:105393036-105393058 TCAGGCGGAGGCCAGCTGGGTGG + Intronic
1123482390 15:20644234-20644256 TCAGGGTGGGGCCACCTGGGTGG - Intergenic
1124015187 15:25867858-25867880 TCTGGCTGGACCCAGGTGGGAGG - Intergenic
1126797905 15:52275231-52275253 GAATGCTGATGCCAGCTGGGTGG + Intronic
1128211950 15:65909226-65909248 TCAGGGTGAGGCAGGCTGGGAGG + Intronic
1128313579 15:66646488-66646510 TCAGGCTGAAGCCAGCTGGGTGG + Intronic
1132013909 15:98299685-98299707 TCCGGCTGGAGCCCTCTGGGTGG - Intergenic
1132731815 16:1366551-1366573 TCAGGGAGAAGGCAGCTGCGGGG + Intronic
1133264064 16:4572627-4572649 TGAGAATGAAGCCAACTGGGAGG - Intronic
1134242177 16:12514110-12514132 TCAAGCATTAGCCAGCTGGGAGG - Intronic
1134849777 16:17470563-17470585 TCGGGCTGCAGCCGGCTCGGCGG + Exonic
1137700370 16:50493658-50493680 TAAGGCTGAAGCCATGTGGTAGG + Intergenic
1139340927 16:66267442-66267464 TCAGGCTCCAGACAACTGGGTGG + Intergenic
1139780778 16:69349693-69349715 TCACGAGGAAGCCAGCTGAGTGG + Intronic
1141067470 16:80925684-80925706 TCAGGCAGGAGCGGGCTGGGTGG + Intergenic
1141152171 16:81571935-81571957 GAAGGCTGAGGGCAGCTGGGTGG - Intronic
1141313111 16:82934377-82934399 TTAGGCTGCACACAGCTGGGGGG + Intronic
1141521172 16:84580640-84580662 TCAGGTGGAAGCCAGATGGTGGG - Intronic
1141531410 16:84648933-84648955 GCCGGCTGGAGCCTGCTGGGCGG + Intronic
1142407865 16:89901197-89901219 GCAGGCTGAGTCCATCTGGGCGG - Intronic
1143166341 17:4899093-4899115 TCTGGCAGAAGGCAGCTGGCGGG + Exonic
1143309856 17:5979123-5979145 TCAAGCTGGCCCCAGCTGGGGGG + Intronic
1143380281 17:6491519-6491541 TCTGGCTGAAGCAGGCTGGGGGG + Intronic
1143516223 17:7420530-7420552 TCAGGGTGGGGCCAGATGGGAGG + Intronic
1143543406 17:7582705-7582727 GCAGGCTGTGGCCATCTGGGAGG - Intergenic
1144671675 17:17136350-17136372 TCAGGCTGCTGCCATCTGGCTGG - Exonic
1145309295 17:21692751-21692773 TCAGGCCCCAGTCAGCTGGGGGG + Intronic
1147331135 17:39700187-39700209 TCCGGCTGGACCCGGCTGGGAGG - Exonic
1148755854 17:49972575-49972597 TCCGGCTGCGGCCAGCGGGGTGG - Intronic
1149225515 17:54465619-54465641 TGAGGCTGCAGCCTGGTGGGGGG - Intergenic
1151664607 17:75538359-75538381 TCAGGATGAAGACAAGTGGGGGG - Intronic
1152944238 17:83190526-83190548 TCAAGCTGAGGCCAGCTTGGAGG + Intergenic
1153835340 18:8959029-8959051 GCAGGCTGAACACAGCAGGGAGG + Intergenic
1155210819 18:23599725-23599747 TCAGGCTGTAGGCACCTGTGGGG + Exonic
1155233272 18:23794445-23794467 CCAAGTTGAAGCCAGCTGTGGGG + Intronic
1155623476 18:27807874-27807896 TTAGGCTGGTCCCAGCTGGGTGG - Intergenic
1156263789 18:35467984-35468006 GCAGGCTGCAGCCAGAGGGGTGG + Intronic
1156461850 18:37325709-37325731 CATGGCTGAAGGCAGCTGGGAGG - Intronic
1157551390 18:48584086-48584108 CAAGGCTGCAGCCAGCTGGGTGG - Intronic
1158325976 18:56314335-56314357 TCAGGCATCAGCCAGATGGGGGG - Intergenic
1159954380 18:74508935-74508957 TCAGGCAGAAGTCAGCGTGGGGG - Intronic
1160338927 18:78069886-78069908 ACAGGCAGAAGCCAGTAGGGTGG - Intergenic
1160599705 18:80003221-80003243 TGAGGATGTAGCCAGCTGGATGG - Intronic
1160759004 19:773155-773177 GGAGGCTGAGGCCAGGTGGGTGG - Intergenic
1160779773 19:872588-872610 GCAGGATGAAGCCGGGTGGGTGG + Intronic
1160911260 19:1474824-1474846 GCAGGACGGAGCCAGCTGGGTGG + Exonic
1161036494 19:2087918-2087940 TCAGACTGAAGCCATCCAGGAGG - Intronic
1161796835 19:6392199-6392221 ACAGGCTGAATGAAGCTGGGTGG - Intronic
1162302768 19:9853593-9853615 TCAAGCTTAAGCGAACTGGGGGG - Intergenic
1163696337 19:18765435-18765457 GGGGGCTGACGCCAGCTGGGCGG - Exonic
1163774418 19:19209546-19209568 TGAGGCTGGAGCGTGCTGGGGGG - Intergenic
1163934670 19:20432046-20432068 GCAGGCTTAAGCCACCTGAGGGG + Intergenic
1164696025 19:30245052-30245074 TGAGGCTGAAGCCTGGTGGATGG - Intronic
1167068675 19:47206338-47206360 TCAGCCTTCAGCCAGCTGGCAGG + Intronic
1202714788 1_KI270714v1_random:36219-36241 ACAGGGAGATGCCAGCTGGGAGG - Intergenic
925337908 2:3112051-3112073 TGAGGCTGAAGACACCTGTGCGG + Intergenic
925793993 2:7523238-7523260 TCAAGCAGAAGGCAGCTGGCTGG - Intergenic
925899295 2:8496869-8496891 TCAGGCAGGAGGCAGCTGGCCGG + Intergenic
926252566 2:11164091-11164113 GCACGCAGAAGCCAGGTGGGTGG - Intronic
927988427 2:27429362-27429384 TCAGGGTGAGGACAGCTGAGAGG + Intronic
930025117 2:47025024-47025046 TCAGGGTCAAGCCACCTGAGAGG - Intronic
930063504 2:47310336-47310358 TAAGGGTGAGGCCTGCTGGGTGG - Intergenic
930704478 2:54490699-54490721 TCAGGTAGATGCCAGATGGGAGG + Intronic
932620729 2:73263782-73263804 CCCTGCTGAAGGCAGCTGGGGGG - Exonic
933750567 2:85600163-85600185 TCAGGCTCCAGCCAGCAGGGTGG + Intronic
934298906 2:91765391-91765413 CCAAGCTTAAGCCAGCTGGCAGG + Intergenic
934536541 2:95139162-95139184 CCAGGCAGAAGCCTGCTGTGGGG + Intronic
934852028 2:97707582-97707604 TCAGATTGAAGCCAGCGGGGAGG + Intergenic
935353441 2:102176424-102176446 TCAGGCTTCAGCTGGCTGGGTGG + Exonic
935390629 2:102548797-102548819 TATGAATGAAGCCAGCTGGGAGG - Intergenic
936586747 2:113764723-113764745 TCAGGCAGAAGTCTGCTGTGGGG - Intergenic
936800326 2:116258080-116258102 CCAGGCTGAACACAGCAGGGAGG + Intergenic
938928489 2:136065728-136065750 TTATGCTGGAACCAGCTGGGGGG + Intergenic
938954238 2:136283391-136283413 TCAGGGGCAAGCCAGCTTGGTGG + Intergenic
939157089 2:138538513-138538535 TCATGCAGAAGAGAGCTGGGTGG - Intronic
939736544 2:145854272-145854294 TAAGGCTGAGACCTGCTGGGCGG + Intergenic
942065795 2:172270452-172270474 TGAGGCTGCAGCCTGGTGGGGGG - Intergenic
942071845 2:172323440-172323462 GCAGGCTGAAGCCAGTTGTAAGG - Intergenic
942521545 2:176809352-176809374 TCAGGCAGATGGCAGCTGTGAGG + Intergenic
943557835 2:189427386-189427408 CCAGGCAGAAGCCAGCTGCAGGG + Intergenic
943779396 2:191805249-191805271 TCCTGCTGATGCTAGCTGGGTGG + Intergenic
947927661 2:233935780-233935802 GCAGGCAGAAGGAAGCTGGGAGG + Intronic
948174953 2:235935981-235936003 CCAGGCAGGAGCCAGCGGGGAGG - Intronic
948457845 2:238115216-238115238 TCAGGCTGTGGCCACCTTGGAGG + Intronic
948885642 2:240882106-240882128 TCAGGCTGACGGCAGCAGTGGGG + Intergenic
1172434447 20:34919188-34919210 TCAGCCTGAGGCCAGGTGAGAGG + Intronic
1173476707 20:43364853-43364875 TCAGGCTGGGGAAAGCTGGGAGG - Intergenic
1174624701 20:51904424-51904446 GGAGGGAGAAGCCAGCTGGGAGG + Intergenic
1174930140 20:54804685-54804707 TCAGGCTGAGGCCACCTCTGTGG - Intergenic
1176721507 21:10397511-10397533 GTAGGCTGGAGCCAGGTGGGAGG + Intergenic
1177754510 21:25329721-25329743 TGAGGCTGAAGCCATGTGTGGGG + Intergenic
1178293219 21:31387083-31387105 GAAGGCTGTAGCCACCTGGGGGG - Intronic
1179479459 21:41668442-41668464 TCACCCTGCGGCCAGCTGGGCGG + Intergenic
1180302699 22:11050286-11050308 GTAGGCTGGAGCCAGGTGGGAGG + Intergenic
1180710474 22:17836094-17836116 TCAGTGAGAAGACAGCTGGGGGG - Intronic
1180843049 22:18968122-18968144 TCAGGGTGTAGCCAGGTCGGGGG - Intergenic
1181474619 22:23160650-23160672 GGAGGCTGGAGCCAGGTGGGAGG + Intronic
1181995943 22:26882635-26882657 ACAGGCTGAAGCCAACTGAGTGG + Intergenic
1182098643 22:27642461-27642483 TCAGGCTGGAGCCACCAGGCAGG - Intergenic
1182219134 22:28743948-28743970 TCTGGCTGAAGAAATCTGGGTGG - Exonic
1182931105 22:34175080-34175102 TAAGGGTGAAGCCAGCTCAGTGG + Intergenic
1182997934 22:34831556-34831578 TCAGGATGAAGCCATCTGGAAGG - Intergenic
1183679207 22:39317280-39317302 TCCGGCTGAAACCAGATGGCTGG + Intronic
1183697252 22:39430439-39430461 CCTGGCTGAGGCCATCTGGGAGG - Exonic
1184559426 22:45253357-45253379 TCCTGCTGAAGCCAGCTGAGAGG + Intergenic
1184773939 22:46613889-46613911 TCTGTCTCAAGCCTGCTGGGAGG + Intronic
1185336409 22:50272529-50272551 GCAGGAAGAGGCCAGCTGGGAGG - Intergenic
949349451 3:3110706-3110728 GCATTCTGAAGACAGCTGGGTGG - Intronic
951911127 3:27751795-27751817 TAAGGCTCAAGTCAGCTGGCAGG - Intergenic
952947663 3:38490262-38490284 GCAGCCTGAAGCCAGCGGGCAGG - Exonic
953884063 3:46705740-46705762 TTAGGCAGAGGCCAGCTGGCTGG - Intronic
954277753 3:49553842-49553864 GCTGTGTGAAGCCAGCTGGGAGG - Intergenic
954792166 3:53141545-53141567 TGTGGCTGAAGCCAGGTGGATGG + Intergenic
956477392 3:69637064-69637086 TGAGGCTGCAGCCTGGTGGGGGG - Intergenic
959838878 3:110951288-110951310 CCAGGCAGAAGCCTGCTGCGGGG + Intergenic
960631952 3:119741491-119741513 TCAGGCGGCACACAGCTGGGAGG - Intronic
960724724 3:120658723-120658745 TCAGGCAGAAGCCAGCTGCAGGG - Intronic
961318212 3:126055006-126055028 GCAAGCAGAAGCCACCTGGGAGG + Intronic
961546249 3:127635823-127635845 TTAGGCTGCAGTCAGCTGGGTGG + Intronic
961678059 3:128580070-128580092 ACAAGCAGAAGCCAGCTTGGAGG - Intergenic
962201383 3:133403602-133403624 TCAGGCTGGAGCAAGCAGTGGGG + Intronic
962607068 3:137041342-137041364 CCAGGCTGCAGCCAACTGGAGGG - Intergenic
962616129 3:137128457-137128479 GCAGACTGAAGCCAGCTAGATGG - Intergenic
963470476 3:145735590-145735612 TCATGCAAAAGCCAGCTGTGTGG + Intergenic
963926519 3:150957157-150957179 AAAGGCTGAAGACAGATGGGAGG - Intronic
964339936 3:155697765-155697787 TGAGGCTGAAGCAAGATGGCAGG + Intronic
964423644 3:156530517-156530539 GCTGGCTAAAGCCAGCTGGGAGG + Intronic
965609435 3:170529180-170529202 TCAAGTTGTAGCTAGCTGGGTGG - Intronic
966926157 3:184645868-184645890 TGAGGCTGAGGGCAGCTGGCTGG + Intronic
966934719 3:184698454-184698476 GCAGTCTGAAACCAGCTGGTAGG + Intergenic
968229126 3:196994267-196994289 TCGGGCCGAAGGCGGCTGGGAGG + Intronic
968946534 4:3667469-3667491 TCAGGCTGGGCTCAGCTGGGAGG - Intergenic
970154726 4:13130517-13130539 TCTGGCTGGGGCCAGCTGAGTGG - Intergenic
970171775 4:13297701-13297723 TCAGACAGAAGCCACCTGAGGGG + Intergenic
970609184 4:17709593-17709615 TGAGGCTGAGGCCAGCATGGAGG - Exonic
975840970 4:78473654-78473676 TCAGGATGAAGGATGCTGGGGGG + Intronic
977511226 4:97965265-97965287 CCAGGCTGCAGCCAGCCAGGGGG + Intronic
979462685 4:121001730-121001752 CGAGGCTGCAGCCAGGTGGGAGG - Intergenic
982566866 4:156996850-156996872 CCAGGCAGAAGCCTGCTGTGAGG - Intergenic
985386377 4:189452417-189452439 TCAGGCAGAAGCCTGCTGCAGGG + Intergenic
986916355 5:12625246-12625268 TCAGGCAGAAGCCTGCTGTAGGG + Intergenic
987046394 5:14113207-14113229 TCAGGCTGCAACCACATGGGAGG - Intergenic
989090195 5:37722473-37722495 TCAGACTAAAGCAACCTGGGTGG - Intronic
992614762 5:78537267-78537289 CCAGGGTGCAGCCAGGTGGGTGG - Intronic
996976333 5:129439196-129439218 TCAGGCTGTAGCCAAGAGGGTGG - Intergenic
998334345 5:141357375-141357397 TCACGCTGAAGGCAGCAGGTTGG + Exonic
998335366 5:141366505-141366527 TCAGGCTGAAGGCAGCAGGTTGG + Exonic
999514541 5:152287795-152287817 TCTGGCTGAAGTCTGGTGGGTGG - Intergenic
999986214 5:157007779-157007801 CCAGGCAGAAGCCTGCTGCGGGG - Intergenic
1003130306 6:3389818-3389840 TCAGGCTGCTGCCAGCTGCTTGG + Intronic
1004026548 6:11824841-11824863 GTAGGCTGAAGCCATCTGGATGG - Intergenic
1005113688 6:22313663-22313685 CCAGGCAGAAGCCTGCTGGAGGG - Intergenic
1005908176 6:30283932-30283954 CCAGGCAGAAGCCAGCTGCAGGG - Intergenic
1006186232 6:32183075-32183097 TCAGGGAGAAGGCAGCTTGGGGG + Intronic
1006406286 6:33847652-33847674 TCAGGCCAAGGCCAACTGGGTGG - Intergenic
1006794206 6:36721743-36721765 CCAGGCTGAGCCCCGCTGGGAGG - Exonic
1006804121 6:36777452-36777474 TCTGGCTGGGGCCGGCTGGGAGG - Intronic
1006881092 6:37340814-37340836 ACAGGCTGAAGCCAACTCAGAGG + Intergenic
1007178227 6:39910832-39910854 CCAGGCAGGAGCCAGCTGGGGGG - Intronic
1008666512 6:53722079-53722101 TTGGGCTGCAGCAAGCTGGGTGG - Intergenic
1010234585 6:73564712-73564734 TAAGGCTGAGACCATCTGGGCGG + Intergenic
1010517397 6:76789911-76789933 TCAGGCAGAAGCCTGCTGCAGGG - Intergenic
1013542358 6:111123141-111123163 ACAGGATGAAGACAGGTGGGAGG - Intronic
1015586270 6:134779525-134779547 TCAGGCTGAGTTCAGCTGGGTGG - Intergenic
1017043346 6:150325127-150325149 GCAGGCTGGAGGCATCTGGGTGG + Intergenic
1017641135 6:156494887-156494909 ACAGGCTGAAGCCAGGAGAGAGG + Intergenic
1018164199 6:161078294-161078316 TTAGGCTTAAGCCAGCTTTGGGG + Intronic
1018564404 6:165136589-165136611 TCAGGCTGAAGCCTGCTGCAGGG + Intergenic
1018767284 6:166944497-166944519 TGGGGCTGAAGCCAGCATGGTGG - Intronic
1018847738 6:167566982-167567004 CCAGGCTGAAGCCATCTCTGTGG + Intergenic
1019205532 6:170358655-170358677 TCAGCCAGCAGCCATCTGGGAGG - Intronic
1019219490 6:170462984-170463006 TGAGGCAGAAGCCAGCGAGGGGG + Intergenic
1019524835 7:1476235-1476257 TCAGGCTGCATCCAGCAGTGGGG - Exonic
1021553165 7:21893497-21893519 TCAGAGTGATGCCAGCTGGCAGG + Intronic
1022273249 7:28831039-28831061 TCTTGCAGAAGCCAGCTGGATGG - Intergenic
1022508510 7:30921371-30921393 TGAGGCTGAGGCCAGCAGTGGGG + Intronic
1022728646 7:33002929-33002951 TAAGGGTGAGGCCAGCTGGCTGG + Intronic
1023733502 7:43214884-43214906 ATTGGCTGAACCCAGCTGGGAGG + Intronic
1024664909 7:51536628-51536650 GCAGTCTGAAGTCACCTGGGAGG - Intergenic
1024968305 7:55045019-55045041 TCAGGATCATGCCAGCTGGATGG - Intronic
1025044999 7:55685060-55685082 TAAGGGTGAGGCCAGCTGGCTGG - Intergenic
1025942944 7:66087038-66087060 TCAGGCTGAGGGCAGCAGGCTGG - Intronic
1026890441 7:73978734-73978756 TCTGGTTGAAGCCAGGTTGGGGG - Intergenic
1026909882 7:74085282-74085304 CTGGGCTGAAGCCAGCTGGGAGG - Intronic
1027178129 7:75917835-75917857 TAAGGCTGTAGCCACCTGGGAGG - Intronic
1027183423 7:75955167-75955189 TAAGGCTGTAGCCACCTGGAAGG + Intronic
1029443662 7:100601462-100601484 TCAGGCCGAAGGGAGATGGGTGG - Intergenic
1029745974 7:102516118-102516140 TCTGGCTGGTGGCAGCTGGGAGG - Intronic
1029763912 7:102615097-102615119 TCTGGCTGGTGGCAGCTGGGAGG - Intronic
1030936757 7:115594215-115594237 TGAGGCTGCAGCCTGGTGGGGGG + Intergenic
1032694228 7:134319983-134320005 TCAGCCTGGAGGCAGCAGGGAGG - Intergenic
1032916484 7:136495562-136495584 TAAGGCTGAAGGTAGTTGGGGGG + Intergenic
1033281447 7:140009448-140009470 TCATGCTGCAGGCAGCTGAGCGG - Intronic
1033542259 7:142367822-142367844 TCAGGCAGAAGCCTGCTGCAAGG - Intergenic
1034411384 7:150944106-150944128 GCAGGCTGTGCCCAGCTGGGTGG - Intergenic
1034573061 7:151972807-151972829 CCAGGCAGAAGCCTGCTGCGGGG + Intronic
1034927533 7:155134200-155134222 TCATTCTGGAGCAAGCTGGGTGG + Intergenic
1034967717 7:155401646-155401668 TCAGCCAGAAGACAGCTTGGAGG + Intergenic
1036914687 8:12793631-12793653 TCAGGCAGAAGCCTGCTATGGGG - Intergenic
1037681442 8:21100942-21100964 TCAGGCTGGAAGCACCTGGGAGG - Intergenic
1039396044 8:37226005-37226027 TCAGGCTGGAGAAAGCTTGGTGG + Intergenic
1041710594 8:60890827-60890849 TCCCGCTGAAGCCTGCTGTGAGG + Intergenic
1042348223 8:67749565-67749587 TGGTGCTGAAGACAGCTGGGAGG - Intergenic
1042969310 8:74391033-74391055 TCAACCTGAAACCAGCTTGGTGG - Intronic
1043533627 8:81176419-81176441 CCAGGCAGAAGCCTGCTGTGGGG - Intergenic
1044945405 8:97384507-97384529 TCAGGCAGAAGCCTGCTGCAGGG - Intergenic
1045383557 8:101649578-101649600 TCATTCTGAAGCCATCTCGGTGG - Intronic
1046435554 8:114183338-114183360 TCAGGCTAGGGCCAGATGGGAGG - Intergenic
1046854671 8:119017490-119017512 TGAGGCTGAAACCAGCTCTGTGG + Intronic
1047183446 8:122611169-122611191 TCAGGATGAAGCCAGTTCTGTGG - Intergenic
1047184457 8:122619279-122619301 TCACTCTGAAGCCAGCTTGGAGG - Intergenic
1049023192 8:139971400-139971422 GCAGGCAGAGGGCAGCTGGGTGG - Intronic
1049151869 8:141040342-141040364 TCTGGGTGGAGCCAGCTGGATGG - Intergenic
1049358358 8:142199792-142199814 TCAGGCTGGAGCCCTGTGGGAGG - Intergenic
1049555222 8:143278213-143278235 TCTGTCCGAAGTCAGCTGGGAGG + Intergenic
1049717313 8:144099095-144099117 GCAGGCTGGAGGCAGCTGGCTGG + Exonic
1050139449 9:2502275-2502297 TAACTCTGAAGCCAACTGGGTGG + Intergenic
1055352749 9:75406084-75406106 TCAGGGTGAAGTCAGGTAGGAGG + Intergenic
1055481959 9:76717484-76717506 TCAGGTAGAAGGCAGATGGGGGG - Intronic
1056575613 9:87854008-87854030 TCAGGCTGAAAACAGCAGGGAGG - Intergenic
1057277439 9:93683570-93683592 TCAGGCAGGAGCCAGCTTGCTGG + Intergenic
1057300256 9:93874439-93874461 CCAGGCAGAAGCCTGCTGTGGGG - Intergenic
1057308338 9:93925442-93925464 GCATGCTGGACCCAGCTGGGCGG + Intergenic
1057332515 9:94129040-94129062 TCAGGCAGAAGCCAGCTGCAGGG + Intergenic
1059190927 9:112325403-112325425 TGAGGTGGAAGCCAGCTGGCGGG + Intronic
1059460122 9:114424296-114424318 AAATGCTGAAGCCAGTTGGGAGG + Intronic
1060163001 9:121383911-121383933 TCTTGCTGAAGACAGATGGGAGG + Intergenic
1060411610 9:123404051-123404073 CCAGGCTGAACCCTGCTGGGAGG - Intronic
1060934204 9:127506295-127506317 TCAGGCTGGAGCCAGGCTGGGGG - Exonic
1060973262 9:127751083-127751105 CCTGGCTGCAGCCACCTGGGAGG - Intronic
1061273603 9:129557636-129557658 TCAGGCTGGAGGCTGGTGGGGGG - Intergenic
1061499694 9:130994698-130994720 TCAGGCTGAACACAGCAGGGAGG + Intergenic
1061822358 9:133235612-133235634 TCAGGCAGCTGCCACCTGGGAGG + Intergenic
1061893385 9:133634462-133634484 TCTAGCTGGAGCCACCTGGGTGG + Intergenic
1062003881 9:134229830-134229852 TCCCGCTGCAGCCAGGTGGGAGG + Intergenic
1062542609 9:137048307-137048329 CCAGGCTGAAGCGGGCTGGAGGG + Exonic
1062624692 9:137437435-137437457 TCAGGCTGAAGGAAGCAGGAAGG + Intronic
1185860292 X:3572181-3572203 TCAGGCTGAGCTCAGCTGGATGG + Intergenic
1186409007 X:9329378-9329400 TCAGGTTAAGGCCAGGTGGGGGG + Intergenic
1186844892 X:13521075-13521097 TCTGGGTGAAGCCAGCAGAGAGG + Intergenic
1189281772 X:39824171-39824193 TGGGGCTGAAGTCAGCTGAGTGG - Intergenic
1189293402 X:39901797-39901819 TCATGTTGGAGTCAGCTGGGGGG - Intergenic
1192038224 X:67588786-67588808 TCAGTCAGAAGTCAGCTGTGGGG + Intronic
1192233347 X:69280822-69280844 TCAGGCTACAGCCGGCTGGATGG - Intergenic
1193167210 X:78294699-78294721 TGAGGCTTCAGCCTGCTGGGTGG - Intronic
1193271499 X:79534669-79534691 TCAGGCAGAAGCATGCTGGAGGG - Intergenic
1193758375 X:85436464-85436486 TCAGGCAGAAGCCGGCTGGAGGG + Intergenic
1196103050 X:111867459-111867481 TCTGGCTGAAGCAATCAGGGAGG - Intronic
1199601325 X:149543069-149543091 TGAGACTGAAGCCATCAGGGCGG - Intronic
1199649052 X:149936415-149936437 TGAGACTGAAGCCATCAGGGCGG + Intronic
1200138779 X:153887073-153887095 TGAGGCTGCAGCCAGCTCGCCGG - Intronic
1200804957 Y:7423820-7423842 TCAGGCTGAGCTCAGCTGGATGG - Intergenic
1201250998 Y:12057454-12057476 CGAGGCTGCAGCCAGGTGGGGGG + Intergenic