ID: 1128313580

View in Genome Browser
Species Human (GRCh38)
Location 15:66646489-66646511
Sequence CAGGCTGAAGCCAGCTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 7, 3: 41, 4: 331}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128313566_1128313580 29 Left 1128313566 15:66646437-66646459 CCCCTGGGATAGTGGTCAGTGCG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1128313580 15:66646489-66646511 CAGGCTGAAGCCAGCTGGGTGGG 0: 1
1: 0
2: 7
3: 41
4: 331
1128313573_1128313580 -4 Left 1128313573 15:66646470-66646492 CCGGCATGCCTGGAAACCTCAGG 0: 1
1: 0
2: 1
3: 15
4: 255
Right 1128313580 15:66646489-66646511 CAGGCTGAAGCCAGCTGGGTGGG 0: 1
1: 0
2: 7
3: 41
4: 331
1128313567_1128313580 28 Left 1128313567 15:66646438-66646460 CCCTGGGATAGTGGTCAGTGCGT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1128313580 15:66646489-66646511 CAGGCTGAAGCCAGCTGGGTGGG 0: 1
1: 0
2: 7
3: 41
4: 331
1128313568_1128313580 27 Left 1128313568 15:66646439-66646461 CCTGGGATAGTGGTCAGTGCGTG 0: 1
1: 0
2: 0
3: 31
4: 850
Right 1128313580 15:66646489-66646511 CAGGCTGAAGCCAGCTGGGTGGG 0: 1
1: 0
2: 7
3: 41
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128313580 Original CRISPR CAGGCTGAAGCCAGCTGGGT GGG Intronic
900606285 1:3525091-3525113 CAGGCTGACCCCAGCTGCATTGG - Intronic
900857041 1:5194568-5194590 CAGGATGAAGGCAGCTGGGTGGG + Intergenic
900907147 1:5567220-5567242 CAGGCTGGAGCCTGCTCGGATGG - Intergenic
901053526 1:6437831-6437853 CAGGGAGATGCCAGCTGGGAGGG + Intronic
901178818 1:7325548-7325570 CAGGGTGTAGCCAGGTGGATGGG + Intronic
902148703 1:14425147-14425169 CAACCTGAACCCAGCTGGGCAGG + Intergenic
902480750 1:16710313-16710335 CAGGGAGATGCCAGCTGGGAGGG - Intergenic
902992426 1:20197594-20197616 GTGGCTGGAGCCAGGTGGGTGGG + Intergenic
903002900 1:20279062-20279084 GGGGCTGCCGCCAGCTGGGTAGG + Intergenic
903188070 1:21640578-21640600 CAGCCTGCAGGCAGCTGGGCTGG + Intronic
903808572 1:26022150-26022172 CAGGCTGGAGGGAGCTGGGCTGG - Exonic
903838176 1:26219481-26219503 CAGGATGCAGAGAGCTGGGTGGG + Intergenic
904064193 1:27736042-27736064 CAGGCACAAGCCACCAGGGTTGG - Intronic
904252366 1:29234301-29234323 CAGCATGAAGCCAGCTAGGAGGG + Intergenic
906027172 1:42683062-42683084 CACGCGGAAGGGAGCTGGGTGGG - Intronic
906034278 1:42740910-42740932 CAGGCTGATGCCAGAAGGTTGGG - Intergenic
906714371 1:47955978-47956000 CAGTCAGAAGCCAACTAGGTAGG - Intronic
906975043 1:50561199-50561221 CAGGATGAACTCATCTGGGTTGG + Intronic
907250563 1:53135509-53135531 CAGGCTGGAGCCAGCGGCCTAGG - Intronic
907488683 1:54794993-54795015 CAGGCTGGGGCCAGGTGGGGCGG - Intronic
908250485 1:62261673-62261695 CAGGCTGAACCCTGCTTGGAAGG - Intronic
908411925 1:63875066-63875088 CAGCCTGAAGCCGGCTGTCTTGG + Intronic
909017427 1:70394790-70394812 CAGGCTCAAGCGATCCGGGTGGG + Intergenic
910102871 1:83597383-83597405 CAGGCTGTAGCAACCAGGGTTGG - Intergenic
910226548 1:84941959-84941981 CAGGCAGAAGAGAGCTGGGCTGG - Intronic
911525581 1:98981388-98981410 TAGGCTGAAGAAAGCTTGGTAGG - Intronic
912343639 1:108943202-108943224 CAGAATAAAGCCAGGTGGGTTGG - Intronic
912390094 1:109297031-109297053 CGGGGTGAGGCCAGCTGGGAAGG - Exonic
912690862 1:111803724-111803746 TGTGCTGAAGCCAGGTGGGTGGG + Intronic
913212794 1:116595337-116595359 CAGGCAGAAGCCACCTGGGATGG + Intronic
913586180 1:120277803-120277825 CAGCATGAAGCCAGCCGGCTGGG - Intergenic
913622006 1:120620566-120620588 CAGCATGAAGCCAGCCGGCTGGG + Intergenic
914568189 1:148889661-148889683 CAGCATGAAGCCAGCCGGCTGGG - Exonic
914604636 1:149240588-149240610 CAGCATGAAGCCAGCCGGCTGGG + Intergenic
914899900 1:151706336-151706358 CAGGCTGTAGGCTGCTGGGTAGG + Exonic
915312412 1:155011214-155011236 CTGGCTCAAGCCAGCAGTGTTGG + Intronic
915486107 1:156221867-156221889 GAGGCTGAAGCCAACAGGGGTGG - Intronic
919728861 1:200900491-200900513 CAGGCTATTGCCCGCTGGGTTGG - Intronic
920179892 1:204126127-204126149 CAGACTGATCCCGGCTGGGTGGG + Exonic
920213905 1:204348734-204348756 CAGGCTAAGGTCAGCAGGGTGGG - Intronic
922463479 1:225830194-225830216 CAGGCTGAGGCTCCCTGGGTAGG + Intronic
922775028 1:228210686-228210708 CAGGCTGAGACCAGCTGGGCTGG - Intronic
923221557 1:231899097-231899119 CAGACTGTAGCTAGCTGGTTGGG - Intronic
923750697 1:236743755-236743777 GAAGCTGGAGCCAGGTGGGTTGG + Intronic
924081558 1:240404404-240404426 CAGGCTGGAGCCTGCCTGGTCGG - Intronic
1063150489 10:3332214-3332236 CAGGCGGGAGCCAGCTGGATAGG - Intergenic
1066416205 10:35223932-35223954 CAGCCTGAGGCCAGCTGTGGTGG + Intergenic
1067523527 10:47025470-47025492 AAGACTGAAGCCAGATGGGGTGG + Intergenic
1068966264 10:62914991-62915013 GAGGTTGAGGCAAGCTGGGTTGG - Intronic
1069725757 10:70576810-70576832 GAGGCTGTAGCCATCTGGGTTGG + Intergenic
1069861077 10:71472164-71472186 CAGGCAGAAGCCAGCTGATCTGG - Intronic
1070143911 10:73760023-73760045 GAGGCTGAAGCCAGCGATGTTGG - Exonic
1070546547 10:77457290-77457312 CAGGCAGAAGTCTGCAGGGTGGG + Intronic
1072451332 10:95541685-95541707 CAGGGTGAAACCAGCTTGGCAGG - Intronic
1072591091 10:96829431-96829453 GGGTCTGAAGACAGCTGGGTTGG - Intergenic
1072624025 10:97099368-97099390 CAGGCTCAACACAGCTGAGTGGG + Intronic
1072663708 10:97379377-97379399 CAGGCAGCAGCCAGCTCCGTGGG + Exonic
1073123738 10:101136986-101137008 CAGTCTGAGGCCAGGAGGGTGGG - Exonic
1073473177 10:103736362-103736384 CGGGCTGCTGCCAGCTGGGCTGG + Intronic
1074113456 10:110438446-110438468 AAGCCTGAGCCCAGCTGGGTGGG - Intergenic
1074769222 10:116722644-116722666 AAGACTGATGACAGCTGGGTAGG - Intronic
1075667174 10:124239781-124239803 CGGGCTGCAGTCAGCTGGCTGGG - Intergenic
1076260347 10:129060032-129060054 CAGGCTGAAGCTGGATGGGAGGG + Intergenic
1076535533 10:131174401-131174423 CAGGAGGACGCCAGCTGGCTGGG + Intronic
1077443755 11:2580769-2580791 CAGGCTGAAGAAAGCAGGGGTGG - Intronic
1078084711 11:8226911-8226933 CAGCCTGAGGCCTGCTGGGATGG - Intronic
1078414723 11:11156012-11156034 CAGGCAGGACCCAGCTAGGTGGG + Intergenic
1081529369 11:43947468-43947490 CAGGCTGGGGCCGGCTGGGCTGG + Intergenic
1081626942 11:44661641-44661663 CAGGCTGCAGGGAGCTGGGGAGG + Intergenic
1081712865 11:45228732-45228754 CAAGCTGAAGTCAGGTGGGGAGG - Intronic
1082786785 11:57321756-57321778 CAGGGTGGAGCCAGGTGGCTGGG - Intronic
1082996136 11:59257064-59257086 AAGGCAGAAGCCAGTTGGGTTGG + Intergenic
1083344491 11:61979753-61979775 CAAGCTCCACCCAGCTGGGTGGG + Intergenic
1083835413 11:65263499-65263521 CAGGCATAAGCCAGCAGGCTCGG + Intronic
1084111224 11:67015310-67015332 CAGGCTGAGGCCAGCAGGGGTGG - Intronic
1084321642 11:68376656-68376678 CAGGCTGGAGCCAGCTGCAGAGG + Intronic
1084433910 11:69127012-69127034 GAGGGTGAGGCCAGGTGGGTGGG + Intergenic
1085048577 11:73367807-73367829 CAGGCTGAAGGCAGGTGGGCGGG - Exonic
1085409903 11:76284693-76284715 CAGGGTGAAGACAGCAGGGCGGG + Intergenic
1085474430 11:76781104-76781126 CAGGTTCTAGCCAGCTGGGCTGG - Intergenic
1087154366 11:94886239-94886261 CAGACTGAAGGGAGCTGGGCAGG + Intergenic
1088926433 11:114307784-114307806 CAGACTGAAGCAAGCAGGGAGGG - Intronic
1089533147 11:119144951-119144973 AACCCTGAAGCCAGCTGAGTGGG + Intergenic
1090009446 11:123033322-123033344 CAGGCAGAAGCCAGCTCGCCTGG - Intergenic
1090171550 11:124610427-124610449 CAGGCTGAGGCCATTTGGGCAGG + Intergenic
1090627735 11:128620640-128620662 CTGACTGAAGCCCGCTGGGTTGG - Intergenic
1090669066 11:128933479-128933501 CAGCCTGAGGCCATCTGTGTAGG - Intergenic
1091197536 11:133744811-133744833 GAGGCTGGAGCCATCTGGGTGGG - Intergenic
1091296293 11:134476112-134476134 CAGCGTGAAGCCAGGTGGGACGG + Intergenic
1091309306 11:134561309-134561331 CAGGCTGTGCCCAGGTGGGTAGG + Intergenic
1091792949 12:3281845-3281867 GAGGCTGAGGCCAGCAGGGTGGG - Intronic
1092713011 12:11357588-11357610 CAGGCTGCAGCAACCTTGGTTGG - Intronic
1093140850 12:15508855-15508877 CAGGCTGAGGTCTGCTGGGATGG + Intronic
1094146706 12:27236412-27236434 CAGGCTGCAGTGAGCTGGGATGG - Intergenic
1096649147 12:53053402-53053424 CAGGCTGAAGTCACCTGGAAGGG - Exonic
1096680704 12:53253403-53253425 GAGGCTGTAGCCAGCTGGATAGG + Exonic
1097055305 12:56245490-56245512 CAGGCTGAGGCCAGGTGAATGGG + Exonic
1098843691 12:75509651-75509673 CAGGCTGCAGTGAGCTGGGATGG - Intronic
1099096751 12:78383679-78383701 CAGGCTGAAGTCATATGGGCAGG + Intergenic
1101802680 12:108035906-108035928 TAGGCTGGGGTCAGCTGGGTTGG - Intergenic
1102020639 12:109679911-109679933 CAGGCTGCAGGCAGCAGGATAGG + Intergenic
1104450380 12:128864105-128864127 CTGGCTGATGCCAGCTCGGCTGG + Intronic
1104548441 12:129733187-129733209 CAGATTGTAGCCAGCTGAGTGGG + Intronic
1105216040 13:18285968-18285990 CAGGCAGAAGCCACCTGGGATGG + Intergenic
1105715099 13:23055585-23055607 GAGGCGGAGGCCTGCTGGGTAGG - Intergenic
1107560474 13:41552983-41553005 CAGGCTCAATCCAGCAGGGCTGG - Intergenic
1109503780 13:63272609-63272631 AAAGCTGAATTCAGCTGGGTAGG + Intergenic
1110502743 13:76248202-76248224 GAGGTGGAGGCCAGCTGGGTGGG - Intergenic
1110890130 13:80688700-80688722 CAGGCAGAAGCCTGCTGAGAGGG - Intergenic
1112407295 13:99132508-99132530 GAAGCTGCAGCCAGCTGGCTGGG - Intergenic
1113280952 13:108786795-108786817 CAGGCAGAAGCAAGCTGGGTTGG + Intronic
1113417124 13:110137050-110137072 CAGCCTGGAGAGAGCTGGGTTGG + Intergenic
1113538788 13:111090238-111090260 CAGGGTGCAGCAGGCTGGGTGGG + Intergenic
1113684779 13:112275343-112275365 CAGCTTGAAGGCAGCTGGGCAGG - Intergenic
1113782226 13:112983210-112983232 CAGGTTCATGGCAGCTGGGTAGG + Intronic
1115149739 14:30270706-30270728 CAGGCTGAGGGGAGCTGGGGCGG - Intergenic
1117994640 14:61467337-61467359 CATGTTGAAGCCAGCTGGAGGGG - Intronic
1118671014 14:68127258-68127280 CAGGAGGAAACCAGGTGGGTTGG - Intronic
1118743206 14:68756130-68756152 CAGCCTGAAGCCAGCAGGCAGGG - Intergenic
1118780120 14:69002351-69002373 AAGGCTGAATCTGGCTGGGTAGG - Intergenic
1119543355 14:75455004-75455026 CAGGCTGGAGGCAGCAGGGATGG + Intronic
1119555228 14:75547743-75547765 CAGGATGGAGCCAGTTGGCTGGG - Intergenic
1119850098 14:77861025-77861047 CATTCTTTAGCCAGCTGGGTGGG - Intronic
1122848747 14:104515276-104515298 AAGGCTGCCGGCAGCTGGGTAGG + Intronic
1122937600 14:104967224-104967246 CAGGCTCCTGCCAGCTGGGTGGG - Intronic
1123019963 14:105393037-105393059 CAGGCGGAGGCCAGCTGGGTGGG + Intronic
1124336502 15:28861275-28861297 CAGGACACAGCCAGCTGGGTAGG - Intergenic
1125722980 15:41853949-41853971 GAGGCTGAAGCAGGCTGGGGTGG + Intronic
1126581961 15:50250238-50250260 AAAGCTGCAGCCACCTGGGTGGG + Intronic
1128313580 15:66646489-66646511 CAGGCTGAAGCCAGCTGGGTGGG + Intronic
1128652710 15:69430895-69430917 AAGGCTGGAGCCAGATTGGTTGG + Intronic
1129716933 15:77857691-77857713 AAGGCTGAAGCCAGATTGGATGG + Intergenic
1130046147 15:80446523-80446545 CAGGCGGAGGCCAGGTGGCTAGG - Intronic
1131615148 15:94008291-94008313 CAGGCCAAAGTCAGCAGGGTTGG - Intergenic
1132013907 15:98299684-98299706 CCGGCTGGAGCCCTCTGGGTGGG - Intergenic
1132725248 16:1335609-1335631 CTGGCTGCAGCCAACTGCGTGGG - Intronic
1132891480 16:2206964-2206986 CAGGCCGAGGCCATCTGGGTAGG + Intronic
1133255270 16:4512706-4512728 CAGGCTGAGGCCTGCTGCGGAGG + Intronic
1133721939 16:8502765-8502787 CAGGCTGAAGGCTGCATGGTCGG - Intergenic
1135009920 16:18866612-18866634 CAGGCTGAAGGGAGGTAGGTTGG - Exonic
1135316803 16:21454078-21454100 CAGGCTGAAGGGAGGTAGGTTGG - Intergenic
1135369726 16:21886321-21886343 CAGGCTGAAGGGAGGTAGGTTGG - Intergenic
1135442088 16:22484803-22484825 CAGGCTGAAGGGAGGTAGGTTGG + Intronic
1136313629 16:29434253-29434275 CAGGCTGAAGGGAGGTAGGTTGG - Intergenic
1136327071 16:29536019-29536041 CAGGCTGAAGGGAGGTAGGTTGG - Intergenic
1136374287 16:29856220-29856242 GACGCAGAAGCCAGCTGGGGCGG - Intergenic
1136441762 16:30276004-30276026 CAGGCTGAAGGGAGGTAGGTTGG - Intergenic
1138036418 16:53611537-53611559 CAGGCTGACGCCTGCTGGGGAGG + Intronic
1139842246 16:69891010-69891032 CACGTGGAAGCCATCTGGGTTGG - Intronic
1139851143 16:69952135-69952157 CTGGCAGAGCCCAGCTGGGTCGG - Intronic
1139880121 16:70175047-70175069 CTGGCAGAGCCCAGCTGGGTCGG - Intronic
1139888557 16:70229729-70229751 CAGGCTGAAGGGAGGTAGGTTGG - Intergenic
1140372388 16:74420470-74420492 CTGGCAGAGCCCAGCTGGGTCGG + Intronic
1140819112 16:78646911-78646933 CTAGCTGAAGCGAGGTGGGTTGG + Intronic
1141034540 16:80616062-80616084 CAGGCAGAAGCCACAGGGGTCGG - Intronic
1141067471 16:80925685-80925707 CAGGCAGGAGCGGGCTGGGTGGG + Intergenic
1141096871 16:81169162-81169184 CAGCCTGAAGCCAGCAAGGCTGG - Intergenic
1141152170 16:81571934-81571956 AAGGCTGAGGGCAGCTGGGTGGG - Intronic
1141181414 16:81755491-81755513 CAGGCTGAAGCCAGGTTTGGTGG - Intronic
1141726413 16:85792086-85792108 TGGGCTGAAGCCACCTGGTTAGG + Intronic
1141929779 16:87194356-87194378 CAAGCTGCAGCCAGAAGGGTGGG - Intronic
1141992635 16:87619415-87619437 CAGCCTGCAGCCAGGTGGGCTGG - Intronic
1142194171 16:88731973-88731995 AAGCCTGAGGCCTGCTGGGTGGG - Intronic
1142610773 17:1108423-1108445 GAGGCTGCAGCCAGGTGGGCAGG - Intronic
1142719090 17:1764345-1764367 CAGGCTCCTGGCAGCTGGGTGGG + Intronic
1143443810 17:6995836-6995858 CAGGGTGAGGCCAACGGGGTGGG - Intronic
1143459782 17:7094852-7094874 CAGGCTTGAGCCAGCTAGGAAGG - Intergenic
1146309156 17:31753817-31753839 CAGGCTGAGGACAGATGGGGTGG - Intergenic
1146403181 17:32516441-32516463 CAGGCTGGAGCTTGCTGGCTGGG + Intronic
1146521522 17:33529086-33529108 AAGGCTGAATCCAACTGGCTGGG + Intronic
1148755852 17:49972574-49972596 CCGGCTGCGGCCAGCGGGGTGGG - Intronic
1148784531 17:50139614-50139636 AGGGCTGAGGGCAGCTGGGTGGG - Intronic
1149494921 17:57111258-57111280 CAGGCTGAAGCCTGCAGAGCAGG - Intronic
1150059620 17:62055064-62055086 GAGGCTGAAGCCAGGTGTGGTGG + Intronic
1151966940 17:77436478-77436500 GGGGCTGGAGCCAGCGGGGTGGG + Intronic
1152214500 17:79024532-79024554 CAGGCTGAAGCCACGAGGATGGG - Intronic
1152683450 17:81682106-81682128 CAGGATGCAGAGAGCTGGGTGGG + Exonic
1152802287 17:82336640-82336662 CAGGCTGCAGTCACGTGGGTGGG - Intergenic
1153015941 18:582764-582786 CAGGCTGAAGCCCAGTGGTTGGG + Intergenic
1153225335 18:2895556-2895578 CAAGCTGAATGCAGCTGAGTGGG - Intronic
1153225743 18:2898355-2898377 GAAGCTAAAGCCAGCTGGGGAGG - Intronic
1155694274 18:28666015-28666037 AAGTCTGAAGCCAGCAAGGTTGG - Intergenic
1157502703 18:48202495-48202517 CAGGATGAAGCCAGCTGGGCAGG + Intronic
1157551389 18:48584085-48584107 AAGGCTGCAGCCAGCTGGGTGGG - Intronic
1158402019 18:57129692-57129714 AAGGCTTAAGGCACCTGGGTTGG + Intergenic
1159898118 18:74016179-74016201 CAGGTTGAAGACAGCTGGGCAGG - Intergenic
1160067451 18:75589049-75589071 CGGGCTGCAGCCAGCAGGCTGGG + Intergenic
1160338926 18:78069885-78069907 CAGGCAGAAGCCAGTAGGGTGGG - Intergenic
1160746980 19:716445-716467 CAGAGTGAGGCCAGCTGAGTGGG + Intronic
1160751374 19:736065-736087 CATGATGAAGGCAGGTGGGTTGG + Exonic
1160759003 19:773154-773176 GAGGCTGAGGCCAGGTGGGTGGG - Intergenic
1160779774 19:872589-872611 CAGGATGAAGCCGGGTGGGTGGG + Intronic
1160911261 19:1474825-1474847 CAGGACGGAGCCAGCTGGGTGGG + Exonic
1161045634 19:2132937-2132959 CAGGCTGAAGCACTCTGCGTGGG + Intronic
1161401681 19:4068421-4068443 CAGCCTGAAACCAGCCGGGTAGG + Intergenic
1161796834 19:6392198-6392220 CAGGCTGAATGAAGCTGGGTGGG - Intronic
1163273635 19:16268968-16268990 CACGAGGAAGCCAGGTGGGTAGG - Intergenic
1163493856 19:17633225-17633247 CAGGCAGAAGGCAGATGGGATGG + Intronic
1163583250 19:18150701-18150723 CAGGCTGAAGCCAGCAGGATTGG - Exonic
1164696024 19:30245051-30245073 GAGGCTGAAGCCTGGTGGATGGG - Intronic
1165056245 19:33177813-33177835 TGGGCTGAAGCCAGCTGCCTGGG + Intronic
1165184741 19:34007992-34008014 CAGCCTGAATCCAACTAGGTAGG + Intergenic
1165314643 19:35047197-35047219 AAGGCTGGGGCCAGCTGGGGAGG - Intronic
1165749917 19:38253383-38253405 CAGCCAGCAGCCAGCTGGGGCGG + Intronic
1166378485 19:42342321-42342343 TTTGCTTAAGCCAGCTGGGTTGG - Intronic
1166970721 19:46565474-46565496 CAGCCTGAAGTCAGCAGGGCAGG - Intronic
1167132718 19:47597800-47597822 CGGGCTGAAGCCAGGTGCGGTGG + Intergenic
1168564745 19:57413665-57413687 CATGCTGAAACCATCTGGGATGG - Intronic
1202714787 1_KI270714v1_random:36218-36240 CAGGGAGATGCCAGCTGGGAGGG - Intergenic
925305628 2:2846409-2846431 CAGGCTGAGGCTTGCTGGGGAGG + Intergenic
926252565 2:11164090-11164112 CACGCAGAAGCCAGGTGGGTGGG - Intronic
927502630 2:23592557-23592579 CAGGCTGCAGCCAGCCTGGCAGG - Intronic
928108475 2:28488290-28488312 CAGGATGGAGCCAGCTGAGATGG + Intronic
928626744 2:33147689-33147711 CAGGCTTAAGCCATCCTGGTAGG - Intronic
929237167 2:39617698-39617720 CAGGATGAAGCAAGATTGGTGGG + Intergenic
930063503 2:47310335-47310357 AAGGGTGAGGCCTGCTGGGTGGG - Intergenic
931337004 2:61355931-61355953 CAAGCAAAAGCTAGCTGGGTTGG + Intronic
932457697 2:71860063-71860085 CAGCCTGAAGCCAGCTTGGGAGG + Intergenic
933500892 2:83109734-83109756 CATGCTGAGACCAGCTCGGTCGG + Intergenic
934298285 2:91760758-91760780 CAGGCAGAAGCCACCTGGGATGG - Intergenic
934536542 2:95139163-95139185 CAGGCAGAAGCCTGCTGTGGGGG + Intronic
935138971 2:100334131-100334153 CATGCCGAGACCAGCTGGGTCGG - Intergenic
937220699 2:120341732-120341754 CAGCCTGGAGCCAGGTGGGAAGG - Intergenic
937346684 2:121130407-121130429 AAGGCTGAGGCAGGCTGGGTAGG - Intergenic
937910922 2:127075328-127075350 CCTGATGAAGCCAGCTGAGTAGG + Intronic
937924061 2:127154167-127154189 CTGCCTGAAGAGAGCTGGGTTGG - Intergenic
938007070 2:127795767-127795789 CAGGCTGCAGCGAGCTGAGATGG + Intronic
940729788 2:157375577-157375599 CAGGCAGAATCCTACTGGGTAGG - Intergenic
942032574 2:171977654-171977676 CAGGCTGAAGCTAGCAAGGTAGG - Intronic
942071844 2:172323439-172323461 CAGGCTGAAGCCAGTTGTAAGGG - Intergenic
942132847 2:172898029-172898051 CAGGCTGAGCACAGCTGTGTGGG + Intronic
942444468 2:176068823-176068845 CGGGAGGAAGCCCGCTGGGTGGG - Intergenic
943557836 2:189427387-189427409 CAGGCAGAAGCCAGCTGCAGGGG + Intergenic
946467059 2:219921343-219921365 CAGGCTGAGGCCAGCCAGGAAGG - Intergenic
947172213 2:227323117-227323139 TAGGCTGATGCCCTCTGGGTTGG + Intergenic
948174952 2:235935980-235936002 CAGGCAGGAGCCAGCGGGGAGGG - Intronic
948805528 2:240452231-240452253 CAGGCTGGGGGCACCTGGGTGGG + Intronic
1170242656 20:14186076-14186098 CTGTCAGAAGCTAGCTGGGTTGG - Intronic
1170711878 20:18798502-18798524 GAGTGTGAAGCCATCTGGGTTGG + Intergenic
1171508358 20:25658265-25658287 CAGGCAGAAACAAGCAGGGTAGG - Intergenic
1172229590 20:33327881-33327903 CAGGCAGAAGTCAGCTGTCTTGG - Intergenic
1172312881 20:33931871-33931893 GAGGGTGAAGCCAGGTGGGGTGG + Intergenic
1173036674 20:39418432-39418454 TAGGATGGAGCCAGCTTGGTTGG - Intergenic
1173922591 20:46757435-46757457 CAGGCAGCAGCTAGCTGGGGTGG + Intergenic
1174056766 20:47803511-47803533 CAAGCTAAAGCCAGCAGGTTTGG + Intergenic
1174275079 20:49397785-49397807 CAGGCTAAAGCCAGCAGGCCTGG - Intronic
1174930139 20:54804684-54804706 CAGGCTGAGGCCACCTCTGTGGG - Intergenic
1176053386 20:63132549-63132571 CAGAGTGATGCCAGCTGCGTAGG + Intergenic
1177515679 21:22148324-22148346 CAGGCAGAAGCCTGCTGCATGGG + Intergenic
1178950027 21:36978573-36978595 CAGCCTGAGGACTGCTGGGTGGG + Intronic
1179642757 21:42758040-42758062 CAGGCAGCAGGCAGCTGGGCTGG + Intronic
1179873733 21:44256912-44256934 CAGGCTGAAGCTTGCTAGGCAGG + Intronic
1182029669 22:27147973-27147995 TTGCCTGAAGCCTGCTGGGTGGG - Intergenic
1182067062 22:27438345-27438367 CCGCCAGAAGCCAGCTGGGCTGG - Intergenic
1182847901 22:33446661-33446683 GAGGCTGAAGCCAGGAGGGCTGG + Intronic
1182931106 22:34175081-34175103 AAGGGTGAAGCCAGCTCAGTGGG + Intergenic
1183430340 22:37761942-37761964 CAGGCAGAAGCCCCCTGGCTGGG - Intronic
1184403393 22:44286630-44286652 CAGGCTTGACCCAGCTGCGTAGG - Intronic
1184559428 22:45253358-45253380 CCTGCTGAAGCCAGCTGAGAGGG + Intergenic
1185336408 22:50272528-50272550 CAGGAAGAGGCCAGCTGGGAGGG - Intergenic
949679324 3:6494850-6494872 GAGGCTGAAGTCAGCAGGGTAGG + Intergenic
950554774 3:13688789-13688811 TAGGCTGATGCCAGCTGGGTTGG + Intergenic
951038027 3:17955002-17955024 CTGGCTCAACCCAACTGGGTAGG + Intronic
952947662 3:38490261-38490283 CAGCCTGAAGCCAGCGGGCAGGG - Exonic
953551377 3:43906415-43906437 TTGGCTGATGCCAGCAGGGTAGG - Intergenic
954715737 3:52525814-52525836 CAGGCAGCAGCCACCAGGGTAGG + Intronic
954717030 3:52532034-52532056 CACACTGAGGCCAGGTGGGTGGG + Intronic
960724723 3:120658722-120658744 CAGGCAGAAGCCAGCTGCAGGGG - Intronic
961061329 3:123831657-123831679 CAGCCGGGAGCCACCTGGGTGGG + Exonic
961064038 3:123858879-123858901 CTGGATGAAGCCAGTTTGGTAGG - Intronic
961115278 3:124323851-124323873 CAGGCTGAGGCCATATAGGTGGG - Intronic
962847859 3:139287029-139287051 CAGCCTGAGTCCAGCTGGGCTGG - Intronic
963138207 3:141927091-141927113 CATTCTTGAGCCAGCTGGGTTGG - Intergenic
963285484 3:143430807-143430829 CAAGCTGAAGTCTGTTGGGTAGG + Intronic
963317408 3:143774404-143774426 CAGGTTGAAGCCAGACGGCTTGG + Intronic
963470477 3:145735591-145735613 CATGCAAAAGCCAGCTGTGTGGG + Intergenic
963826807 3:149964471-149964493 CAGGCTGAAGTCAGCCAGCTGGG - Intronic
963926518 3:150957156-150957178 AAGGCTGAAGACAGATGGGAGGG - Intronic
964423645 3:156530518-156530540 CTGGCTAAAGCCAGCTGGGAGGG + Intronic
966196996 3:177323747-177323769 GAGGCTTCAGCCAGCTGGGCAGG - Intergenic
967388052 3:188929596-188929618 CAGGGTGAAGGCTGCAGGGTTGG - Intergenic
968433513 4:573351-573373 CAGCCAGAAGCCAGCAGGGATGG + Intergenic
969707476 4:8819833-8819855 AAGGCTGCAGCCAGCAGGGAAGG - Intergenic
970223076 4:13830473-13830495 CAGGCTGAAGCCAGTGAGGGAGG - Intergenic
970355425 4:15246147-15246169 CAAGAGGAAGCCAGTTGGGTTGG + Intergenic
970721869 4:18997481-18997503 CAGGCTGCACACAGCAGGGTCGG + Intergenic
971394600 4:26216511-26216533 CAAGGTGAAGCCAGAGGGGTGGG + Intronic
975658277 4:76663217-76663239 CAGCTTGAAACCAACTGGGTAGG + Intronic
977295016 4:95200424-95200446 CAGGCTGCAGCCAGTTGCCTGGG + Intronic
979297122 4:119046398-119046420 CAGAATGCAGGCAGCTGGGTTGG - Intronic
980538825 4:134166118-134166140 GAGGCAGAAGCCAGGAGGGTTGG + Intergenic
980947785 4:139339825-139339847 CAGACTGAAGATAGGTGGGTTGG + Intronic
981726993 4:147859062-147859084 TATGCTGACCCCAGCTGGGTTGG - Intronic
982173488 4:152683645-152683667 CACTCTGAAGCCAGCTAGGAAGG + Intergenic
983814288 4:172103826-172103848 CAGGCTAATGCCAACTGGCTAGG - Intronic
986276201 5:6277186-6277208 CCGCCTGGAGACAGCTGGGTAGG - Intergenic
988977698 5:36531091-36531113 CTGGTTGAGGACAGCTGGGTAGG + Intergenic
989815318 5:45729565-45729587 AAGGCTAGAGCCAGCTGAGTTGG - Intergenic
990242897 5:53833631-53833653 CAGGGTGAGGCAAGGTGGGTGGG + Intergenic
993037691 5:82775074-82775096 CAGAATGAAGCCTGCAGGGTAGG + Intergenic
997810125 5:136959141-136959163 CAGGCTGCAGCCATAGGGGTGGG - Intergenic
998291943 5:140924598-140924620 CAGGCTGATGCCAGGTGCGGTGG + Intronic
998404926 5:141868888-141868910 CGGTCTGAAGCCAGCGGGATGGG + Exonic
1001579910 5:172791490-172791512 AAGGCTGATGCCAGCCAGGTCGG + Intergenic
1002312330 5:178322579-178322601 CAGGCAGGAGCCAGCTCGTTTGG - Intronic
1004196829 6:13512784-13512806 AAAAGTGAAGCCAGCTGGGTTGG + Intergenic
1004854590 6:19736188-19736210 CAGGCGGATGCCTGCTGGGCTGG - Intergenic
1005113687 6:22313662-22313684 CAGGCAGAAGCCTGCTGGAGGGG - Intergenic
1006406285 6:33847651-33847673 CAGGCCAAGGCCAACTGGGTGGG - Intergenic
1006841424 6:37030291-37030313 GATGCTGAAGGCAGCTGGCTCGG + Intergenic
1008666511 6:53722078-53722100 TGGGCTGCAGCAAGCTGGGTGGG - Intergenic
1010120377 6:72368995-72369017 CAGGATGTAACCAGCTTGGTTGG + Intronic
1010785373 6:79994027-79994049 GAGGCTGAAGCCAGCATGGCTGG - Intergenic
1011954725 6:93012747-93012769 CAGGATGAGGCCAGCCAGGTAGG - Intergenic
1013024135 6:106252724-106252746 CAGGCTCAATTCAGCTGGCTAGG + Intronic
1013590307 6:111614173-111614195 AAGGCTGAACACAGCAGGGTGGG + Intergenic
1016833326 6:148453996-148454018 CAGCCTGAAGTCAGCAGGGCAGG + Intronic
1017043347 6:150325128-150325150 CAGGCTGGAGGCATCTGGGTGGG + Intergenic
1017699544 6:157055039-157055061 CCGGCTGATGCCAGCTGAGGAGG - Intronic
1017848715 6:158283799-158283821 GAGGCTGAAGCTGGCTGGGGTGG - Intronic
1018203507 6:161415952-161415974 CCGGAGGGAGCCAGCTGGGTGGG - Intronic
1018767283 6:166944496-166944518 GGGGCTGAAGCCAGCATGGTGGG - Intronic
1019286548 7:226168-226190 CAGGCTGAACCCAGTGGGTTTGG - Intronic
1019497988 7:1349394-1349416 CCGGCCGAGGCCAGCTGGGGAGG + Intergenic
1020798051 7:12700248-12700270 CAGGTTGAAGCCAGGTGCGGTGG + Intergenic
1021735031 7:23634649-23634671 CAGGCAGAAGCCAGCTGATTTGG - Intronic
1022122948 7:27327434-27327456 CAGTTGGAAGCCAGCTGTGTGGG - Intergenic
1023292083 7:38678885-38678907 CAGGGAGCAGCGAGCTGGGTAGG + Intergenic
1023868475 7:44250126-44250148 CAGGCTGCACCCAGCAGGGTAGG + Intronic
1024269607 7:47632456-47632478 CAGGCTGAAGGCAGCCATGTGGG + Intergenic
1025942943 7:66087037-66087059 CAGGCTGAGGGCAGCAGGCTGGG - Intronic
1026013019 7:66651697-66651719 GAGGGTGAAGCCACCTGGGAAGG - Intronic
1026970542 7:74465004-74465026 CACCCTGGAGCCAGGTGGGTGGG - Intronic
1029443661 7:100601461-100601483 CAGGCCGAAGGGAGATGGGTGGG - Intergenic
1029709048 7:102289679-102289701 AAGCCAGAAGGCAGCTGGGTGGG + Intronic
1034153060 7:148931964-148931986 CAGCCTGAAGCCAGATGGATAGG - Intergenic
1034411383 7:150944105-150944127 CAGGCTGTGCCCAGCTGGGTGGG - Intergenic
1034573062 7:151972808-151972830 CAGGCAGAAGCCTGCTGCGGGGG + Intronic
1034927534 7:155134201-155134223 CATTCTGGAGCAAGCTGGGTGGG + Intergenic
1035381639 7:158444697-158444719 CAGGCTGAGGCCATCTCGGTTGG - Intronic
1035657602 8:1322532-1322554 CAGGATGCAGCACGCTGGGTGGG - Intergenic
1036652523 8:10654474-10654496 CAGGGTGAGGTCAGCTGGGGTGG - Intronic
1040871744 8:52106796-52106818 CAGGCAACAGCCAGCTGCGTGGG + Intergenic
1042969309 8:74391032-74391054 CAACCTGAAACCAGCTTGGTGGG - Intronic
1045063097 8:98425176-98425198 CAGACTGCAGCCAGGTGTGTGGG + Intronic
1046854672 8:119017491-119017513 GAGGCTGAAACCAGCTCTGTGGG + Intronic
1048008414 8:130437797-130437819 TACGCAGAAGCCAGCTGGGGAGG - Intronic
1048373520 8:133801510-133801532 CATATTGAACCCAGCTGGGTAGG - Intergenic
1048841646 8:138572027-138572049 TAGGCCGAAGCCAGCTTGGTTGG - Intergenic
1049023191 8:139971399-139971421 CAGGCAGAGGGCAGCTGGGTGGG - Intronic
1049283695 8:141763258-141763280 CAGGCAGGAGCCAGGTGGGGAGG + Intergenic
1049717314 8:144099096-144099118 CAGGCTGGAGGCAGCTGGCTGGG + Exonic
1049785183 8:144447258-144447280 CAGGCTGAGGGCAGCAGGGGAGG + Intergenic
1050907804 9:11027272-11027294 CAGGCAGAAGCCTGCTGCATGGG - Intergenic
1052609352 9:30751389-30751411 CAGGCTGCCTGCAGCTGGGTTGG - Intergenic
1052704866 9:31982278-31982300 CAAGCTGATCCCAGCTGGGCAGG + Intergenic
1052861828 9:33442266-33442288 CAGGCTGGGGTGAGCTGGGTGGG + Intronic
1053135826 9:35649843-35649865 CAGCCTGCAGCCAGCTGAGATGG - Exonic
1056478675 9:86979030-86979052 CAGGATGGAGCCAGCCGGATTGG - Intergenic
1056728531 9:89143456-89143478 GAGGCTGAAACCTGCTGGGCTGG - Intronic
1056968485 9:91183723-91183745 CTGGTTGAAGTCACCTGGGTGGG + Intergenic
1057277440 9:93683571-93683593 CAGGCAGGAGCCAGCTTGCTGGG + Intergenic
1057308339 9:93925443-93925465 CATGCTGGACCCAGCTGGGCGGG + Intergenic
1057332516 9:94129041-94129063 CAGGCAGAAGCCAGCTGCAGGGG + Intergenic
1057704756 9:97388704-97388726 CATGGTGAAGGCAGCTGGGATGG - Intergenic
1059632988 9:116144621-116144643 CAGGTTGAAGCCTGATGGGTTGG + Intergenic
1059975092 9:119707498-119707520 CAGCCTGAAGGCATTTGGGTAGG - Intergenic
1059975161 9:119708073-119708095 AAGCCTGAAGTCAGCAGGGTGGG - Intergenic
1060968492 9:127724679-127724701 CGGGCTGGAGCCGGCTGGGCTGG + Intronic
1061764869 9:132875330-132875352 CAAGCAGATGCCAGCTGGGGCGG - Intronic
1061987254 9:134136658-134136680 CAGGCTGCAGCTCGCTAGGTGGG + Intronic
1062098164 9:134713229-134713251 CAGCATGAAGCCAGTGGGGTAGG - Intronic
1062335162 9:136061722-136061744 CAGCGAGAAGCCAGGTGGGTGGG + Intronic
1062537386 9:137026994-137027016 CAGGCTGCAGTCAGCTGGGGTGG - Intronic
1062542610 9:137048308-137048330 CAGGCTGAAGCGGGCTGGAGGGG + Exonic
1185542425 X:912903-912925 CAGGCAGGGGCCACCTGGGTCGG + Intergenic
1189070414 X:37857315-37857337 CAGGCAGAAGCCTGCTGCATGGG - Intronic
1191714764 X:64186721-64186743 CAAGCTGAGGCCAGATAGGTAGG + Exonic
1193671937 X:84397575-84397597 CAGGCAGAACCCAGCTGAGGAGG + Intronic
1194403673 X:93468098-93468120 CAGCCTGAAGACAGCAGGGGTGG - Intergenic