ID: 1128314501

View in Genome Browser
Species Human (GRCh38)
Location 15:66652181-66652203
Sequence GGAAACTGAGGCCCAGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5117
Summary {0: 62, 1: 326, 2: 763, 3: 1467, 4: 2499}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128314501_1128314508 2 Left 1128314501 15:66652181-66652203 CCCCTCTCTGGGCCTCAGTTTCC 0: 62
1: 326
2: 763
3: 1467
4: 2499
Right 1128314508 15:66652206-66652228 ATCTGTCAATGAGTTAGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 80
1128314501_1128314509 14 Left 1128314501 15:66652181-66652203 CCCCTCTCTGGGCCTCAGTTTCC 0: 62
1: 326
2: 763
3: 1467
4: 2499
Right 1128314509 15:66652218-66652240 GTTAGACCAGGAGAGCTCTGAGG 0: 1
1: 0
2: 2
3: 13
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128314501 Original CRISPR GGAAACTGAGGCCCAGAGAG GGG (reversed) Intronic