ID: 1128314502

View in Genome Browser
Species Human (GRCh38)
Location 15:66652182-66652204
Sequence GGGAAACTGAGGCCCAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7144
Summary {0: 95, 1: 356, 2: 997, 3: 2066, 4: 3630}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128314502_1128314509 13 Left 1128314502 15:66652182-66652204 CCCTCTCTGGGCCTCAGTTTCCC 0: 95
1: 356
2: 997
3: 2066
4: 3630
Right 1128314509 15:66652218-66652240 GTTAGACCAGGAGAGCTCTGAGG 0: 1
1: 0
2: 2
3: 13
4: 179
1128314502_1128314508 1 Left 1128314502 15:66652182-66652204 CCCTCTCTGGGCCTCAGTTTCCC 0: 95
1: 356
2: 997
3: 2066
4: 3630
Right 1128314508 15:66652206-66652228 ATCTGTCAATGAGTTAGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128314502 Original CRISPR GGGAAACTGAGGCCCAGAGA GGG (reversed) Intronic