ID: 1128314503

View in Genome Browser
Species Human (GRCh38)
Location 15:66652183-66652205
Sequence GGGGAAACTGAGGCCCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17577
Summary {0: 107, 1: 642, 2: 2199, 3: 5103, 4: 9526}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128314503_1128314508 0 Left 1128314503 15:66652183-66652205 CCTCTCTGGGCCTCAGTTTCCCC 0: 107
1: 642
2: 2199
3: 5103
4: 9526
Right 1128314508 15:66652206-66652228 ATCTGTCAATGAGTTAGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 80
1128314503_1128314509 12 Left 1128314503 15:66652183-66652205 CCTCTCTGGGCCTCAGTTTCCCC 0: 107
1: 642
2: 2199
3: 5103
4: 9526
Right 1128314509 15:66652218-66652240 GTTAGACCAGGAGAGCTCTGAGG 0: 1
1: 0
2: 2
3: 13
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128314503 Original CRISPR GGGGAAACTGAGGCCCAGAG AGG (reversed) Intronic