ID: 1128314504

View in Genome Browser
Species Human (GRCh38)
Location 15:66652193-66652215
Sequence ATTGACAGATGGGGAAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15913
Summary {0: 3, 1: 77, 2: 789, 3: 4011, 4: 11033}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128314504_1128314509 2 Left 1128314504 15:66652193-66652215 CCTCAGTTTCCCCATCTGTCAAT 0: 3
1: 77
2: 789
3: 4011
4: 11033
Right 1128314509 15:66652218-66652240 GTTAGACCAGGAGAGCTCTGAGG 0: 1
1: 0
2: 2
3: 13
4: 179
1128314504_1128314508 -10 Left 1128314504 15:66652193-66652215 CCTCAGTTTCCCCATCTGTCAAT 0: 3
1: 77
2: 789
3: 4011
4: 11033
Right 1128314508 15:66652206-66652228 ATCTGTCAATGAGTTAGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 80
1128314504_1128314511 21 Left 1128314504 15:66652193-66652215 CCTCAGTTTCCCCATCTGTCAAT 0: 3
1: 77
2: 789
3: 4011
4: 11033
Right 1128314511 15:66652237-66652259 GAGGACCCCTCCTGACCTCGTGG 0: 1
1: 0
2: 0
3: 10
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128314504 Original CRISPR ATTGACAGATGGGGAAACTG AGG (reversed) Intronic