ID: 1128314505 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:66652202-66652224 |
| Sequence | GTCTAACTCATTGACAGATG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 126 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 10, 4: 115} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1128314505_1128314511 | 12 | Left | 1128314505 | 15:66652202-66652224 | CCCCATCTGTCAATGAGTTAGAC | 0: 1 1: 0 2: 0 3: 10 4: 115 |
||
| Right | 1128314511 | 15:66652237-66652259 | GAGGACCCCTCCTGACCTCGTGG | 0: 1 1: 0 2: 0 3: 10 4: 122 |
||||
| 1128314505_1128314509 | -7 | Left | 1128314505 | 15:66652202-66652224 | CCCCATCTGTCAATGAGTTAGAC | 0: 1 1: 0 2: 0 3: 10 4: 115 |
||
| Right | 1128314509 | 15:66652218-66652240 | GTTAGACCAGGAGAGCTCTGAGG | 0: 1 1: 0 2: 2 3: 13 4: 179 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1128314505 | Original CRISPR | GTCTAACTCATTGACAGATG GGG (reversed) | Intronic | ||