ID: 1128314506

View in Genome Browser
Species Human (GRCh38)
Location 15:66652203-66652225
Sequence GGTCTAACTCATTGACAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128314506_1128314511 11 Left 1128314506 15:66652203-66652225 CCCATCTGTCAATGAGTTAGACC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1128314511 15:66652237-66652259 GAGGACCCCTCCTGACCTCGTGG 0: 1
1: 0
2: 0
3: 10
4: 122
1128314506_1128314509 -8 Left 1128314506 15:66652203-66652225 CCCATCTGTCAATGAGTTAGACC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1128314509 15:66652218-66652240 GTTAGACCAGGAGAGCTCTGAGG 0: 1
1: 0
2: 2
3: 13
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128314506 Original CRISPR GGTCTAACTCATTGACAGAT GGG (reversed) Intronic