ID: 1128314506 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:66652203-66652225 |
Sequence | GGTCTAACTCATTGACAGAT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 67 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 60} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1128314506_1128314511 | 11 | Left | 1128314506 | 15:66652203-66652225 | CCCATCTGTCAATGAGTTAGACC | 0: 1 1: 0 2: 0 3: 6 4: 60 |
||
Right | 1128314511 | 15:66652237-66652259 | GAGGACCCCTCCTGACCTCGTGG | 0: 1 1: 0 2: 0 3: 10 4: 122 |
||||
1128314506_1128314509 | -8 | Left | 1128314506 | 15:66652203-66652225 | CCCATCTGTCAATGAGTTAGACC | 0: 1 1: 0 2: 0 3: 6 4: 60 |
||
Right | 1128314509 | 15:66652218-66652240 | GTTAGACCAGGAGAGCTCTGAGG | 0: 1 1: 0 2: 2 3: 13 4: 179 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1128314506 | Original CRISPR | GGTCTAACTCATTGACAGAT GGG (reversed) | Intronic | ||