ID: 1128314507

View in Genome Browser
Species Human (GRCh38)
Location 15:66652204-66652226
Sequence TGGTCTAACTCATTGACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128314507_1128314509 -9 Left 1128314507 15:66652204-66652226 CCATCTGTCAATGAGTTAGACCA 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1128314509 15:66652218-66652240 GTTAGACCAGGAGAGCTCTGAGG 0: 1
1: 0
2: 2
3: 13
4: 179
1128314507_1128314511 10 Left 1128314507 15:66652204-66652226 CCATCTGTCAATGAGTTAGACCA 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1128314511 15:66652237-66652259 GAGGACCCCTCCTGACCTCGTGG 0: 1
1: 0
2: 0
3: 10
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128314507 Original CRISPR TGGTCTAACTCATTGACAGA TGG (reversed) Intronic