ID: 1128314509

View in Genome Browser
Species Human (GRCh38)
Location 15:66652218-66652240
Sequence GTTAGACCAGGAGAGCTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 179}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128314506_1128314509 -8 Left 1128314506 15:66652203-66652225 CCCATCTGTCAATGAGTTAGACC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1128314509 15:66652218-66652240 GTTAGACCAGGAGAGCTCTGAGG 0: 1
1: 0
2: 2
3: 13
4: 179
1128314501_1128314509 14 Left 1128314501 15:66652181-66652203 CCCCTCTCTGGGCCTCAGTTTCC 0: 62
1: 326
2: 763
3: 1467
4: 2499
Right 1128314509 15:66652218-66652240 GTTAGACCAGGAGAGCTCTGAGG 0: 1
1: 0
2: 2
3: 13
4: 179
1128314502_1128314509 13 Left 1128314502 15:66652182-66652204 CCCTCTCTGGGCCTCAGTTTCCC 0: 95
1: 356
2: 997
3: 2066
4: 3630
Right 1128314509 15:66652218-66652240 GTTAGACCAGGAGAGCTCTGAGG 0: 1
1: 0
2: 2
3: 13
4: 179
1128314504_1128314509 2 Left 1128314504 15:66652193-66652215 CCTCAGTTTCCCCATCTGTCAAT 0: 3
1: 77
2: 789
3: 4011
4: 11033
Right 1128314509 15:66652218-66652240 GTTAGACCAGGAGAGCTCTGAGG 0: 1
1: 0
2: 2
3: 13
4: 179
1128314507_1128314509 -9 Left 1128314507 15:66652204-66652226 CCATCTGTCAATGAGTTAGACCA 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1128314509 15:66652218-66652240 GTTAGACCAGGAGAGCTCTGAGG 0: 1
1: 0
2: 2
3: 13
4: 179
1128314503_1128314509 12 Left 1128314503 15:66652183-66652205 CCTCTCTGGGCCTCAGTTTCCCC 0: 107
1: 642
2: 2199
3: 5103
4: 9526
Right 1128314509 15:66652218-66652240 GTTAGACCAGGAGAGCTCTGAGG 0: 1
1: 0
2: 2
3: 13
4: 179
1128314505_1128314509 -7 Left 1128314505 15:66652202-66652224 CCCCATCTGTCAATGAGTTAGAC 0: 1
1: 0
2: 0
3: 10
4: 115
Right 1128314509 15:66652218-66652240 GTTAGACCAGGAGAGCTCTGAGG 0: 1
1: 0
2: 2
3: 13
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128314509 Original CRISPR GTTAGACCAGGAGAGCTCTG AGG Intronic