ID: 1128314511

View in Genome Browser
Species Human (GRCh38)
Location 15:66652237-66652259
Sequence GAGGACCCCTCCTGACCTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 122}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128314504_1128314511 21 Left 1128314504 15:66652193-66652215 CCTCAGTTTCCCCATCTGTCAAT 0: 3
1: 77
2: 789
3: 4011
4: 11033
Right 1128314511 15:66652237-66652259 GAGGACCCCTCCTGACCTCGTGG 0: 1
1: 0
2: 0
3: 10
4: 122
1128314506_1128314511 11 Left 1128314506 15:66652203-66652225 CCCATCTGTCAATGAGTTAGACC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1128314511 15:66652237-66652259 GAGGACCCCTCCTGACCTCGTGG 0: 1
1: 0
2: 0
3: 10
4: 122
1128314505_1128314511 12 Left 1128314505 15:66652202-66652224 CCCCATCTGTCAATGAGTTAGAC 0: 1
1: 0
2: 0
3: 10
4: 115
Right 1128314511 15:66652237-66652259 GAGGACCCCTCCTGACCTCGTGG 0: 1
1: 0
2: 0
3: 10
4: 122
1128314510_1128314511 -10 Left 1128314510 15:66652224-66652246 CCAGGAGAGCTCTGAGGACCCCT 0: 1
1: 0
2: 2
3: 25
4: 300
Right 1128314511 15:66652237-66652259 GAGGACCCCTCCTGACCTCGTGG 0: 1
1: 0
2: 0
3: 10
4: 122
1128314507_1128314511 10 Left 1128314507 15:66652204-66652226 CCATCTGTCAATGAGTTAGACCA 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1128314511 15:66652237-66652259 GAGGACCCCTCCTGACCTCGTGG 0: 1
1: 0
2: 0
3: 10
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128314511 Original CRISPR GAGGACCCCTCCTGACCTCG TGG Intronic