ID: 1128314993

View in Genome Browser
Species Human (GRCh38)
Location 15:66654781-66654803
Sequence GCTCCAGTTTGGGGAGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 438}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128314993_1128315007 1 Left 1128314993 15:66654781-66654803 CCCTGCCCTCCCCAAACTGGAGC 0: 1
1: 0
2: 5
3: 45
4: 438
Right 1128315007 15:66654805-66654827 CCAGGCGCGGGACAAAGGAGGGG 0: 1
1: 0
2: 0
3: 13
4: 160
1128314993_1128315005 0 Left 1128314993 15:66654781-66654803 CCCTGCCCTCCCCAAACTGGAGC 0: 1
1: 0
2: 5
3: 45
4: 438
Right 1128315005 15:66654804-66654826 ACCAGGCGCGGGACAAAGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 134
1128314993_1128315009 9 Left 1128314993 15:66654781-66654803 CCCTGCCCTCCCCAAACTGGAGC 0: 1
1: 0
2: 5
3: 45
4: 438
Right 1128315009 15:66654813-66654835 GGGACAAAGGAGGGGGCGCCCGG 0: 1
1: 0
2: 3
3: 33
4: 405
1128314993_1128315004 -1 Left 1128314993 15:66654781-66654803 CCCTGCCCTCCCCAAACTGGAGC 0: 1
1: 0
2: 5
3: 45
4: 438
Right 1128315004 15:66654803-66654825 CACCAGGCGCGGGACAAAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 176
1128314993_1128315008 2 Left 1128314993 15:66654781-66654803 CCCTGCCCTCCCCAAACTGGAGC 0: 1
1: 0
2: 5
3: 45
4: 438
Right 1128315008 15:66654806-66654828 CAGGCGCGGGACAAAGGAGGGGG 0: 1
1: 0
2: 1
3: 16
4: 190
1128314993_1128315010 18 Left 1128314993 15:66654781-66654803 CCCTGCCCTCCCCAAACTGGAGC 0: 1
1: 0
2: 5
3: 45
4: 438
Right 1128315010 15:66654822-66654844 GAGGGGGCGCCCGGCATCCCTGG 0: 1
1: 0
2: 2
3: 22
4: 270
1128314993_1128315003 -4 Left 1128314993 15:66654781-66654803 CCCTGCCCTCCCCAAACTGGAGC 0: 1
1: 0
2: 5
3: 45
4: 438
Right 1128315003 15:66654800-66654822 GAGCACCAGGCGCGGGACAAAGG 0: 1
1: 0
2: 1
3: 4
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128314993 Original CRISPR GCTCCAGTTTGGGGAGGGCA GGG (reversed) Intronic
900126264 1:1070237-1070259 GGTCCAGGGTGGGGAGGGCTCGG - Intergenic
900205870 1:1431668-1431690 GCTCCCATTTGGGCAGGGCAGGG - Intergenic
900625775 1:3607920-3607942 TCACCAGGTTGGGGAGGGCGGGG + Intronic
901261783 1:7876431-7876453 GCTGCAGAGGGGGGAGGGCATGG + Intergenic
901420336 1:9146369-9146391 CCTCCCGTGTGGGGAGGGTAGGG - Intergenic
902258348 1:15205509-15205531 GATTCAATTTGAGGAGGGCAGGG - Intronic
902731030 1:18368987-18369009 GCTCCAGTTAAGGGAGGGCCTGG - Intronic
903849610 1:26297934-26297956 GCTCCAGGTGGGAGAGGGCCAGG - Intronic
904771267 1:32882569-32882591 GCTCTAGGCTGGGGTGGGCAGGG + Intergenic
905520873 1:38598716-38598738 GCCCCAGGCTGGGGTGGGCAGGG + Intergenic
906123243 1:43409252-43409274 CCTCCAGTTTGGGGTAAGCAGGG + Intronic
906149325 1:43578352-43578374 GCTCCAGCCTGATGAGGGCATGG + Intronic
906843087 1:49160893-49160915 GCTCAAGTTTGGTGGGGGGAGGG - Intronic
907554053 1:55329262-55329284 GTTCCAGCTGGGGGAGGGCCAGG + Intergenic
907658660 1:56371318-56371340 GAGCCTGTTAGGGGAGGGCAGGG - Intergenic
908482411 1:64555237-64555259 GCAGTACTTTGGGGAGGGCAAGG - Intronic
908708038 1:66981834-66981856 GATGCAGTTGGGGGAGGGGATGG - Exonic
908839962 1:68269734-68269756 TCTCCAATTTGGGCAGAGCATGG + Intergenic
912752958 1:112300683-112300705 GCTGCAGTTTAAGGAGGGCATGG + Intergenic
914704371 1:150159181-150159203 GCCCCGGGTTGGGGAGGGCAGGG - Exonic
915326656 1:155084349-155084371 ACTGTAGTATGGGGAGGGCAGGG + Intronic
915332877 1:155124638-155124660 CCTGCAGTTTGGGGAGGGGAAGG - Intergenic
915592009 1:156876029-156876051 GCCCCAGTCTTGGGAGGGCTGGG - Intronic
915598136 1:156906825-156906847 GCTCCAGTCTGGGGATCGCAGGG - Exonic
915650602 1:157307654-157307676 GCTCAGCTCTGGGGAGGGCAGGG - Intergenic
915663626 1:157424560-157424582 GATCGAGTTTGGTGAGGGGAGGG + Intergenic
916169844 1:161993695-161993717 GCGCCAGGTTGGGCAGGGAATGG - Intronic
919207605 1:194437406-194437428 GCTGCAGTATGGGGATGGAATGG - Intergenic
919761707 1:201102222-201102244 GCTCCAGACTGGGCAGGGAAAGG + Intronic
920051421 1:203167111-203167133 GCTCCAGGCTTGGCAGGGCATGG - Exonic
920282488 1:204854462-204854484 GCTGCAGTTTGAGGAGGGAGGGG + Intronic
920672474 1:208015159-208015181 GCTCAAGGTTGGGCTGGGCATGG - Intergenic
922058982 1:222069335-222069357 GGTCCAGTATGGATAGGGCAAGG + Intergenic
922796165 1:228340882-228340904 CCGCCAGGTTGGGGAGGGCCAGG + Exonic
922806185 1:228391290-228391312 ACTCCGGGCTGGGGAGGGCAGGG + Intergenic
922809969 1:228409779-228409801 GGTGCAGTTTGGGGAGGGAGGGG + Intronic
923043582 1:230337495-230337517 GCTTCAGTTTGGAAAGGTCAAGG + Intronic
923697005 1:236263100-236263122 ACAACAGTTTGGGGAAGGCAGGG - Intronic
924335542 1:242983497-242983519 ATCCCAGTTTGGGGAGGCCAAGG + Intergenic
1064003799 10:11684492-11684514 GGGCCTGTTGGGGGAGGGCAAGG + Intergenic
1064117331 10:12589685-12589707 GCTTCAGATAGGGGTGGGCAGGG + Intronic
1064445418 10:15388634-15388656 CCAGCAGTTTGGGGAGGCCAAGG - Intergenic
1065670039 10:28106409-28106431 TCTCCAGTTTGGAGATGCCAAGG - Intronic
1065939795 10:30553986-30554008 GATCCAGCTTGGTGAGGGCGTGG + Intergenic
1067236920 10:44458902-44458924 GCTCTAGTTTTGGGTGGCCATGG + Intergenic
1068261962 10:54594581-54594603 GCTGTAGTGTGGGGAGGACATGG - Intronic
1068469952 10:57448321-57448343 GCTCCAGCTTGGTGAGGGGAGGG - Intergenic
1068951576 10:62782605-62782627 GCTCCAGCTTGGAGGGGGTAGGG + Intergenic
1070373877 10:75810374-75810396 TGTCCAGTTGAGGGAGGGCAGGG + Intronic
1070605183 10:77893535-77893557 GCTGCTGTCTGGGGCGGGCAGGG - Intronic
1071341296 10:84651491-84651513 GCTCCAGCTTGGTGGGGGGAGGG - Intergenic
1071526409 10:86362284-86362306 GCTCCAGCCAGGGGAGGGCAGGG - Intronic
1072054486 10:91740732-91740754 GCTGCGGTTGGCGGAGGGCACGG + Intergenic
1072404411 10:95136480-95136502 GCTCAAGTTTGGTGAGGGGAGGG + Intergenic
1072733038 10:97860840-97860862 GCGTCAGCTTGGGTAGGGCAGGG + Intronic
1072736328 10:97881957-97881979 GGCCCAGATGGGGGAGGGCAGGG - Intronic
1072746149 10:97940611-97940633 GCACCACTGTGGGGAGGGCAGGG + Intronic
1073322639 10:102624968-102624990 GCTCCAGTCTGGGCCGGGCTGGG - Intronic
1073619797 10:105035086-105035108 GCCCCAGTTTGAGGAGGATAGGG - Intronic
1074917146 10:117968576-117968598 TCTCCAGGTTGGGGTGGGGAGGG - Intergenic
1075515006 10:123101517-123101539 ACTCCATTTTGGTGGGGGCATGG - Intergenic
1076010072 10:126980666-126980688 AATCAAGTTTGGGAAGGGCAGGG - Intronic
1076057421 10:127387022-127387044 GCTACAGAATGGGCAGGGCAGGG + Intronic
1077325830 11:1963618-1963640 CCTCCAGATTGGGGAGCCCATGG + Intronic
1078555190 11:12319569-12319591 GGTGCAGTGAGGGGAGGGCAGGG + Intronic
1079867912 11:25758590-25758612 GCTCAAGCTTGGTGAGGGAAAGG + Intergenic
1080184529 11:29465062-29465084 GCACCAGTTTCGGCTGGGCATGG - Intergenic
1080429211 11:32183353-32183375 GCTTCAGTTTGGGGAAGGTGTGG - Intergenic
1080610602 11:33900669-33900691 GCCCAAATCTGGGGAGGGCAGGG - Intergenic
1081389068 11:42507595-42507617 GGTCTAGTGTGTGGAGGGCAAGG + Intergenic
1081869535 11:46377054-46377076 GCTCCTGTGGGGGGAGGTCAGGG - Exonic
1082113731 11:48305448-48305470 GCTGCAGTTTGGGGTTTGCATGG + Intergenic
1083255618 11:61493780-61493802 GCGGCAGTTTGGCCAGGGCAGGG + Intergenic
1083449186 11:62731177-62731199 GGGCCAGTTTGGGAAGGGCATGG - Intronic
1084194786 11:67518301-67518323 GCTCCCCTTTGGGGCGGCCAAGG - Intergenic
1084970353 11:72768154-72768176 GGTCCAGCATGGTGAGGGCAGGG - Intronic
1085154255 11:74278889-74278911 GCTGCAGTGGGGGGTGGGCAGGG + Intronic
1085856456 11:80181507-80181529 GCTGCAGTATGGGGAGGGAGTGG + Intergenic
1087056522 11:93941882-93941904 GGTGCAGCTTGGGGAGTGCATGG - Intergenic
1089687204 11:120160905-120160927 GTTGCAGTTCGGGGAGGCCAAGG - Intronic
1090249424 11:125241036-125241058 GGTCCAGCATGGGGATGGCATGG - Intronic
1090635362 11:128687561-128687583 GCTTCAGGATGGGGAGGGCGGGG - Intronic
1090728990 11:129553541-129553563 GTTCCACTGTGGGGAGGGCAGGG + Intergenic
1091215593 11:133899502-133899524 TCTTCATTTTGGGGAGGGAAAGG - Intergenic
1091240731 11:134050600-134050622 GTGCCGGTTTGGGGAGGGCGGGG + Intergenic
1202808810 11_KI270721v1_random:18797-18819 CCTCCAGATTGGGGAGCCCATGG + Intergenic
1091470730 12:724551-724573 GTTCCCGTTTGGGCAGGGGAAGG - Intergenic
1091811217 12:3399384-3399406 GCTGCAGTTTGGGGACTGGAGGG + Intronic
1092060626 12:5547621-5547643 TCTCCAGGGTGGGGTGGGCAGGG + Intronic
1092171805 12:6378123-6378145 GCTCCCCTTTGGGGAGGGAAAGG - Intronic
1093290013 12:17308437-17308459 GCAACATTGTGGGGAGGGCAAGG + Intergenic
1093834191 12:23806352-23806374 GCTCCAGATTGGGGAGGAGAAGG - Intronic
1094218332 12:27969348-27969370 GCGCCGGGTTGGGGAGGCCAGGG - Intronic
1095832337 12:46601427-46601449 GCTCCAGCTTGGTGGGGGAAGGG - Intergenic
1096211270 12:49767795-49767817 GCTCCAGCATGGGGAGTGCAAGG + Intergenic
1096642371 12:53004808-53004830 GCTGCAATATGGTGAGGGCAGGG - Intergenic
1097460740 12:59858717-59858739 GCTGCTGTTTGGACAGGGCAAGG + Intergenic
1098134809 12:67390779-67390801 GCTCCAGTTTGCAGAGAGAAGGG - Intergenic
1098602667 12:72350780-72350802 ACTCCAGTTAAGGGAGGACATGG + Intronic
1099699125 12:86061671-86061693 GCTCGAGCTTGGTGAGGGAAGGG + Intronic
1100830752 12:98515184-98515206 GCTAGCGTTTGGGGAAGGCAAGG + Intergenic
1100922101 12:99499755-99499777 TCTGCAATTTGGGGAGGGCTTGG - Intronic
1101253942 12:102959007-102959029 GTTGCATTTTGGGGTGGGCAGGG + Intronic
1101804591 12:108052340-108052362 TCTCCAGTTAGAGGAGGCCACGG - Intergenic
1102001639 12:109561253-109561275 GCTCCAGAGTGGGCAGGGCTGGG + Intronic
1102434304 12:112908769-112908791 GCTCCAGCTCGGGGAGGGGGTGG + Exonic
1102823832 12:115929544-115929566 CCTGCAATTTGGGGAGGCCAAGG + Intergenic
1102826709 12:115952981-115953003 GATCCAGTTGGTGGGGGGCAGGG - Intergenic
1103333120 12:120168597-120168619 GCCCCAGTCAGGGAAGGGCAGGG - Intronic
1103699254 12:122840189-122840211 GGTCCAGGTTGGGGTGGGAAGGG + Intronic
1104004240 12:124880975-124880997 GCTCCTGTTTGGGCAGGGATGGG + Intronic
1104804361 12:131575595-131575617 GCTCCAGGTTGGGGACAGCATGG - Intergenic
1105396791 13:20043844-20043866 GCTGCAGTGTGGGGAGGGAATGG + Intronic
1105497698 13:20945211-20945233 GATCCAGACTGGGGAGGTCATGG - Intergenic
1106419990 13:29578147-29578169 GCTTTTGTTTGGGGATGGCAAGG - Intronic
1106858181 13:33875298-33875320 AAGCCAGTTTGGGGAGGGCCTGG + Intronic
1107473460 13:40712710-40712732 GCTCCAGCTTGGTGGGGGAAGGG - Intergenic
1109731558 13:66419970-66419992 GCTCCAGCTTGGTGGGGGGAGGG + Intronic
1110019959 13:70457602-70457624 GTTCCAGTTTGGTGGGGGAAGGG + Intergenic
1113675547 13:112204576-112204598 GCTCCAGCTCCTGGAGGGCACGG - Intergenic
1115355192 14:32439379-32439401 GCCCCAGTGTGGGGAGGAAAGGG + Intronic
1115359809 14:32488371-32488393 GCTCCAGCTTGGTGGGGGTAGGG - Intronic
1116243548 14:42379097-42379119 GCTTCAGTGTGGGGAGGGAGTGG - Intergenic
1117361497 14:54979515-54979537 ATTCCAGATTGGGGTGGGCATGG - Intronic
1117760354 14:59020893-59020915 GCTTCAGTTTAGGCAGGACATGG + Intergenic
1118346870 14:64947338-64947360 GCTCCCCTTTGTGGAGTGCATGG + Exonic
1119262493 14:73245876-73245898 GCTCTAGGCTGTGGAGGGCAAGG - Intronic
1120770121 14:88370167-88370189 GCTCCAGCTTGATGAGGGGAGGG + Intergenic
1121176039 14:91891412-91891434 GATCCTGTTTGGGAAGAGCAAGG - Intronic
1122043921 14:99010090-99010112 GCCCCTGTCTGGGGAGGGCGAGG - Intergenic
1122113692 14:99517596-99517618 GCTCCAGGGTGGGCAGGGGAAGG - Intronic
1122248554 14:100422101-100422123 TCTGCAGTTTGGGCAGGGCTTGG + Intronic
1122338013 14:101006554-101006576 CGGCCAGTTTGGTGAGGGCAAGG - Intergenic
1122792804 14:104191457-104191479 GTCCCAGGTTGGGGTGGGCATGG + Intergenic
1122876007 14:104665767-104665789 GGTGCAGTTTGAGGAGGGGAGGG - Intergenic
1123111339 14:105868339-105868361 GCTCCAGGTTGGTGAGGGGCTGG + Intergenic
1124084210 15:26531655-26531677 GCTCCTGTTTGGTGGGGGGAGGG + Intergenic
1124135029 15:27027702-27027724 GCTCCAGTTTAGGGATGATATGG - Intronic
1126267872 15:46775765-46775787 GCTGCATTTGGGGGAGGGGAAGG - Intergenic
1127610647 15:60632730-60632752 GCACAAGTTTTGGGAGGGGAGGG + Intronic
1128064703 15:64757220-64757242 CCACCACTTTGGGGAGGCCAGGG - Intronic
1128241070 15:66101325-66101347 GGCCCAGTGTGGGGAGGGCAGGG - Intronic
1128314993 15:66654781-66654803 GCTCCAGTTTGGGGAGGGCAGGG - Intronic
1128645574 15:69376505-69376527 GGTTCAAGTTGGGGAGGGCAGGG + Intronic
1129680980 15:77658164-77658186 ACTCCAGGGTGGGCAGGGCAGGG - Intronic
1129952167 15:79601494-79601516 TCTGCAGCCTGGGGAGGGCATGG - Intergenic
1130173777 15:81546487-81546509 TCTCAAGGTTGGGGAGAGCATGG - Intergenic
1130322613 15:82853512-82853534 CCTCCAGGTCGGGCAGGGCAGGG + Intronic
1130441926 15:83963305-83963327 GCTCCAGCTTGGTGGGGGAAGGG + Intronic
1130605578 15:85313475-85313497 GCTCCCCTTTGGGCAGAGCATGG - Intergenic
1130648620 15:85749660-85749682 GCTCTAGTTTGGGGGTGGGACGG - Intergenic
1132461117 16:55343-55365 GCTCCATTTTACGAAGGGCAAGG - Intronic
1132958385 16:2608693-2608715 CCTGCACTGTGGGGAGGGCAGGG + Intergenic
1132970997 16:2688789-2688811 CCTGCACTGTGGGGAGGGCAGGG + Intronic
1133031757 16:3014402-3014424 ACTCCAGGGTTGGGAGGGCATGG - Exonic
1134020105 16:10915591-10915613 GCACCAGTTTGGGGAAAGCCTGG - Exonic
1134392409 16:13831721-13831743 CCAGCAGTTTGGGGAGGCCAAGG - Intergenic
1136541036 16:30927794-30927816 GCGCCAGCTTGGGGAGCGGATGG + Exonic
1136694181 16:32062196-32062218 TCTCCATTTCAGGGAGGGCAGGG - Intergenic
1136794678 16:33005460-33005482 TCTCCATTTCAGGGAGGGCAGGG - Intergenic
1136875232 16:33848932-33848954 TCTCCATTTCAGGGAGGGCAGGG + Intergenic
1137596452 16:49727324-49727346 GCTCCAGGTTGGGGACGGGGGGG + Intronic
1138417569 16:56880013-56880035 GACCCAGGTTGGGGAGGTCACGG + Intronic
1140056681 16:71531575-71531597 GCTCCAGCTTGGGGAGGAAACGG + Intronic
1141575964 16:84963763-84963785 GCTCCAGCTTTGGGAGGGGTGGG + Intergenic
1141756977 16:85997762-85997784 CCCCCAGCTTGGAGAGGGCATGG + Intergenic
1141761718 16:86033125-86033147 GCTTGAGTTTGGGGAGGACACGG - Intergenic
1141948441 16:87325484-87325506 TCTCCAGTCTGTGGGGGGCAGGG + Intronic
1141994285 16:87626888-87626910 CCAGCACTTTGGGGAGGGCAAGG + Intronic
1142401267 16:89860019-89860041 GCTCCAGGTGGGGGAGGCCGAGG - Intronic
1203096941 16_KI270728v1_random:1267110-1267132 TCTCCATTTCAGGGAGGGCAGGG - Intergenic
1142594345 17:1022330-1022352 GCTGCCCTTGGGGGAGGGCAGGG - Intronic
1142607127 17:1088092-1088114 GCTGCAGATTTGGGAGGGCCCGG - Intronic
1143434013 17:6909256-6909278 GCTATAGTTAAGGGAGGGCAAGG + Intronic
1143574012 17:7779228-7779250 GCTCCAGTCTGCGGGGTGCAAGG - Exonic
1143989499 17:10944623-10944645 GCAGCACTTTGGGGAGAGCAGGG + Intergenic
1144196114 17:12896750-12896772 GCTCCAAGCTGGGGAGGACAGGG - Intronic
1146948271 17:36888821-36888843 GTGCCAGTTTGGGGAGGGAGGGG + Intergenic
1147659895 17:42111886-42111908 GCTCCATTCTGGGAATGGCAGGG + Exonic
1147660008 17:42112393-42112415 GCTCCATTCTGGGAATGGCAGGG + Intronic
1148035313 17:44655885-44655907 GTACCGGTTTGGGGAGGGCGAGG - Intergenic
1148145947 17:45364917-45364939 GCTCCTGGTTGGGGTGGGGAGGG + Intergenic
1148949672 17:51299818-51299840 CCTCCAGTTTGAGGATGGGATGG + Intergenic
1149424278 17:56539957-56539979 GATCTAGTTTGGGGGGGTCAAGG + Intergenic
1149439863 17:56664980-56665002 GCACCGGTTGGGGGTGGGCATGG - Intergenic
1149551744 17:57545691-57545713 GCTCCATTATGGGGAGAGAATGG - Intronic
1149687944 17:58549019-58549041 CATCCAGTTGGGGGATGGCAGGG + Intergenic
1150212633 17:63449779-63449801 GCTCGGGTGTGGGAAGGGCAGGG + Intergenic
1150300029 17:64040114-64040136 ACTCCAGGTTGGTGAGGGAAGGG + Exonic
1150652299 17:67018029-67018051 GTTCCAGTCTGGTGGGGGCACGG - Intronic
1151269199 17:72979927-72979949 GCACCATTTTGGGGAGGTCATGG - Intronic
1151385426 17:73752546-73752568 GTTCCATCTTAGGGAGGGCAGGG - Intergenic
1151805259 17:76400956-76400978 GCTCCAGGGTGTGGAGGTCAAGG + Intronic
1151978937 17:77497917-77497939 CCTCCAGGTTGGCGGGGGCAGGG + Intronic
1152580589 17:81164011-81164033 GCTCCAATTCGGGGATGGCAAGG + Intronic
1152641171 17:81449874-81449896 CCTCAAGTATGGGGAGGGCCAGG - Intronic
1152663788 17:81555563-81555585 CCACCACTTTGGGGAGGCCAAGG - Intergenic
1152723818 17:81935609-81935631 GCTGGAGTTGGGGGTGGGCAGGG + Intronic
1152778350 17:82215691-82215713 TCTGCAGTGTGGGGGGGGCAGGG - Intergenic
1152857710 17:82675677-82675699 CCTCCAGCTAGGGGAGGACATGG - Intronic
1153985251 18:10345143-10345165 TCTCAGATTTGGGGAGGGCAGGG - Intergenic
1154499923 18:14991095-14991117 GCCCCCTTTTGGGGAGGGCCTGG + Intergenic
1156415133 18:36879872-36879894 TCTCCAGCTTGGTGAGGGAAGGG - Intronic
1158132267 18:54165636-54165658 GCACCAGTTTGTGGAGGGAGGGG + Intronic
1158630629 18:59111298-59111320 TCTCCCCTTTGGGTAGGGCATGG + Intergenic
1158684923 18:59604951-59604973 TCTCCAGTTTGAGGTGGGCCTGG - Intronic
1159196755 18:65125681-65125703 GCTCCAGCTTGATAAGGGCATGG - Intergenic
1160563881 18:79775033-79775055 GCTCCAGGGTGGGGAGGGGCTGG + Intergenic
1160831194 19:1105566-1105588 GCTCCAGCCTGGAGAGGGCCTGG + Intronic
1160860056 19:1233913-1233935 GCTGCAGGTGAGGGAGGGCAGGG + Intronic
1162151350 19:8647842-8647864 GGGCCTGTTGGGGGAGGGCAGGG + Intergenic
1162186690 19:8910431-8910453 CCTGCAGTATGGGGAGGACATGG - Exonic
1163098523 19:15078846-15078868 GGGCCTGTTGGGGGAGGGCAGGG + Intergenic
1163313240 19:16526291-16526313 ACTCCAGCTTGGGCAGGGGAGGG + Intronic
1163466197 19:17469866-17469888 GCTCTAGTTTCGGGAGGGTGGGG + Intronic
1163749130 19:19064847-19064869 GCTTTTGTTTGGGGAGGGGAGGG - Intronic
1165330405 19:35138737-35138759 GCTGCTGGTTGGGGAGGGCATGG + Intronic
1166801917 19:45463096-45463118 ACTTGAGCTTGGGGAGGGCAAGG - Intronic
1167080068 19:47272155-47272177 ACTCCAGGTGGGGGAGTGCATGG + Intergenic
1167499967 19:49840490-49840512 GATCCAGTGGGGGGAGGGCGGGG + Intergenic
1167679810 19:50912362-50912384 GCTCCAGCCAGAGGAGGGCAGGG + Intergenic
925484507 2:4313186-4313208 GCTCCAGCTTGGTGGGGGGAAGG - Intergenic
925521802 2:4754696-4754718 CTTCCAGTTTGGGCAGGGGAGGG + Intergenic
926140155 2:10363721-10363743 GCCACAGTTTGGGCACGGCAAGG + Intronic
926718297 2:15941368-15941390 GCTCAAATTTGGGGAGGGGAAGG + Intronic
926945774 2:18185913-18185935 GCTCCAGTCTGGGGAAGGAGGGG + Intronic
927060306 2:19412453-19412475 CCCCCAGCTTGGTGAGGGCAGGG + Intergenic
927635660 2:24814301-24814323 CATCCAGTTGGGGGAGGGCGGGG + Intronic
929577227 2:43059542-43059564 TCTACAGTTTGGGCAGGGCATGG + Intergenic
930930363 2:56874933-56874955 GCTGCAGTTGGGGGAGGGCATGG - Intergenic
932721305 2:74140664-74140686 GCACCAGTCTGGGGTGGGGAAGG - Intronic
933583192 2:84150535-84150557 GCTGAAGTTTGGTAAGGGCAGGG - Intergenic
934571157 2:95374217-95374239 GCTCCAGTGTGGCCAGGGCATGG - Intronic
935866411 2:107392328-107392350 GCTGCAGTTCGGGGTAGGCACGG + Intergenic
937177458 2:119954506-119954528 GCTACAGTTTGTGGAGGGACAGG + Intronic
937320765 2:120959341-120959363 GCTCCAGTATGGGGTGGGGGTGG + Intronic
937736691 2:125299217-125299239 CCTCCAGTTTGGAGAGGCCAGGG - Intergenic
937807284 2:126161070-126161092 GCTCCAGCTTGGTGTGGGGAAGG + Intergenic
938499139 2:131821454-131821476 GCCCCCTTTTGGGGAGGGCCTGG + Intergenic
941276588 2:163497985-163498007 GCTCAAGCTTGGTGAGGGGAGGG + Intergenic
944553850 2:200869038-200869060 GCAGCACTTTGGGGAGGCCAAGG - Intergenic
945533761 2:210987036-210987058 GCTCAAGCTTGGTGAGGGAAGGG - Intergenic
945664247 2:212721379-212721401 GCTCGAGTTCCGGGTGGGCACGG - Intergenic
946200617 2:218068865-218068887 GCTCCAGAGTGGGGAGGGCAGGG - Intronic
946416652 2:219543399-219543421 TCTCCAGGTTGGGGCGGGCCTGG + Exonic
947489094 2:230578614-230578636 CCTTCAGAATGGGGAGGGCAAGG - Intergenic
1170121667 20:12919133-12919155 GCTTGAGTTTGGGCATGGCATGG - Intergenic
1170421998 20:16202386-16202408 GTTTCAGTTTGGGGAGGAAAGGG - Intergenic
1171186125 20:23125638-23125660 GCTCCAGTGTGCGGAAGGAAGGG - Intergenic
1171215029 20:23346103-23346125 TCTGCAGTTTGGGTGGGGCAAGG + Intergenic
1171298635 20:24040261-24040283 GCTGCAGTGAGTGGAGGGCAAGG - Intergenic
1171533262 20:25865960-25865982 GCTCCAGTTTGGGGCGGCGTGGG + Intronic
1171793435 20:29548473-29548495 GGTCCAGTTTGGGGCGGGGTGGG - Intergenic
1171855025 20:30335906-30335928 GGTCCAGTTTGGGGCGGGGTGGG + Intergenic
1172160669 20:32865916-32865938 ACTACAGTTTGGGGCGAGCAGGG + Intronic
1172781674 20:37440179-37440201 GCAGCAGGTTGGGGAAGGCAGGG - Intergenic
1173113273 20:40216331-40216353 CCTCCTGCTTTGGGAGGGCATGG + Intergenic
1173294876 20:41747766-41747788 GCCCCATTTGGGAGAGGGCAGGG + Intergenic
1173839898 20:46150529-46150551 CCTCCAGTTTTTGGAGGGAAAGG + Intergenic
1175895842 20:62335262-62335284 GCTGCAGCCTGGGGAGAGCAGGG + Exonic
1175918063 20:62436763-62436785 GCTGCACAGTGGGGAGGGCAGGG + Intergenic
1178393568 21:32219773-32219795 GCTCAAGCTTGGTGAGGGAAGGG + Intergenic
1179499988 21:41802411-41802433 TTTGCAGTTTGGGGAGGTCACGG - Intronic
1179718687 21:43303265-43303287 TCTCCTGTTTGGGGAGAGGATGG - Intergenic
1179808103 21:43852788-43852810 GCTTCAACTTGGGGAGGGCAGGG + Intergenic
1179822379 21:43944228-43944250 GCTCCAGAGTGGCGAGGGCCGGG - Intronic
1181013858 22:20057252-20057274 GCTCCAGTGTGGGCCAGGCAAGG - Intronic
1181030343 22:20146500-20146522 TCCCGAGTTAGGGGAGGGCAGGG + Intronic
1182313366 22:29425385-29425407 GTTCCAGCTTGGGGAGGCCGTGG + Intergenic
1182320864 22:29478042-29478064 GCTCCAGTTTGCAGAGGGCAAGG - Intergenic
1182583271 22:31328008-31328030 ACTCCAGTGTGGGCCGGGCAAGG - Intronic
1183077494 22:35436245-35436267 GATCCAGGCCGGGGAGGGCAGGG - Intergenic
1183932785 22:41245812-41245834 TCTCCAGTCTGGGGAGGGAGAGG - Exonic
1184034404 22:41911589-41911611 GCTCCAGGGAGGGGAGGGGAGGG - Intronic
1184069323 22:42138330-42138352 GCACCAGTTCTGGGTGGGCAGGG + Intergenic
1184559560 22:45254168-45254190 GGTGCAGTTTGGGCCGGGCACGG + Intergenic
949533702 3:4979533-4979555 GCTTCAGTTGGGGGCGTGCATGG - Exonic
949865294 3:8542290-8542312 GCTCCAGCTGGGGCTGGGCATGG - Intronic
950139003 3:10602159-10602181 TCTCCATTTTGATGAGGGCAGGG - Intronic
950639946 3:14342378-14342400 GCTCCAGATGGCGGGGGGCAAGG - Intergenic
950682481 3:14594578-14594600 GCTCCACTTGGGCCAGGGCAGGG + Intergenic
952865838 3:37854618-37854640 GCCCCGGCTGGGGGAGGGCATGG - Intergenic
953701500 3:45199402-45199424 GCTTGAATTTGGGGAGGTCAAGG + Intergenic
954613876 3:51959790-51959812 GCTGCAGGTGGGGCAGGGCAGGG - Intronic
955774660 3:62420527-62420549 GCAGCAGATTGGGGAGAGCATGG + Intronic
956371768 3:68570998-68571020 GCTGCAGTTGGGGGAGGGCATGG - Intergenic
956495537 3:69822031-69822053 AATCCAGTTTGGGCTGGGCATGG - Intronic
956749436 3:72334440-72334462 TCTGCAATTTGGGCAGGGCATGG - Intergenic
956964660 3:74444625-74444647 GTACCAGTTTGGGTAGGGAAAGG - Intronic
958515293 3:95107647-95107669 GGGCCTGTTAGGGGAGGGCAGGG - Intergenic
958574488 3:95929980-95930002 GCACTAGTATGGAGAGGGCAGGG + Intergenic
958586250 3:96091488-96091510 GCTTCAGTTTGGTGGGGGGAAGG + Intergenic
958793588 3:98682169-98682191 GCTCAAGCTTGGTGAGGGGAGGG + Intergenic
959091810 3:101911297-101911319 GCTCAAGCTTGGTGAGGGGAGGG - Intergenic
959664133 3:108902651-108902673 GCTGCAGTGTGGGGAAGGGAGGG + Intergenic
959760606 3:109959417-109959439 GCTCCAGTATGAGGGAGGCATGG - Intergenic
960150041 3:114239969-114239991 GCTGCATTTTGGGAAGGGGAGGG - Intergenic
960847882 3:122021797-122021819 GCACCTGTTTGGGAAGGGCCTGG + Intronic
961005019 3:123399043-123399065 GCTGAAGCTTGGGGAGGGTATGG - Intronic
961141777 3:124562263-124562285 GCTCCAGTAAGGGGTGGGGATGG + Intronic
961464056 3:127070862-127070884 GCTACAGTTCGGAGAGGGCATGG + Intergenic
962397980 3:135034337-135034359 CCTCCCGTTCAGGGAGGGCAAGG + Intronic
964713836 3:159700527-159700549 GATGCAGTTTGGGCTGGGCATGG + Intronic
965577518 3:170232829-170232851 GGTCCAGTTTTGGCTGGGCAAGG - Intronic
965837343 3:172866829-172866851 GCTGGAGTTTCGGGGGGGCATGG + Intergenic
966234883 3:177689640-177689662 GGTCCAGTGTGGGGCGGGGAGGG + Intergenic
967343532 3:188427754-188427776 GCTCCAGCTTGGTGGGGGGAGGG - Intronic
967557207 3:190874533-190874555 TCTGCAGTTTGGGCAGGGCAGGG + Intronic
967562658 3:190934853-190934875 GCTCGAGCTTGGTGAGGGGAGGG - Intergenic
971482095 4:27124151-27124173 GCTTGAGTCTGGGGAGGTCAAGG - Intergenic
972219327 4:36935918-36935940 GCTCAAGTTTGGTGGGGGAAGGG + Intergenic
972544463 4:40067139-40067161 GCTTGAGTCTGGGGAGGTCAAGG - Intronic
975466338 4:74713803-74713825 GCTCCAGCTTGGTGGGGGGAGGG - Intergenic
975511011 4:75193872-75193894 GCTGCAGTGTGGGGAGAGCATGG - Intergenic
975524253 4:75331598-75331620 GCTCCAGCTTGGTGGGGGAAGGG + Intergenic
975916680 4:79333495-79333517 GCACCAGTTTGGGGTTGGAAAGG - Intergenic
976167612 4:82272072-82272094 GTTCCAGCTTGGTGAGGGGAGGG + Intergenic
976190378 4:82481166-82481188 ACTCCAGTGTTGGGATGGCAGGG + Intergenic
976445975 4:85129958-85129980 GCTCCAGCTTGGTGGGGGGAGGG - Intergenic
977774430 4:100900743-100900765 GCTCCAGTTTGGCGCAGGGAGGG + Intergenic
978699762 4:111628295-111628317 GCTCCAGCTTGGTGGGGGGAGGG - Intergenic
979059711 4:116042664-116042686 GCTCCAGCTTTGGCTGGGCATGG - Intergenic
979241576 4:118451783-118451805 ATCCCAGTTTGGGGAGGCCAAGG - Intergenic
979469039 4:121072831-121072853 GGTCCTGTTTGGGGAGCGCTGGG - Intronic
979559751 4:122088762-122088784 GAACCAGTTTTTGGAGGGCAGGG - Intergenic
979705369 4:123713876-123713898 GCTCCAGCTTGGTGGGGGGAGGG + Intergenic
980180057 4:129392086-129392108 GCCCCAGTTTGGAAGGGGCAGGG - Intergenic
980633919 4:135473793-135473815 GCTCGAGCTTGGTGAGGGGAGGG - Intergenic
982276128 4:153638843-153638865 CCAGCACTTTGGGGAGGGCAAGG + Intergenic
982692755 4:158566992-158567014 GCGCCAGTTCCGGGTGGGCATGG + Intronic
982772962 4:159414887-159414909 GCAGCACTCTGGGGAGGGCATGG + Intergenic
982909216 4:161118090-161118112 GCTCCAGCTTGGTGGGGGGAGGG - Intergenic
983030485 4:162795404-162795426 GCTGGAGTGTGGGGAGGGAATGG + Intergenic
984203205 4:176753204-176753226 GGTCTATTTTGGGGAGGGCCAGG + Intronic
985590865 5:764410-764432 GCACTAGTTCGGGGTGGGCATGG + Intronic
985913705 5:2902139-2902161 GCTTCAGGTTGGGCAGAGCAGGG - Intergenic
986005115 5:3660935-3660957 TCTCCAGAGTTGGGAGGGCAGGG + Intergenic
986412255 5:7492756-7492778 AGTCCAGTTTGGGGAGGTGAAGG + Intronic
986920515 5:12674109-12674131 GCTCGAGCTTGGTGAGGGGAGGG - Intergenic
987019266 5:13852667-13852689 GCTCCAGCTTGGTGGGGGGAGGG + Intronic
988864944 5:35324468-35324490 GCTGCAGTGTGGGGTGGGAATGG - Intergenic
989353631 5:40516656-40516678 GCACCAGCTTGGGGAAGACATGG + Intergenic
991577717 5:68122362-68122384 GCTGCAGTATGGGGAGGGAGAGG - Intergenic
991657771 5:68920917-68920939 GCTCGAGTTCGGGGTGGGCATGG + Intergenic
992287287 5:75248441-75248463 GCTCCAGCTTAGTGAGGGGAGGG + Intergenic
992673000 5:79078208-79078230 GTTCCAGGGTTGGGAGGGCAAGG + Intronic
992908715 5:81373666-81373688 GCTCGAGCTTGGTGAGGGGAGGG + Intronic
993911557 5:93690351-93690373 GCTCCAGCTTGGTGGGGGGAAGG + Intronic
994951373 5:106467687-106467709 GCTCAATTTTGGGGAGAGAAAGG - Intergenic
994991309 5:107000100-107000122 GCTCCAGCTTGGTGAGGGGAGGG - Intergenic
995183899 5:109252441-109252463 GATCCCTTGTGGGGAGGGCATGG - Intergenic
995695746 5:114876517-114876539 GCTCAAGCTTGGTGAGGGGAGGG + Intergenic
996898950 5:128521356-128521378 GGGCCTGTCTGGGGAGGGCAGGG + Intronic
997187944 5:131900875-131900897 GCTGCAGCAGGGGGAGGGCATGG - Intronic
997809532 5:136953886-136953908 GCTCCACCTTGGTGAGGGGAGGG - Intergenic
997906875 5:137826086-137826108 ACTCCAGTTGGAGAAGGGCAGGG - Intergenic
998230802 5:140360498-140360520 GCTCCAGCTGGGGAAGGGGAAGG - Intronic
998388820 5:141773948-141773970 GCTACAGCTTTGGGAGGGCTGGG + Intergenic
999656327 5:153814193-153814215 TCTCCAGTTTGGGGATGTCTGGG - Intergenic
999779138 5:154835150-154835172 GCTCAAGTTGGGGGAGGGAAGGG + Intronic
1001346379 5:170903326-170903348 GCTCCAGCTTGGTGGGGGGAGGG - Intronic
1001583863 5:172819622-172819644 GATCCAGAGTTGGGAGGGCAGGG + Intergenic
1001597525 5:172907637-172907659 CCTGGAGGTTGGGGAGGGCATGG - Intronic
1001674748 5:173502549-173502571 GCTCTAGCTAGGGGAGGGCAAGG + Intergenic
1003320227 6:5044489-5044511 GGTCCAGCTTCAGGAGGGCAGGG + Intergenic
1003518315 6:6835983-6836005 GCTACTGTTTGGGAAGGGCAAGG + Intergenic
1003736873 6:8887216-8887238 GCTGGAGTTCGGGGTGGGCATGG + Intergenic
1003848427 6:10197755-10197777 GTGCCAGTTTGTGGAGGTCAAGG - Intronic
1006782909 6:36644141-36644163 GCTCTAGTTTGCAGCGGGCAGGG + Intergenic
1007177989 6:39909508-39909530 CCTTCTGTTTAGGGAGGGCAGGG - Intronic
1007212518 6:40206711-40206733 GCTCCAGTTTCAAGATGGCATGG + Intergenic
1007637355 6:43307555-43307577 GCTCCAGCTTGGGGAAGGGTCGG + Intronic
1010973128 6:82284198-82284220 GCTCCAGCTTGGTGGGGGGAGGG - Intergenic
1011020688 6:82809335-82809357 GCTCCAGCTTGGTGGGGGGAGGG - Intergenic
1011254655 6:85408074-85408096 GCTCCAGGCTGGAGAGGCCAGGG + Intergenic
1011410348 6:87060068-87060090 GCGCCAGTTCTGGGTGGGCATGG - Intergenic
1011615594 6:89195168-89195190 GCTCCAATTTGGGCCGGGCATGG + Intronic
1012469119 6:99550249-99550271 GCTCCAGTATGTGCAGGACATGG - Exonic
1013218802 6:108057143-108057165 GCTTCAGCTTGGGGAGGTCGAGG + Intronic
1013349462 6:109292181-109292203 GATCCAGTCTGGGTAGGGAAGGG + Intergenic
1013576575 6:111489164-111489186 GCTTGAGCTTGGGGAGGTCAAGG + Intergenic
1013939597 6:115645447-115645469 GCTCCAGCTTGGTGGGGGGAGGG + Intergenic
1013983158 6:116157650-116157672 GCCCAAATTTGGGGAAGGCAGGG - Intronic
1014902404 6:126983962-126983984 ACTCCAGCTTGGTGAGGGGAGGG + Intergenic
1015325503 6:131918941-131918963 GCTGCAGTGTGGGGAGGGGGTGG - Intergenic
1016337819 6:143027009-143027031 GCTGTAGTTTGGGGATGGGATGG - Intergenic
1016873106 6:148838248-148838270 GCCCCAGGTTGGAAAGGGCAGGG + Intronic
1017026247 6:150183794-150183816 GTCCCAGTTTGGGCCGGGCACGG - Intronic
1017819874 6:158041524-158041546 GCTCCAGTGTGGGCAGGGAGGGG + Intronic
1018062803 6:160103697-160103719 ACTCCAGTGTAGAGAGGGCATGG - Intronic
1018951563 6:168381660-168381682 GCTTGAGTGTAGGGAGGGCATGG - Intergenic
1019346401 7:532951-532973 GCTGCAGTTGGGTGAGGACAGGG - Intergenic
1019732127 7:2634226-2634248 GCACCAGTATTGGAAGGGCAGGG - Intronic
1020106073 7:5422953-5422975 GCCCCAGTTTGGGGAAGTCGGGG + Intronic
1020716062 7:11675562-11675584 GCTCCAGCTTGGTGGGGGAAGGG + Intronic
1020935499 7:14459000-14459022 GCTCCAGCTTGGTGGGGGGAGGG + Intronic
1021425596 7:20496062-20496084 GCTGCAGTGTGGGGAGGGCATGG - Intergenic
1022284112 7:28938788-28938810 GCTAGAGTTTGGAGATGGCAGGG - Intergenic
1024658827 7:51474243-51474265 CCCCCATCTTGGGGAGGGCACGG + Intergenic
1025784594 7:64633004-64633026 TCTCCAATTTTGGGAGAGCAAGG - Intergenic
1028168670 7:87569040-87569062 TCTCCATTTTCGGCAGGGCATGG + Intronic
1029111294 7:98214167-98214189 CCCCCAACTTGGGGAGGGCAGGG - Intergenic
1029938532 7:104454465-104454487 GCTACAGTTTGTGGCAGGCAAGG - Intronic
1031257835 7:119479828-119479850 CCTCAAGTTTGGGGAGTGCATGG - Intergenic
1031922975 7:127614850-127614872 GCCCCAGTGTGGGGAGGGAAGGG + Intronic
1032283187 7:130522865-130522887 GCTCCAGGCTTGGGAGGCCAAGG + Intronic
1032666392 7:134041015-134041037 CCATCAGTTTGGGGAGGGGAAGG - Intronic
1032957112 7:136984282-136984304 GCTCCAGCTTGGTGGGGGGAGGG - Intronic
1033141785 7:138833797-138833819 ACTCCAGTGTGGGGGAGGCAAGG - Intronic
1033494144 7:141876949-141876971 GCTGCAGTGTGGGGAGGGGCAGG + Intergenic
1034072405 7:148199016-148199038 GGTGCAGATTAGGGAGGGCATGG + Intronic
1035710756 8:1712178-1712200 GCTCAAGCTTGGTGCGGGCAGGG + Intergenic
1036947556 8:13108864-13108886 GATGCAGTTTCGGGAGGGGAAGG - Intronic
1037497610 8:19455371-19455393 TCTCCAGTCTGGGGATGGAAAGG + Intronic
1037890515 8:22621655-22621677 GCTCCAGATGGGTAAGGGCAGGG - Intronic
1039640129 8:39210285-39210307 GCTTCAGATTGGGGACGGGATGG + Intronic
1041155065 8:54977185-54977207 GCTCGAGCTTGGTGAGGGGAGGG + Intergenic
1043640144 8:82441471-82441493 GCTCCAGTTCCGGGTGGGCGTGG + Intergenic
1044920159 8:97161868-97161890 GCTCCAAGTAGGGGAGTGCATGG - Intergenic
1045797708 8:106065383-106065405 GCTCGAGCTTGGTGAGGGGAGGG + Intergenic
1045883183 8:107065024-107065046 GCTCCAGCTTGGTGGGGGGATGG - Intergenic
1046742405 8:117843549-117843571 CACCCAGTTTGGGGAGGGGAAGG + Intronic
1047026829 8:120833706-120833728 GATCCAGCTTGGGGAGGTCAGGG - Intergenic
1047168526 8:122466855-122466877 GCTGCAGTGTGGGGAGGGAGTGG - Intergenic
1047346274 8:124031776-124031798 GCCCCAGTTGAGGGAAGGCAGGG + Intronic
1047720215 8:127632091-127632113 GATGCAGTTTGCAGAGGGCATGG - Intergenic
1047805979 8:128360301-128360323 ACTCCAGCTTTGGGAGGCCAAGG - Intergenic
1048229805 8:132627647-132627669 GTTCCAGATTGGGGTGTGCACGG + Intronic
1048688508 8:136931696-136931718 GCTCCAGTTTGGAAAGCCCAGGG - Intergenic
1049183736 8:141237666-141237688 GCGCCACTTCGGGGAAGGCATGG - Intronic
1049236075 8:141513065-141513087 GCTGGAGGTGGGGGAGGGCATGG + Intergenic
1049364869 8:142232329-142232351 GGCCCAGTCTGGGCAGGGCATGG - Intronic
1049675151 8:143885954-143885976 GCTCCAGGCTGGGGAGGGGCAGG - Intergenic
1050499610 9:6282754-6282776 GCTCAAGCCTGGGGAGGTCAAGG + Intergenic
1052995697 9:34550706-34550728 GCCCCAGTTTGGGGACTGGAAGG + Intergenic
1053507335 9:38654407-38654429 CCTCCACTTTGAGGAGGGAATGG + Intergenic
1053792853 9:41699195-41699217 GGTCCAGTTTGGGGCGGGGTGGG + Intergenic
1054152321 9:61615630-61615652 GGTCCAGTTTGGGGCGGGGTGGG - Intergenic
1054181266 9:61911216-61911238 GGTCCAGTTTGGGGCGGGGTGGG + Intergenic
1054472096 9:65546773-65546795 GGTCCAGTTTGGGGCGGGGTGGG - Intergenic
1054656327 9:67669926-67669948 GGTCCAGTTTGGGGCGGGGTGGG - Intergenic
1055710722 9:79058791-79058813 TCTGCAGCTTGGGAAGGGCAGGG - Intergenic
1056035926 9:82605517-82605539 GTTACAGGTTGGGGAAGGCAGGG - Intergenic
1056669592 9:88615033-88615055 GGGCCCGTTGGGGGAGGGCAGGG - Intergenic
1057827037 9:98379174-98379196 GCCCCAGTTTTGGTAGAGCAAGG + Intronic
1057979890 9:99650250-99650272 GCTACAGTGGGAGGAGGGCATGG - Intergenic
1058393192 9:104520471-104520493 GCTCCAGTTTGGTTGGGGGAGGG + Intergenic
1058609811 9:106763297-106763319 GCTTCAGTTTGGGGAGATCAAGG - Intergenic
1059409832 9:114124892-114124914 CCTCCAGAGTGGGGAGGGCAGGG - Intergenic
1060280084 9:122209779-122209801 GCTCCAGTCTGTAGAGAGCACGG - Intronic
1060522944 9:124304161-124304183 GCTCCAGGTTGGGATGGGAAAGG + Intronic
1061338199 9:129957326-129957348 GCTCAAGTGTGGGCCGGGCACGG - Intronic
1061472636 9:130839175-130839197 GATGCACTTTGGGGAGGCCAAGG - Intronic
1061507090 9:131037484-131037506 GCTGCAGTTAGGGGAGGGCTGGG - Intronic
1061791911 9:133063502-133063524 GTTCCAGGTGGGGAAGGGCAGGG - Intronic
1061958346 9:133975221-133975243 GCTCCTGGTGGGGGAGGCCATGG - Intronic
1062397099 9:136356931-136356953 CCCCCAGAGTGGGGAGGGCAGGG + Intronic
1062434892 9:136542644-136542666 GCTTCAGTTTGGGGAGGGTGGGG + Intronic
1062537443 9:137027204-137027226 GCTCCAGCCTGGGAAGGGAAGGG - Intronic
1187038020 X:15563253-15563275 GTAGCAGTTTGGGCAGGGCACGG + Intronic
1190727274 X:53197770-53197792 GCACCAGATTGGGGATGTCAAGG - Exonic
1190759986 X:53431159-53431181 GCTCCAGGGTGGGGTGGGAAAGG - Intergenic
1190904585 X:54713822-54713844 GCTTGAGTCTGGGGAGGTCAAGG - Intergenic
1191153259 X:57243050-57243072 GCTCCAGGTTGGTGGGGGGAGGG + Intergenic
1191872935 X:65765222-65765244 GCTCAAGCTTGGTGAGGGGAGGG - Intergenic
1192230953 X:69264586-69264608 GCTCGGGTTTGAGGAGGACAGGG + Intergenic
1192580176 X:72274624-72274646 GCTTTACTTTGGGGAGGGGAAGG - Intronic
1192958168 X:76095688-76095710 GCTTCAGCTTGGTGAGGGGAGGG - Intergenic
1192964174 X:76159609-76159631 GCTCCAGCTTGGTGGGGGGAAGG + Intergenic
1193350849 X:80462780-80462802 GCTCCAGCTTGGTGCGGGGAGGG + Intergenic
1194130391 X:90074205-90074227 GCTGCAGTGAGGGGAAGGCATGG + Intergenic
1194158547 X:90422721-90422743 GCTCAAGCTTGGTGCGGGCAGGG + Intergenic
1194798389 X:98240681-98240703 GCTCCAGCTTGGTGGGGACAGGG - Intergenic
1195541510 X:106068129-106068151 GCTGCAGTGTGGGGAGGGTGTGG + Intergenic
1195580279 X:106493664-106493686 GCTCCAGCTTGGTGGGGGGAGGG - Intergenic
1196269801 X:113697753-113697775 GCTCGAGATTGGTGAGGGGAGGG - Intergenic
1196367807 X:114943055-114943077 GCTCCAGCTTGGTGGGGGGAGGG - Intergenic
1196554429 X:117070320-117070342 GCTGCAGTGAGGAGAGGGCATGG - Intergenic
1196671429 X:118372340-118372362 GTTCAAGTTTGGGGATGGGAGGG - Intronic
1198002267 X:132451511-132451533 GCTCCAGCTTTGTGAGGGGAGGG - Intronic
1198266394 X:135013105-135013127 GCCACAGTTTGAGGAGGGGAGGG - Intergenic
1198531854 X:137555789-137555811 GCTCCAAGTTGTGGAAGGCAGGG - Intergenic
1199560983 X:149161989-149162011 GCTGCAGTAGGGGGAGGGCATGG - Intergenic
1199662249 X:150063653-150063675 GATCCTGTCTGGGGTGGGCAGGG - Intergenic
1199846645 X:151696299-151696321 GCTACATTTTGGGGAGGGAGGGG + Intronic
1200504863 Y:3999689-3999711 GCTCAAGCTTGGTGCGGGCAGGG + Intergenic
1201578887 Y:15490624-15490646 TCCCCATTTTGGGCAGGGCAGGG - Intergenic
1202389289 Y:24353616-24353638 ATCCCAGTTTGGGGAGGCCAAGG - Intergenic
1202481498 Y:25316508-25316530 ATCCCAGTTTGGGGAGGCCAAGG + Intergenic