ID: 1128314993

View in Genome Browser
Species Human (GRCh38)
Location 15:66654781-66654803
Sequence GCTCCAGTTTGGGGAGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 438}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128314993_1128315010 18 Left 1128314993 15:66654781-66654803 CCCTGCCCTCCCCAAACTGGAGC 0: 1
1: 0
2: 5
3: 45
4: 438
Right 1128315010 15:66654822-66654844 GAGGGGGCGCCCGGCATCCCTGG 0: 1
1: 0
2: 2
3: 22
4: 270
1128314993_1128315008 2 Left 1128314993 15:66654781-66654803 CCCTGCCCTCCCCAAACTGGAGC 0: 1
1: 0
2: 5
3: 45
4: 438
Right 1128315008 15:66654806-66654828 CAGGCGCGGGACAAAGGAGGGGG 0: 1
1: 0
2: 1
3: 16
4: 190
1128314993_1128315007 1 Left 1128314993 15:66654781-66654803 CCCTGCCCTCCCCAAACTGGAGC 0: 1
1: 0
2: 5
3: 45
4: 438
Right 1128315007 15:66654805-66654827 CCAGGCGCGGGACAAAGGAGGGG 0: 1
1: 0
2: 0
3: 13
4: 160
1128314993_1128315005 0 Left 1128314993 15:66654781-66654803 CCCTGCCCTCCCCAAACTGGAGC 0: 1
1: 0
2: 5
3: 45
4: 438
Right 1128315005 15:66654804-66654826 ACCAGGCGCGGGACAAAGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 134
1128314993_1128315009 9 Left 1128314993 15:66654781-66654803 CCCTGCCCTCCCCAAACTGGAGC 0: 1
1: 0
2: 5
3: 45
4: 438
Right 1128315009 15:66654813-66654835 GGGACAAAGGAGGGGGCGCCCGG 0: 1
1: 0
2: 3
3: 33
4: 405
1128314993_1128315003 -4 Left 1128314993 15:66654781-66654803 CCCTGCCCTCCCCAAACTGGAGC 0: 1
1: 0
2: 5
3: 45
4: 438
Right 1128315003 15:66654800-66654822 GAGCACCAGGCGCGGGACAAAGG 0: 1
1: 0
2: 1
3: 4
4: 93
1128314993_1128315004 -1 Left 1128314993 15:66654781-66654803 CCCTGCCCTCCCCAAACTGGAGC 0: 1
1: 0
2: 5
3: 45
4: 438
Right 1128315004 15:66654803-66654825 CACCAGGCGCGGGACAAAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128314993 Original CRISPR GCTCCAGTTTGGGGAGGGCA GGG (reversed) Intronic