ID: 1128319853

View in Genome Browser
Species Human (GRCh38)
Location 15:66685504-66685526
Sequence GGTGAAGCACAGAAGACTAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128319853_1128319858 -2 Left 1128319853 15:66685504-66685526 CCCATAGTCTTCTGTGCTTCACC 0: 1
1: 0
2: 1
3: 18
4: 167
Right 1128319858 15:66685525-66685547 CCCTCTTCTGTGGGCTTCCCTGG 0: 2
1: 0
2: 1
3: 28
4: 302
1128319853_1128319863 23 Left 1128319853 15:66685504-66685526 CCCATAGTCTTCTGTGCTTCACC 0: 1
1: 0
2: 1
3: 18
4: 167
Right 1128319863 15:66685550-66685572 TAGCATGCTCCCTACACCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128319853 Original CRISPR GGTGAAGCACAGAAGACTAT GGG (reversed) Exonic
903543070 1:24107721-24107743 CGTGAAGCCCAGAAGTCTGTTGG + Intronic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
915748520 1:158183110-158183132 GGTGAAGCACAGCAGTCTAGAGG + Exonic
915755671 1:158257018-158257040 GGTGAAGCACAGCAGTCTAGAGG + Exonic
915762501 1:158329394-158329416 GGTGAAGCACAGCAGTTTAGAGG - Exonic
915765301 1:158356059-158356081 GGTGAAACACAGCAGTCTAGGGG + Exonic
915790836 1:158669187-158669209 GGTGAAGAACATCAGAATATAGG + Intronic
917538229 1:175889903-175889925 GGTGTAGCAAAGAAAACTACAGG - Intergenic
918082708 1:181220099-181220121 GGTGAGTCACAGAAGATTCTGGG - Intergenic
918307378 1:183259550-183259572 AGTCAAGAAGAGAAGACTATGGG - Intronic
918557591 1:185822069-185822091 GGTGGAGCACAGAGGATTCTTGG + Intronic
919692079 1:200536701-200536723 AGTGAAGCACAGAAGAGTTGAGG - Intergenic
921983315 1:221282481-221282503 GGTAAAGGATAGAACACTATTGG - Intergenic
923698509 1:236278724-236278746 GGTGAAGCACTGGAAACTAAAGG - Intronic
924118584 1:240772852-240772874 GGAGAAGCACAGAAAAGTTTTGG - Intergenic
1067052175 10:43028042-43028064 TGAGAAGCACAGAACCCTATGGG + Intergenic
1070304678 10:75233358-75233380 CGTGAAGCAGACAAGCCTATAGG - Intergenic
1071382366 10:85080477-85080499 AGTGAATCCCAGAAGACTAAAGG + Intergenic
1074434205 10:113419882-113419904 GGTGAAGCACAGAAGTCTCTTGG - Intergenic
1074436356 10:113437576-113437598 GGTGAAGAACCGAAGCCTAGAGG - Intergenic
1080527310 11:33136971-33136993 GGTGAAACAAAAAGGACTATTGG - Intronic
1084236742 11:67792548-67792570 CGTGAAGAACAGAAGAAGATAGG - Intergenic
1087392673 11:97558275-97558297 AGTATAGCACAGAAGCCTATTGG + Intergenic
1091804498 12:3346320-3346342 ACTGAGGCACAGAACACTATTGG + Intergenic
1092912721 12:13162177-13162199 GTTGAAGCAGAGGAGGCTATGGG + Intergenic
1092961531 12:13601081-13601103 GGAGAAGCACTGAAGTCTAAAGG + Intronic
1096006947 12:48181182-48181204 GGAGAAGCACAAAAGGCCATGGG - Intronic
1096743537 12:53711387-53711409 GGTGGGGCACAGAAGTCAATGGG + Intronic
1097686604 12:62696973-62696995 GATGAAGAAAAGAAGACTTTTGG + Intronic
1099775559 12:87123590-87123612 GCTGGAGCACAGAAGATTTTTGG - Intergenic
1099884447 12:88509660-88509682 GGTGAAGCTCAGTAACCTATGGG - Intronic
1100023742 12:90102362-90102384 GGAGGAGCACAGAATTCTATAGG - Intergenic
1100900087 12:99228880-99228902 GGTGAAGCACAAAACTTTATAGG - Intronic
1101660826 12:106764395-106764417 GGGGAAGAACAGAAGAATCTTGG + Intronic
1103140815 12:118546648-118546670 GGTGACCTCCAGAAGACTATGGG - Intergenic
1106436275 13:29725785-29725807 GGTGAGGGAAAAAAGACTATTGG - Intergenic
1107064214 13:36195301-36195323 TGTGCAGCACAGAACACTCTGGG + Intronic
1107219439 13:37963953-37963975 TGTGAAGCAGAGGAGAGTATAGG + Intergenic
1109479566 13:62931332-62931354 GTTGAAGAGCAGAAGATTATAGG - Intergenic
1110856302 13:80300800-80300822 GGTGAAGAACAAATGACTTTAGG - Intergenic
1112602653 13:100871878-100871900 GGTGAAGCACAGAGGACCTTAGG - Intergenic
1112709641 13:102112569-102112591 CCTGGAGCACAGAAGACTTTCGG - Intronic
1112997229 13:105588839-105588861 GCTGAAAAACAGAAGACTCTGGG - Intergenic
1113096578 13:106671544-106671566 CATGAAGCACAGAAGACTTCGGG - Intergenic
1114034902 14:18614619-18614641 AAGGAAGCACAGAAGACTTTGGG - Intergenic
1114123744 14:19700397-19700419 AAGGAAGCACAGAAGACTTTGGG + Intergenic
1114293128 14:21305186-21305208 GGTGGAACACAGAGGACTTTTGG - Intronic
1114486663 14:23066858-23066880 GGTGAATGACGAAAGACTATGGG + Intronic
1115024208 14:28721453-28721475 GTTGTAGCACAGGAGATTATCGG + Intergenic
1116197609 14:41749683-41749705 GGAGAAGCAAAGATCACTATTGG + Intronic
1116315554 14:43386826-43386848 AGGCAAGCACAGAAGATTATTGG + Intergenic
1120026486 14:79590725-79590747 TGTGACACACAGAAGACTGTAGG - Intronic
1124681092 15:31731565-31731587 GGTGGAGCACAGAGGATTTTAGG + Intronic
1124717328 15:32076905-32076927 GGTGGAGCAGAGAAGACTTGGGG - Intronic
1126000584 15:44205788-44205810 GGTGAAGAAAAGAAGTCTCTTGG - Intergenic
1126287764 15:47034094-47034116 GGCCGAGCACAGAAGACTTTTGG + Intergenic
1126687067 15:51257523-51257545 GGTGAAGCTCACAGGACTGTGGG + Intronic
1126802676 15:52314091-52314113 GGTGAATCAAAGAAGAAGATGGG + Intronic
1128319853 15:66685504-66685526 GGTGAAGCACAGAAGACTATGGG - Exonic
1128426318 15:67545045-67545067 AGTGAGGCACAGAAGTTTATGGG - Intronic
1128895032 15:71365264-71365286 GGTGAAGCAAAGAAAGCTGTAGG + Intronic
1129700843 15:77768028-77768050 AGGGAAGGACAGAAGACTGTGGG + Intronic
1131861290 15:96656215-96656237 GGAGAAGCACAGAAAAAAATAGG - Intergenic
1136184962 16:28582327-28582349 GGTGGAGCACAGAGGATTTTAGG + Intronic
1137742989 16:50798998-50799020 GCTGAAGCACAGAACAGTAGGGG - Exonic
1138456144 16:57121886-57121908 GGTGAAGCTCAGAAGGCCATAGG - Intronic
1141421212 16:83917769-83917791 GATAAAGCACAGAAGACTGCTGG - Exonic
1145291262 17:21548224-21548246 GGTGAAGCACAGGAACGTATTGG - Intronic
1145388816 17:22438826-22438848 GGTGAAGCACAGGAACGTATTGG + Intergenic
1146153851 17:30502221-30502243 GGTGAAGCACAGGATACTTAGGG + Intronic
1147512717 17:41085058-41085080 GGAGAAACACAGAATACAATTGG - Exonic
1152364204 17:79845559-79845581 GGGGAAGCACAGAAGTGTCTGGG - Intergenic
1153604816 18:6821896-6821918 GGTAAATCACAGAAGACAAGGGG - Intronic
1154427513 18:14283563-14283585 GGGGCAGTACAGAAGAATATAGG + Intergenic
1158952942 18:62512674-62512696 AGTGAAGGCCAGAAGACAATAGG + Intergenic
1159468084 18:68811795-68811817 CGTGAAGCACAGAGGACTGCAGG + Intronic
1159641267 18:70865152-70865174 GGTGAAGCTCCCAAGACCATGGG + Intergenic
1159742403 18:72188784-72188806 GGTGAAGCACAAAGGATTTTAGG - Intergenic
1161607974 19:5225280-5225302 GGGGAAGCACAGGAGACTAGGGG + Intronic
1162555395 19:11383186-11383208 GGTGAAGCACAGAAGCTCTTCGG + Exonic
1164663315 19:29999500-29999522 CCTGAAGCACAGAAGGTTATGGG - Intronic
1165613903 19:37181858-37181880 GGCGAAACACAGAGGATTATTGG + Exonic
925698154 2:6604916-6604938 GGTAAAGCCTAGAAAACTATTGG - Intergenic
928180675 2:29066224-29066246 GGTGAAGCATGGAAGACCCTTGG + Intronic
930762654 2:55052075-55052097 GGTGGAACACAGAAGATTTTGGG + Intronic
932525558 2:72463387-72463409 TGTGAAGCAATGAAGACTAAAGG + Intronic
937077149 2:119115339-119115361 GGAGAAGCACAGACAACCATGGG - Intergenic
938039270 2:128062436-128062458 GGTGAAGCACAGAAGAGGCAGGG - Intergenic
938313140 2:130307786-130307808 GGTGTAGCACAGAGCACTATGGG - Intergenic
939821868 2:146967393-146967415 GGTGAAGCCCAAAATACTTTTGG + Intergenic
940292929 2:152095385-152095407 GGTGAAGCAGAGAAGGCAGTTGG - Intronic
940318413 2:152348793-152348815 TTAGAAGCACAGAAGACAATTGG - Intronic
940432184 2:153605843-153605865 GGAGAAGCTCAGAAGAGAATAGG + Intergenic
941242441 2:163056119-163056141 GGTGGAGCACAGAAGATTTTCGG - Intergenic
942741871 2:179190251-179190273 GTTGAAGATCAGAAGGCTATAGG - Intronic
943432513 2:187822396-187822418 GGTGAAGCACAGAGGATTTTAGG - Intergenic
946814742 2:223565247-223565269 GGTGAAGCACACAAGTTTTTAGG - Intergenic
1170711520 20:18795399-18795421 GGTGAAGAAAAGAAGTCTTTTGG + Intergenic
1172712974 20:36941323-36941345 GGTCAAGGACAGAAGGCTGTGGG - Intronic
1175165241 20:57038912-57038934 GGAGAAGAACAGAATACTGTGGG - Intergenic
1175594906 20:60223246-60223268 GGTGAAGCAAAGAACCCTTTTGG - Intergenic
1178285773 21:31324064-31324086 GGTGGAGCACAGAGGATTTTAGG + Intronic
1178797091 21:35755170-35755192 GGAGAAGTACAGAATGCTATGGG + Intronic
1179709096 21:43202220-43202242 CTTGAAGGACAGAAGAATATAGG - Intergenic
1180459022 22:15541667-15541689 AAGGAAGCACAGAAGACTTTGGG - Intergenic
1180935029 22:19619814-19619836 GGGGAAGCACAGAAAAATCTTGG - Intergenic
1182071935 22:27469893-27469915 GGGGAAGGACAGGGGACTATGGG - Intergenic
1182900375 22:33893623-33893645 GTTGAAGCACAGAAGTCTTAAGG - Intronic
1183569804 22:38644329-38644351 GGTGGAGCACAGAGGACTGTTGG + Intronic
1183569811 22:38644414-38644436 GGTGGAGCACAGAGGACTGTTGG + Intronic
1183569818 22:38644499-38644521 GGTGGAGCACAGAGGACTGTTGG + Intronic
949346363 3:3080509-3080531 AGTGAAGCACAGAGAGCTATAGG - Intronic
951909111 3:27730672-27730694 GGAGAAACAGAGAAGACTCTCGG - Intergenic
953441939 3:42925715-42925737 GGTGAAGCACAGATGAATCTAGG - Intronic
953700035 3:45188289-45188311 TGTGAAGCAAAGACGACTCTGGG + Intergenic
955225470 3:57056801-57056823 GATGCACCACAAAAGACTATGGG + Intronic
957232274 3:77535709-77535731 GGTAAAGTACAGAATAATATGGG + Intronic
957292839 3:78299124-78299146 GGTGATGTACAGAGAACTATGGG - Intergenic
963567767 3:146950932-146950954 GGTGAAGCATAGAGGATTTTAGG + Intergenic
966090808 3:176133252-176133274 GGGGAAGGACAGAAGACTTATGG + Intergenic
967734917 3:192941931-192941953 GGTGAAGCACAAAATATTATGGG + Intergenic
968635699 4:1677569-1677591 GGAAAAGCAGAGAAGACTAAGGG - Intronic
969246800 4:5939841-5939863 GCTGAAGCAGTGAAGACTAAAGG - Intronic
969492215 4:7505925-7505947 GTGGAGGCACAGAAGACTAGGGG - Intronic
970513842 4:16807569-16807591 GGTGAATCACAAAAGATCATTGG + Intronic
970877303 4:20885995-20886017 GGAGAAACATAGAAAACTATGGG - Intronic
971054051 4:22892827-22892849 GTAGAAGAACAGAAGCCTATGGG - Intergenic
972098421 4:35379833-35379855 AGTGACGCTCAGAGGACTATGGG - Intergenic
975545234 4:75554102-75554124 GGGGAAGGACTGAAGGCTATGGG - Intergenic
976101614 4:81569977-81569999 AGTCAACCACAGAAGTCTATGGG + Intronic
976668292 4:87623929-87623951 TGTGAAGCAAGGAAGACAATAGG - Intergenic
976786431 4:88826681-88826703 GGTGGAGCAGAGAAGACCAAAGG - Intronic
978870767 4:113574207-113574229 GGTGAAGCACTGAACTCTGTGGG - Intronic
979515319 4:121602538-121602560 GGTGGAGCACAGAGGATTTTAGG - Intergenic
979707855 4:123742301-123742323 GGTGAAACCCAGAAGACTCAAGG + Intergenic
984550690 4:181155413-181155435 TGTGAAGCACAAAAGACAAAGGG + Intergenic
984580184 4:181502130-181502152 GGTGAAGCACAGGAGATTTTAGG + Intergenic
987565275 5:19575990-19576012 GGGGAAACATAGAAGACTTTGGG + Intronic
990379266 5:55206159-55206181 AGTGGAGCACAGAAGATTTTTGG + Intergenic
992348257 5:75902466-75902488 GTTGAAGCACAGAAACCTAGAGG - Intergenic
1002420178 5:179141946-179141968 GGGCAAGCCCAGAAGACTAGTGG + Intronic
1003498358 6:6683727-6683749 GGTAAAGCACATACGAGTATTGG + Intergenic
1004146361 6:13070565-13070587 AGTAAAGCCCAGAAGACTTTGGG - Intronic
1004335465 6:14760420-14760442 GGTGAAGCACAGAAAAGGAAGGG + Intergenic
1004438484 6:15621898-15621920 GGGGAAGCACAGAAGAGGAAGGG - Intronic
1007847579 6:44772561-44772583 GGTGAAGCAGAGAAGGCAAAAGG - Intergenic
1008182395 6:48347718-48347740 GGGGAAGCAAAGAAGACAAAAGG - Intergenic
1009370460 6:62894180-62894202 GGTGAAGCCCAGAAGCCTCCTGG - Intergenic
1010568486 6:77448443-77448465 GATGAGGCATAGAAGAATATTGG + Intergenic
1010960820 6:82143729-82143751 GGAGAAGCAGAGACTACTATTGG + Intergenic
1011384145 6:86776056-86776078 GGTGGAGCACAGAGGATTTTAGG + Intergenic
1012736372 6:102950389-102950411 GGTGAAGCACAGAAAAAAATTGG - Intergenic
1012968942 6:105705732-105705754 GTTGAACCACAGAATACCATCGG + Intergenic
1014903334 6:126995871-126995893 GGAGGAGCACAGAAGATTTTGGG + Intergenic
1021031269 7:15739455-15739477 TAGGAAGAACAGAAGACTATGGG - Intergenic
1021543510 7:21787094-21787116 GGTGAAGCACAGGGGATTTTTGG + Intronic
1028096192 7:86764024-86764046 GGTGAAGTGGAGAAGACTCTAGG + Intronic
1031778014 7:125925161-125925183 AGTCAAGCACAGGATACTATAGG + Intergenic
1033046616 7:137967999-137968021 GTTGAAGCACACAAGACTTAGGG + Intronic
1034399571 7:150853128-150853150 GGTGGAGCACAGAAGATTTTGGG + Intronic
1035430117 7:158813276-158813298 ATTGAAGCACAGAAGATTTTAGG + Intronic
1035781868 8:2233944-2233966 GGAGAACCACAGAAGACCCTGGG + Intergenic
1035810251 8:2485462-2485484 GGAGAACCACAGAAGACCCTGGG - Intergenic
1036910546 8:12754594-12754616 GGGGAAGCAGAGGAGACTCTCGG + Intronic
1037208305 8:16353023-16353045 AGAGAATCACAGAAGACAATGGG - Intronic
1038507533 8:28097972-28097994 GATGCAGCACAGAAGAACATGGG - Intronic
1040137995 8:43877962-43877984 GGGGGAGCACTGAAGACTATGGG - Intergenic
1041343288 8:56868920-56868942 GGTGAAGCACACACTGCTATGGG - Intergenic
1047574341 8:126136362-126136384 GAAGAAGCCCAGAAGACTAGAGG - Intergenic
1047992833 8:130304561-130304583 GCAGATGCATAGAAGACTATTGG - Intronic
1052359768 9:27541288-27541310 GGTGAAGCACAGGAGCCTTGGGG - Intergenic
1054738833 9:68783973-68783995 GGCGAAGCACAGAAAACGAGGGG - Exonic
1054894969 9:70299411-70299433 GGAGAAGGACAGAAGGCTATGGG - Intronic
1055246599 9:74252871-74252893 GCTGAAGCACAGAATATTTTTGG + Intergenic
1062257706 9:135636639-135636661 GGTGAAGCACAAAGGAATTTTGG - Intronic
1185814129 X:3138367-3138389 GGTGGAGCACAGAGGATTTTAGG - Intergenic
1192947620 X:75983156-75983178 GTTGAAACACAGAGGCCTATGGG + Intergenic
1193424048 X:81319185-81319207 GGTGAAGAACTGAAGATAATTGG + Intergenic
1193499713 X:82260676-82260698 GGTAAAGCACAGAAAAAAATAGG + Intergenic
1194115520 X:89892026-89892048 GGTGAAGAACTGAAGATTACTGG - Intergenic
1196333165 X:114496047-114496069 GGTGTAGCAAAGAATACAATTGG + Intergenic
1197057476 X:122138066-122138088 GGTTAAGCACATAATGCTATGGG - Intergenic
1199660095 X:150040388-150040410 GGTGCATCACAGGTGACTATAGG - Intergenic
1199878790 X:151956317-151956339 GGAGAAGCACAGAATGCTTTTGG + Intronic
1200404498 Y:2796246-2796268 GAAGAAGAACAGAAGATTATGGG + Intergenic
1200468315 Y:3549160-3549182 GGTGAAGAACTGAAGATTACTGG - Intergenic
1201267578 Y:12223115-12223137 GGTGGAGCACAGAGGATTTTAGG + Intergenic